Composition for diagnosing colorectal cancer and application thereof

By designing specific primer pairs to identify the HMGN3Δ6 isomer and combining it with RT-PCR and agarose gel electrophoresis, the problems of insufficient specificity and accuracy in molecular diagnostic technology for colorectal cancer were solved, early accurate diagnosis and non-invasive detection were achieved, and potential targets for clinical treatment were provided.

CN120608155APending Publication Date: 2025-09-09BINZHOU MEDICAL COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510776114.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2025-09-09

AI Technical Summary

Technical Problem

Existing molecular diagnostic technologies for colorectal cancer lack specificity and accuracy in detecting splice variants, making it difficult to identify tumor-specific changes at an early stage, resulting in a low early diagnosis rate.

Method used

Specific primer pairs were designed to identify the HMGN3Δ6 isoform in the HMGN3 gene. The expression level of HMGN3Δ6 was detected by RT-PCR or qRT-PCR. The isoforms were distinguished by agarose gel electrophoresis. The RNA extraction and detection procedures were optimized. The results were normalized with an internal reference gene to improve the detection precision and accuracy.

Benefits of technology

It has achieved early and accurate diagnosis of colorectal cancer, improved the specificity and accuracy of detection, reduced patient pain and testing costs, provided a non-invasive detection method, and offered potential molecular targets for clinical treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120608155A_ABST
    Figure CN120608155A_ABST
Patent Text Reader

Abstract

The invention relates to the field of biological medicine, and discloses a composition for diagnosing colorectal cancer and application thereof.The composition for diagnosing colorectal cancer comprises a detection reagent capable of specifically recognizing an isomer in an HMGN3 gene, the isomer comprises an HMGN3 delta 6 isomer, and the detection reagent comprises a specific primer pair used for RT-PCR or qRT-PCR. The specific primer pair comprises a nucleotide sequence as shown in SEQ ID NO. 1 and a nucleotide sequence as shown in SEQ ID NO. 2. An HMGN3 delta 6 isomer is used as a specific marker, a specific primer pair is designed, colorectal cancer diagnosis is achieved, the specific primer pair is only complementary with HMGN3 delta 6, full-length isomer interference is avoided, the bottleneck of insufficient splicing variant detection specificity in traditional molecular diagnosis is broken through, and the detection precision is improved from the aspects of marker screening and primer design.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a composition for diagnosing colorectal cancer and applications thereof. Background Art

[0002] Colorectal cancer is a malignant tumor that poses a serious threat to human health. Its occurrence and development are closely related to abnormal gene expression regulation. Alternative splicing (AS), as a key link in gene expression regulation, can enable a single gene to produce multiple transcripts, thereby expanding protein diversity. Studies have shown that more than 90% of human genes undergo alternative splicing, and during tumorigenesis, abnormal alternative splicing events occur frequently, often leading to increased expression of cancer-promoting isoforms or decreased expression of tumor-suppressing isoforms. This abnormal splicing can promote tumor progression by regulating angiogenesis, cell invasion, immune escape, and other pathways. Therefore, targeting abnormal splicing variants to develop diagnostic markers has become an important research direction in precision medicine for tumors.

[0003] Currently, the molecular diagnostic technology for colorectal cancer is based on the detection of full-length gene expression (such as CEA protein detection). Due to the lack of the ability to distinguish splicing isoforms, it is difficult to identify tumor-specific changes in the early stages. The splicing variants that are specifically highly expressed in colorectal cancer are not screened out. The specificity and accuracy in splicing variant detection are insufficient, and the diagnostic value of abnormal splicing events cannot be utilized, resulting in a low early diagnosis rate. Summary of the Invention

[0004] In response to the deficiencies of the existing technology, the present invention provides a composition for diagnosing colorectal cancer and its application, which solves the problem of insufficient specificity and accuracy in the detection of splicing variants in traditional molecular diagnostic technology for colorectal cancer.

[0005] To achieve the above objectives, the present invention is implemented through the following technical solutions: a composition for diagnosing colorectal cancer, comprising a detection reagent capable of specifically identifying isomers in the HMGN3 gene, wherein the isomers include the HMGN3Δ6 isomer, and the detection reagent comprises a specific primer pair for RT-PCR or qRT-PCR, wherein the specific primer pair comprises the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2.

[0006] By adopting the above technical solution, the HMGN3Δ6 isomer is used as a specific marker and a specific primer pair is designed to achieve the diagnosis of colorectal cancer. The specific primer pair is only complementary to HMGN3Δ6, avoiding interference from the full-length isomer, breaking through the bottleneck of insufficient specificity of splicing variant detection in traditional molecular diagnosis, and improving detection accuracy from the aspects of marker screening and primer design. This solves the problem of insufficient specificity and accuracy of traditional molecular diagnostic technology for colorectal cancer in splicing variant detection, and provides an innovative solution for the early and accurate diagnosis of colorectal cancer.

[0007] Preferably, the method further comprises one or more of reagents for RNA extraction, reverse transcription reagents, PCR buffer, dNTPs, and DNA polymerase.

[0008] Preferably, it further comprises an internal reference gene for quantitative detection, and the internal reference gene is GAPDH.

[0009] According to the use of the above-mentioned composition for diagnosing colorectal cancer in the preparation of a colorectal cancer diagnostic reagent or kit.

[0010] Preferably, the diagnostic reagent or kit is used to detect the expression level of HMGN3Δ6 in a biological sample, and the biological sample includes a tissue sample, a cell sample or a body fluid sample.

[0011] Preferably, the detecting of biological samples comprises the following steps:

[0012] Extract RNA from the sample to be tested;

[0013] The extracted RNA is amplified by RT-PCR or qRT-PCR using specific primers to obtain amplified products;

[0014] The expression level of the amplified product is detected to determine the expression level of HMGN3Δ6 in the sample to be tested, thereby assisting in the diagnosis of colorectal cancer.

[0015] Preferably, in the auxiliary diagnosis of colorectal cancer, when the expression level of HMGN3Δ6 is higher than that of the normal control sample, the sample to be tested is determined to be positive for colorectal cancer.

[0016] Preferably, the diagnostic reagent or kit further comprises a reagent for agarose gel electrophoresis, for distinguishing the amplified products of HMGN3Δ6 from the full-length HMGN3 FL.

[0017] The present invention provides a composition for diagnosing colorectal cancer and its application. It has the following beneficial effects:

[0018] 1. This invention uses the HMGN3Δ6 isomer as a specific marker and designs specific primer pairs to achieve the diagnosis of colorectal cancer. The specific primer pairs are complementary only to HMGN3Δ6, avoiding interference from the full-length isomer. This breaks through the bottleneck of insufficient specificity of splice variant detection in traditional molecular diagnosis, improves detection accuracy from the aspects of marker screening and primer design, and solves the problem of insufficient specificity and accuracy in splice variant detection in traditional molecular diagnostic technology for colorectal cancer. It provides an innovative solution for the early and accurate diagnosis of colorectal cancer.

[0019] 2. By designing specific primers spanning the splice sites of exons 5-7, the present invention discovered that HMGN3Δ6 of the HMGN3 gene is specifically and highly expressed in colorectal cancer tissues, while the full-length isomer HMGN3 FL showed no significant changes. This allows for precise identification of HMGN3Δ6, eliminates interference from HMGN3 FL and other isomers, and improves the specificity of colorectal cancer diagnosis. This marker shows significant differential expression in colorectal cancer samples from multiple public databases, providing a reliable molecular biological basis for clinical diagnosis.

[0020] 3. By optimizing the RNA extraction and detection process, the present invention can still effectively detect the expression level of HMGN3Δ6 in non-invasive samples (such as blood and feces). It can be applied to a variety of biological samples, including tissue samples, cell samples and body fluid samples, providing a convenient and non-invasive detection method for early screening of colorectal cancer. Compared with traditional diagnostic methods that rely on tissue biopsy, it reduces patient pain and detection costs, and improves screening efficiency and accessibility.

[0021] 4. The present invention not only quantitatively detects the expression level of HMGN3Δ6 through qRT-PCR but also includes agarose gel electrophoresis reagents, which can visually distinguish the two isoforms based on the difference in amplification product length (HMGN3Δ6 is 169 bp, and HMGN3 FL is 262 bp). This effectively eliminates the interference of nonspecific amplification and further improves the accuracy of diagnosis. By comparing the electrophoretic band patterns, the reliability of the qRT-PCR results can be quickly verified, providing more comprehensive information support for clinical decision-making.

[0022] 5. The present invention not only reveals the value of HMGN3Δ6 as a diagnostic marker, but also confirms its key role in the proliferation of colorectal cancer cells through cell function experiments. Knocking down HMGN3Δ6 can inhibit the proliferation and cloning ability of cancer cells, while regulating splicing to shift towards HMGN3Δ6 promotes cell growth. This suggests that HMGN3Δ6 can be used as a potential molecular target for the treatment of colorectal cancer, providing a theoretical basis for the development of targeted therapeutic drugs or gene therapies, and has broad clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the differential expression of HMGN3 transcripts in colorectal cancer of the present invention;

[0024] Figure 2 Schematic diagram of the RT-PCR primer design and the effect of knocking down HMGN3Δ6 on SW480 cells of the present invention;

[0025] Figure 3 Schematic diagram of the functional universality of HMGN3Δ6 verified in multiple cell lines of the present invention;

[0026] Figure 4 Schematic diagram of the expression and function of dRfxCas13d regulating HMGN3 splicing isoforms of the present invention. DETAILED DESCRIPTION

[0027] The following will clearly and completely describe the technical solution of the present invention in conjunction with the accompanying drawings. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0028] Please see the attached Figure 1 -Attached Figure 4 An embodiment of the present invention provides a composition for diagnosing colorectal cancer, comprising a detection reagent capable of specifically identifying isomers in the HMGN3 gene, wherein the isomers include the HMGN3Δ6 isomer, and the detection reagent includes a specific primer pair for RT-PCR or qRT-PCR, wherein the specific primer pair includes the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2.

[0029] Specifically, the composition enables the diagnosis of colorectal cancer by specifically recognizing the Δ6 splice variant of the HMGN3 gene (HMGN3Δ6). The core principle is that this isoform is formed by direct splicing of exons 5 and 7 of the HMGN3 gene, lacking exon 6 of the full-length transcript (HMGN3 FL). This structural difference leads to abnormally high expression of HMGN3Δ6 in colorectal cancer tissues, while HMGN3 FL expression remains unchanged, making it a specific biomarker for colorectal cancer.

[0030] The specific primer pair (SEQ ID NO. 1 and SEQ ID NO. 2) included in the detection reagent is designed to amplify only HMGN3Δ6, but not HMGN3FL, by spanning the splice site between exons 5 and 7. The nucleotide sequence of SEQ ID NO. 1 is 5'-CCAGATTGTCAGCGAAACCT-3', and the nucleotide sequence of SEQ ID NO. 2 is 5'-GCCTCTTCAGCTTTAGTTTCAC-3'. These primers complement specific regions of the HMGN3Δ6 transcript, ensuring selective amplification of the target fragment during RT-PCR or qRT-PCR reactions. The amplified product obtained using this primer pair is 169 bp in length, significantly different from the 262 bp product of HMGN3 FL and can be visually distinguished by agarose gel electrophoresis. This design not only eliminates interference from HMGN3FL but also utilizes the unique structure of the exon 5-7 splice site, resulting in highly specific detection results. In practical applications, this combination, combined with an internal reference gene (such as GAPDH), can accurately quantify HMGN3Δ6 expression levels. When HMGN3Δ6 expression in a test sample is significantly higher than in a normal control, it suggests the sample may be derived from colorectal cancer tissue, providing a molecular biological basis for clinical diagnosis.

[0031] The method also includes one or more of reagents for RNA extraction, reverse transcription reagents, PCR buffer, dNTPs, and DNA polymerase. It also includes an internal reference gene for quantitative detection, wherein the internal reference gene is GAPDH.

[0032] Specifically, the RNA extraction reagent used was TRIzol reagent (Invitrogen). Its principle is to lyse cells and inactivate RNases through the synergistic action of guanidine isothiocyanate and phenol, thereby extracting total RNA from biological samples, ensuring the integrity and purity of the RNA and providing a high-quality template for subsequent reverse transcription. The reverse transcription reagent used was HiScript IIQ RT SuperMix (Vazyme), which contains reverse transcriptase, dNTPs, and a buffer system. It can reverse transcribe the extracted RNA into cDNA. In this process, the reverse transcriptase uses RNA as a template to synthesize a complementary DNA chain, providing a template for PCR amplification.

[0033] PCR buffer (such as the buffer system in ChamQ SYBR qPCR Master Mix) is used to maintain the optimal pH and ionic strength for the PCR reaction. dNTPs (deoxyribonucleoside triphosphates) serve as the raw materials for DNA synthesis. Under the catalysis of a DNA polymerase (such as Taq enzyme), the target DNA fragment is synthesized along the primer extension direction. Specifically, using the cDNA as a template and guided by the primer, the DNA polymerase exponentially amplifies the HMGN3Δ6-specific sequence through a chain polymerization reaction of dNTPs, ensuring the sensitivity and specificity of the detection.

[0034] In addition, the internal reference gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase) included in the composition is used to standardize quantitative detection. Since GAPDH is stably expressed in various tissues as a housekeeping gene, its corresponding primer pair (sequences known in the art) can be synchronously amplified as an internal reference. The relative expression level of HMGN3Δ6 is calculated using the 2^-ΔΔCt method, eliminating differences in RNA extraction efficiency, reverse transcription efficiency, and PCR reaction efficiency between different samples. This makes the HMGN3Δ6 expression level detection results more comparable and accurate, thereby ensuring the reliability of colorectal cancer diagnosis.

[0035] The above-mentioned composition for diagnosing colorectal cancer is used to prepare a colorectal cancer diagnostic reagent or kit. The diagnostic reagent or kit is used to detect the expression level of HMGN3Δ6 in a biological sample, including a tissue sample, a cell sample, or a body fluid sample. The diagnostic reagent or kit also contains a reagent for agarose gel electrophoresis to distinguish the amplified products of HMGN3Δ6 from those of full-length HMGN3 FL.

[0036] Specifically, when the composition is used to prepare a colorectal cancer diagnostic reagent or kit, its application is based on the molecular characteristics of HMGN3Δ6 being specifically and highly expressed in colorectal cancer tissues, and disease diagnosis is achieved by detecting the expression level of this isoform in biological samples. Biological samples include tissue samples, cell samples or body fluid samples, among which tissue samples can be obtained by surgical resection or puncture, cell samples can be obtained from exfoliated cells or cultured cells, and body fluid samples include non-invasive specimens such as blood and feces. The selection of these sample types meets the detection needs of different clinical scenarios. The agarose gel electrophoresis reagent contained in the diagnostic reagent or kit is used to separate and distinguish the amplified products of HMGN3Δ6 and full-length HMGN3 FL by electrophoresis. The specific principle is: after RT-PCR or qRT-PCR reaction, the amplified product of HMGN3Δ6 (169bp) and the product of HMGN3 FL (262bp) have different molecular weight differences and migrate at different rates in the agarose gel under the action of an electric field, thereby forming bands at different positions on the gel. After staining with nucleic acid dyes such as GelRed, the band position and brightness can be directly observed under ultraviolet light, enabling intuitive distinction between the two isomers.

[0037] The key to this differentiation mechanism lies in the design of a specific primer pair: the nucleotide sequences represented by SEQ ID NO. 1 and SEQ ID NO. 2 target only the exon 5-7 splice site of HMGN3Δ6 and do not bind to exon 6 of HMGN3 FL, ensuring the specificity of the amplified product. By comparing the banding patterns of the sample with known positive and negative controls, HMGN3Δ6 expression can be accurately determined. The presence of a distinct 169 bp band in the sample, with a brightness higher than that of the normal control, indicates high HMGN3Δ6 expression. Combined with its association with colorectal cancer, this approach can assist clinicians in making diagnostic decisions. This electrophoretic differentiation step not only verifies the validity of PCR amplification but also eliminates interference from nonspecific amplification by using product length differences, further improving diagnostic accuracy. Furthermore, the use of the amplified band of the internal reference gene GAPDH as a loading control can correct for experimental errors and enhance the reliability of the test results.

[0038] Testing a biological sample involves the following steps:

[0039] Extract RNA from the sample to be tested;

[0040] The extracted RNA is amplified by RT-PCR or qRT-PCR using specific primers to obtain amplified products;

[0041] The expression level of the amplified product is detected to determine the expression level of HMGN3Δ6 in the test sample, thereby assisting in the diagnosis of colorectal cancer. In assisting the diagnosis of colorectal cancer, when the expression level of HMGN3Δ6 is higher than that of the normal control sample, the test sample is determined to be positive for colorectal cancer.

[0042] Specifically, the expression of the amplified product and the determination of HMGN3Δ6 expression levels were determined using real-time quantitative PCR (qRT-PCR) combined with standardization using an internal reference gene. Specifically, after RNA extraction and reverse transcription, cDNA was amplified by qRT-PCR using the specific primers shown in SEQ ID NOs. 1 and 2. The reaction system included ChamQSYBR qPCR Master Mix (Vazyme). The accumulation of PCR products was monitored in real time using a fluorescent probe or SYBR Green dye. GAPDH was also amplified as an internal reference gene, leveraging its stable expression to balance detection errors between samples.

[0043] Expression levels were calculated using the 2^-ΔΔCt method: First, the Ct difference (ΔCt) between the target gene (HMGN3Δ6) and the internal reference gene (GAPDH) was calculated. The ΔCt of the test sample was then compared with the ΔCt of the normal control sample (ΔΔCt). Finally, relative expression was calculated using the 2^-ΔΔCt method. The normal control sample was derived from pathologically confirmed non-colorectal cancer tissue, and its HMGN3Δ6 expression level served as a baseline threshold. When the relative expression level of HMGN3Δ6 in the test sample exceeded the set threshold (e.g., more than 2-fold) of the normal control sample, the patient was considered positive for colorectal cancer. The combination of fluorescence quantification and internal reference normalization not only accurately quantified HMGN3Δ6 expression levels but also eliminated experimental errors, ensuring reproducible diagnostic results and clinically valuable. This auxiliary diagnostic method provides objective molecular biological evidence for the early detection of colorectal cancer by detecting specific markers at the molecular level.

[0044] The following is a further introduction with reference to specific embodiments

[0045] Example 1

[0046] To analyze the differential expression of HMGN3 splice variants in normal and colorectal cancer tissues, we downloaded RNA sequencing data from public databases, including projects PRJCA001118, SRP024880, and SRP107926. The transcript structure of HMGN3 was analyzed using GENCODE annotation information. The full-length transcript (HMGN3 FL) contains exons 5, 6, and 7, while the splice variant HMGN3Δ6 lacks exon 6 and consists only of exons 5 and 7. RNA-seq data were processed using fastp software and aligned to the human hg38 reference genome using hisat2. Transcript-level expression was then quantified using Salmon software, resulting in TPM (transcripts per million) expression values ​​for HMGN3 FL and HMGN3Δ6 in each sample. After all expression data were summarized, statistical analysis and visualization were performed using R language. The Wilcoxon rank sum test was used to compare expression differences. The ggplot2 and ggpubr packages were used for plotting. Violin plots showed the expression distribution of the two splicing variants in different tissues, and statistical significance was annotated.

[0047] As attached Figure 1 The figure shows the expression of HMGN3 gene transcripts HMGN3Δ6 and HMGN3 FL in different datasets. Part A lists different HMGN3 transcript variants, including the full-length transcript (HMGN3 FL) and a splice variant lacking exon 6 (HMGN3Δ6). Part B, based on statistical results from three datasets (PRJCA001113, SRP029880, and SRP107326), shows that HMGN3Δ6 expression in colorectal cancer samples is significantly different from that in normal intestinal tissue, while the expression of the full-length transcript HMGN3 FL is not significantly different. This suggests that the HMGN3Δ6 splice variant may have a specific role in cancer and warrants further investigation. The TPM values ​​of HMGN3Δ6 in CRC samples were significantly increased, while the expression of HMGN3 FL was not statistically different, confirming that HMGN3Δ6 can serve as a specific expression marker for colorectal cancer.

[0048] 1. Cell Culture and Stable Viral Knockdown

[0049] To achieve specific knockdown of HMGN3-FL and HMGN3Δ6 isoforms, this study constructed a lentiviral expression vector based on the RfxCas13d system, using a targeted gRNA to guide Cas13d to specifically degrade the target transcript at the RNA level. SW480 cells were used for this experiment. Cells were cultured in high-glucose DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin-streptomycin at 37°C and 5% CO2.

[0050] To stably knock down HMGN3Δ6 or HMGN3 FL, a lentiviral expression vector based on the RfxCas13d system was constructed, and the following targeting gRNA sequences were designed and cloned:

[0051] HMGN3Δ6guide1:TTCAGTTTTCTGTGCCTCTTCAGCTTTAGT(SEQ ID NO.5)

[0052] HMGN3Δ6guide2: AGTTTTCTGTGCCTCTTCAGCTTT (SEQ ID NO.6)

[0053] HMGN3 FL guide1:GCGAGAGATGTGGATCTCTTCAGCTTTAGT(SEQ ID NO.7)

[0054] HMGN3 FL guide2:AGAGATGTGGATCTCTTCAGCTTT(SEQ ID NO.8)

[0055] Non-targeting control guide (NT-guide): GCAGGGTTTTCCCAGTCACGACGTTGTAAA (SEQ ID NO. 9)

[0056] HEK293T cells were co-transfected with a three-plasmid system (packaging vector psPAX2 and envelope vector pMD2.G) to produce viral particles. After 48 hours, the viral supernatant was collected, sterilized by filtration (0.45 μm filter), and used to infect target cells.

[0057] 8 μg / mL Polybrene (Sigma) was added to cells during infection to enhance infection efficiency. Puromycin was used for selection 48 hours after infection to obtain cell lines stably expressing gRNA.

[0058] All subsequent experiments were performed based on the screened stable knockdown cells.

[0059] 2. qRT-PCR detection of gene knockdown efficiency

[0060] 48 hours after transfection, total cellular RNA was extracted (TRIzol Reagent, Invitrogen) and reverse transcribed using HiScriptIIQ RT SuperMix. qRT-PCR was performed on an ABI QuantStudio system using ChamQ SYBR qPCR Master Mix (Vazyme). To verify the expression levels of the full-length HMGN3 transcript (HMGN3-FL) and the splice variant HMGN3-Δ6, specific qRT-PCR primers for both isoforms were designed. Primers were designed based on the GENCODE-annotated HMGN3 transcript sequence using the Primer-BLAST (NCBI) online tool. Sequence alignment was performed to ensure specific recognition of the target isoform. Among them, the primers for HMGN3-FL span the splicing region of exon 6 and can specifically amplify the FL transcript containing E6; while the primers for HMGN3-Δ6 span the direct splicing region between E5 and E7 and can only successfully amplify transcripts lacking E6, thereby achieving differentiated detection of the two transcripts.

[0061] Specific primers were designed for HMGN3Δ6 and HMGN3FL isoforms, respectively. GAPDH was used as an internal reference gene. Relative expression levels were calculated using the 2^-ΔΔCt method, as shown in the following table:

[0062]

[0063] As attached Figure 2The figure shows that our designed RT-PCR primers specifically recognize HMGN3-FL and HMGN3Δ6 isoforms, with their product fragments differing by 93 bp in size. RT-PCR results indicate that splicing of exon 6 of the HMGN3 gene occurs in colorectal cancer cells. Knockdown of the HMGN3Δ6 transcript isoform significantly reduced the proliferation and colony-forming ability of colorectal cancer cell lines SW480, while knockdown of the HMGN3 FL isoform had no significant effect on cell proliferation and colony-forming ability. At the same time, a lentiviral system was used to construct CRISPR / RfxCas13d knockdown of HMGN3Δ6 and stable cell lines with knockdown of HMGN3Δ6, and SW480 cells were subcutaneously injected to construct a subcutaneous tumor model in mice. The results showed that the proliferation ability of colorectal cancer cells with HMGN3Δ6 knockdown was significantly inhibited, while knockdown of the HMGN3 FL isoform had no obvious effect on colorectal cancer growth. These data suggest that HMGN3Δ6 plays an important role in the proliferation of colorectal cancer cells, and specific primers can effectively distinguish the amplification products of HMGN3Δ6 and FL; after knocking down HMGN3Δ6, the OD570 value and clone number of SW480 cells decreased significantly, confirming the promoting effect of HMGN3Δ6 on cell proliferation.

[0064] 3. Cell proliferation assay (MTT assay)

[0065] 24 hours after transfection, cells were seeded at 2000 cells / well in a 96-well plate. MTT solution (final concentration 0.5 mg / mL) was added at 24, 48, 72, and 96 hours. After incubation for 4 hours, 150 μL of DMSO was added to dissolve the crystals. After gentle shaking for 10 minutes, the absorbance (OD570) was measured at 570 nm.

[0066] The experimental groups were set up as follows:

[0067] NT-guide group (non-targeted control)

[0068] HMGN3Δ6guide1 group

[0069] HMGN3Δ6guide2 group

[0070] HMGN3 FL guide1 group

[0071] HMGN3 FL guide2 group

[0072] There were 5 replicate wells in each group, and the experiment was repeated 3 times.

[0073] 4. Colony Formation Assay

[0074] 48 hours after transfection, count cells and seed at a density of 500 cells / well in 6-well plates. Continue culturing for 10-14 days. Once colonies are visible, fix with 4% paraformaldehyde for 20 minutes, stain with 0.5% crystal violet for 15 minutes, rinse with PBS, and air-dry. Photograph under a microscope and count colonies manually or using ImageJ software. Each colony is defined as a cluster of >50 cells.

[0075] As attached Figure 3 As shown, the effects of knocking down HMGN3Δ6 and HMGN3 FL on cell proliferation and clone formation were further verified in additional colorectal cancer cell lines. Knockdown of the HMGN3Δ6 transcript isoform significantly reduced the proliferation and clone formation abilities of colorectal cancer cells LoVo and HCT-116, while knockdown of the HMGN3 FL isoform had no significant effect on cell proliferation and clone formation abilities. These data suggest that HMGN3Δ6 plays an important role in the proliferation of various colorectal cancer cells. Experiments were repeated in LoVo and HCT-116 cells, and results consistent with those in SW480 cells were observed: the OD450 value and colony number in the HMGN3Δ6 knockdown group were significantly lower than those in the control group, indicating that the pro-proliferation effect of HMGN3Δ6 is universal across various colorectal cancer cells.

[0076] To specifically regulate the expression levels of the two major splicing isoforms of HMGN3 (HMGN3 FL and HMGN3Δ6), this study employed a deactivated RfxCas13d system (dRfxCas13d), which regulates RNA splicing by recruiting regulatory factors rather than directly degrading them. Unlike traditional RfxCas13d, dRfxCas13d is an RNA-targeting tool that can regulate transcript fate through RNA binding in the absence of nuclease activity, making it suitable for intervening in alternative splicing events. We constructed a lentiviral vector stably expressing dRfxCas13d and inserted a specific gRNA sequence into it to target the HMGN3 pre-mRNA. All designed gRNA sequences were structurally evaluated and validated for specificity using RNAfold and BLAST, and ultimately sequences with high conservation and low off-target risk were selected for constructing expression vectors.

[0077] As attached Figure 4As shown, dRfxCas13d technology was used to target HMGN3 isoforms, achieving the conversion of HMGN3 FL and HMGN3Δ6 splicing isoforms. This resulted in increased expression of the isoform HMGN3Δ6 and decreased expression of HMGN3FL. The results showed that increased expression of HMGN3Δ6 significantly promoted the proliferation and cloning of colorectal cancer cells LoVo and DLD1, suggesting that HMGN3 exon 6 splicing can be used as a specific therapeutic target for colorectal cancer. dRfxCas13d technology successfully induced splicing to shift toward HMGN3Δ6, resulting in a significant increase in cell OD value and colony number, confirming the cancer-promoting effect of HMGN3Δ6 and its potential as a therapeutic target from both positive and negative aspects.

[0078] The gRNAs used are as follows:

[0079] guide1:5'-ATGTGGATCTGCAATAACATTACAGGCAAT-3'(SEQ ID NO.10)

[0080] guide2:5'-TCTACTGTACCCTTAACTCTCACTGTTTCA-3'(SEQ ID NO.11)

[0081] guide3:5'-TGCTTTCTGCTTTTCAAACCACCACAGAAG-3'(SEQ ID NO.12)

[0082] Non-targeting control guide (NT-guide): GCAGGGTTTTCCCAGTCACGACGTTGTAAA (SEQ ID NO. 9)

[0083] RT-PCR detection of HMGN3 isoform expression

[0084] To simultaneously detect the expression of the full-length HMGN3 transcript (HMGN3 FL) and the splice variant (HMGN3 Δ6), conventional RT-PCR combined with agarose gel electrophoresis was performed. Total RNA was extracted using TRIzol reagent (Invitrogen) and reverse transcribed into cDNA using HiScript IIQ RT SuperMix (Vazyme). PCR amplification was performed using 2× Taq Master Mix (Vazyme). Primers spanned the region between exon 5 and exon 7 of HMGN3. This allowed for the difference in product length between FL and Δ6, depending on whether exon 6 was included, to be distinguished by electrophoresis.

[0085] The primers used are as follows:

[0086] Forward: 5'-TCTGCTAAGAAAGAACCTGGA-3'(SEQ ID NO.13)

[0087] Reverse: 5'-TGACAATTCATTCTCCCTCGT-3'(SEQ ID NO.14)

[0088] Reaction conditions were as follows: pre-denaturation at 95°C for 3 minutes; 35 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds; and extension at 72°C for 5 minutes. PCR products were separated by electrophoresis on a 2% agarose gel (voltage: 120V, time: 25-30 minutes) and stained with GelRed. Bands were visualized using a gel imaging system (Bio-Rad). The HMGN3 FL amplified product is approximately 262 bp, while the HMGN3Δ6 product, due to the deletion of exon 6, is approximately 169 bp. The two are clearly distinguishable on the electropherogram. Band intensity indirectly reflects the relative expression levels of the two splice isoforms.

[0089] The sequence of the present invention is as follows:

[0090] SEQ ID NO.1

[0091] CCAGATTGTCAGCGAAACCT

[0092] SEQ ID NO.2

[0093] GCCTCTTCAGCTTTAGTTTCAC

[0094] SEQ ID NO.3

[0095] AACAGGAGCCCACAAGAC

[0096] SEQ ID NO.4

[0097] TGTGCTCTCACTGTTTCAATCTG

[0098] SEQ ID NO.5

[0099] TTCAGTTTCTGTGCCTCTTCAGCTTTAGT

[0100] SEQ ID NO.6

[0101] AGTTTTCTGTGCCTCTTCAGCTTT

[0102] SEQ ID NO.7

[0103] GCGAGAGATGTGGATCTCTTCAGCTTTAGT

[0104] SEQ ID NO.8

[0105] AGAGATGTGGATCTCTTCAGCTTT

[0106] SEQ ID NO.9

[0107] GCAGGGTTTTCCCAGTCACGACGTTGTAAA

[0108] SEQ ID NO.10

[0109] ATGTGGATCTGCAATAACATTACAGGCAAT

[0110] SEQ ID NO.11

[0111] TCTACTGTACCCTTAACTCTCACTGTTTCA

[0112] SEQ ID NO.12

[0113] TGCTTTCTGCTTTTCAAACCACCACAGAAG

[0114] SEQ ID NO.13

[0115] TCTGCTAAGAAAGAACCTGGA

[0116] SEQ ID NO.14

[0117] TGACAATTCATTCTCCCTCGT

[0118] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A composition for diagnosing colorectal cancer, comprising a detection reagent capable of specifically identifying isoforms in the HMGN3 gene, characterized in that: The isomers include HMGN3Δ6 isomers, and the detection reagent includes a specific primer pair for RT-PCR or qRT-PCR, wherein the specific primer pair includes the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. A composition for diagnosing colorectal cancer according to claim 1, characterized in that: It also includes one or more of reagents for RNA extraction, reverse transcription reagents, PCR buffer, dNTPs, and DNA polymerase.

3. The composition for diagnosing colorectal cancer according to claim 1, characterized in that: It also contains an internal reference gene for quantitative detection, and the internal reference gene is GAPDH.

4. Use of a composition for diagnosing colorectal cancer according to any one of claims 1 to 3 in the preparation of a colorectal cancer diagnostic reagent or kit.

5. The use according to claim 4, characterized in that: The diagnostic reagent or kit is used to detect the expression level of HMGN3Δ6 in a biological sample, and the biological sample includes a tissue sample, a cell sample or a body fluid sample.

6. The use according to claim 5, characterized in that: The detection of biological samples comprises the following steps: Extract RNA from the sample to be tested; The extracted RNA is amplified by RT-PCR or qRT-PCR using specific primers to obtain amplified products; The expression level of the amplified product is detected to determine the expression level of HMGN3Δ6 in the sample to be tested, thereby assisting in the diagnosis of colorectal cancer.

7. The use according to claim 6, characterized in that: In the auxiliary diagnosis of colorectal cancer, when the expression level of HMGN3Δ6 is higher than that of the normal control sample, the sample to be tested is determined to be positive for colorectal cancer.

8. The use according to claim 4, characterized in that: The diagnostic reagent or kit further comprises a reagent for agarose gel electrophoresis, which is used to distinguish the amplified products of HMGN3Δ6 from the full-length HMGN3 FL.