Haplotype SNP (Single Nucleotide Polymorphism) primer related to genetic potential of female parent feather color of half muscovy duck and application of haplotype SNP primer

Abstract

The invention relates to haplotype SNP (Single Nucleotide Polymorphism) primers related to heredity potential of female parent feather color of half muscovy ducks and application, and belongs to the technical field of biology. Nucleotide sequences of the SNP primers are as shown in SEQ ID NO: 1-SEQ ID NO: 8, every two primers correspond to one SNP site, the SNP sites are sequentially located at the 6462091th basic group on chromosome 10 of a duck reference genome ZJU1.0 version, and the basic groups are mutated into T or C; at the 6456655th basic group, the basic group is mutated into G or A; at the 6453471th basic group, the basic group is mutated into T or C; at the 6452579th basic group, the basic group is mutated into T or C. The haplotype molecular marker which is relatively high in accuracy and can be used for female parent breeding of half muscovy ducks is obtained. The method has the beneficial effects that female parent individuals with high white feather rate of offspring half muscovy ducks can be screened out, and early molecular marker-assisted breeding of the female parents of the half muscovy ducks is guided.

Description

Technical Field

[0001] The invention relates to a haplotype SNP primer related to the genetic potential of the female parent feather color of a Mule duck and an application thereof, belonging to the field of biotechnology. Background Art

[0002] Mule ducks are the offspring of distant hybridization between Muscovy ducks and domestic ducks. They are sterile and therefore also called mule ducks. Mule ducks exhibit significant hybrid vigor, characterized by docility, tolerance to roughage, rapid early growth, high feed conversion, high lean meat percentage, and delicious meat. Plumage color is a key packaging trait for Mule ducks, with white feathers being preferred for both carcass aesthetics and down processing. However, the hybrids of male and female Cherry Valley ducks, used in current Mule duck breeding programs, produce low white feather rates, severely impacting the production efficiency and economic benefits of white-feathered Mule ducks. Reciprocal cross experiments have shown that the dominant influence on white feather rate in Mule ducks is the female parent, and that white feather rates vary between different female genotypes. Cherry Valley ducks, which are the female parents of Mule ducks, all have white feathers, and cannot be directly selected based on the female parent's feather color phenotype. The traditional breeding method uses the progeny determination method, that is, the feather color phenotype (white feather rate) of the Mule duck offspring obtained by hybridizing white-feathered male Muscovy ducks with Cherry Valley ducks is counted to select the female parent. This method is time-consuming and labor-intensive. Summary of the Invention

[0003] The purpose of the present invention is to address the defects of the existing technology, propose a haplotype SNP primer related to the genetic potential of the maternal feather color of the semi-Muggy duck and its application, and provide a rapid and simple gene analysis method for the breeding of the maternal feather color genetic potential of the semi-Muggy duck.

[0004] The present invention achieves the purpose of the invention through the following technical solutions. First, primers corresponding to haplotype molecular markers related to the genetic potential of the female parent's feather color of the semi-Muscovy duck are provided. The nucleotide sequences are shown in SEQ ID NO: 1-SEQ ID NO: 8. Each of the two primers corresponds to four SNP sites, SNP1-SNP4, on chromosome 10 of the duck reference genome ZJU1.0 version. The gene position of SNP1 is NC_051781.1: 6462091, where the base is T or C; the gene position of SNP2 is NC_051781.1: 6456655, where the base is G or A; the gene position of SNP3 is NC_051781.1: 6453471, where the base is T or C; and the gene position of SNP4 is NC_051781.1: 6452579, where the base is T or C.

[0005] The present invention further provides the use of the above primers for detecting the genetic potential of the female parent feather color of the Mule duck. The detection method comprises the following steps: The first step is to provide a DNA sample of a mule duck mother to be tested, and perform PCR amplification using the SNP primers shown in SEQ ID NOs: 1-8 to obtain a PCR product; The second step is to perform Sanger sequencing on the PCR products; Step 3: Determine the genotype of the PCR product based on the sequencing results of step 2. The final volume of the PCR amplification reaction system in the above method is 20 μL. Upstream and downstream primers 50 nM 2 μL, dNTP 2.5 mM 0.8 μL, Taq enzyme 5 U / μL 0.2 μL, Contains Mg 2+ 2 μL of 10× PCR Buffer, 2 μL of DNA from the female parent of the Mule duck to be tested (20 ng / μL), Add ultrapure water to make up to 20 μL.

[0006] PCR amplification conditions were as follows: 95°C for 5 min, 1 cycle; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, 30 cycles; and 72°C for 10 min.

[0007] The nucleotide sequences of the amplified products are shown in SEQ ID NO: 9 to SEQ ID NO: 24.

[0008] When the PCR products were CGCC homozygous genotypes, the corresponding offspring of the Mule duck mother had a higher white feather rate; when the PCR products were TATT homozygous genotypes, the corresponding offspring of the Mule duck mother had a lower white feather rate.

[0009] After resequencing the Cherry Valley duck genome, the present study used plumage color scores from its Mule duck offspring as a proxy for plumage genetic potential. Genome-wide association analysis was then performed on Mule duck maternal lines. Significantly associated molecular markers were identified and subsequently validated in a population setting. This yielded highly accurate haplotype molecular markers that can be used for Mule duck maternal breeding. This approach facilitates the selection of maternal individuals with a high white feather rate in their offspring, guiding early molecular marker-assisted breeding of Mule duck maternal lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 Manhattan plot based on genome-wide association analysis of the genetic potential of maternal plumage color in Mule ducks.

[0011] Figure 2 Violin plot showing the feather color scoring results of offspring from female parents with different haplotypes. DETAILED DESCRIPTION

[0012] The present invention is further described in detail below with reference to specific examples. Unless otherwise noted, the equipment and reagents used in each example, embodiment, and comparative example are commercially available. The following experiments were conducted at the breeding farm of Jiangsu Guiliu Animal Husbandry Group Co., Ltd. The white-feathered Muscovy ducks and Cherry Valley ducks involved in the experiments are both proprietary strains cultivated within the company over many years. The half-Muscovy ducks are a hybrid of the white-feathered Muscovy ducks and Cherry Valley ducks.

[0013] Example Genome-wide association study (GWAS) of the genetic potential of maternal plumage color in Mule ducks Five male white-feathered Muscovy ducks were randomly crossed with 300 female Cherry Valley ducks. Each egg was labeled with its maternal parentage and hatched to ensure that each female produced at least 10 half-Muscovy duck offspring. Each half-Muscovy duck was scored based on the distribution and area of ​​black feathers on its body. The average feather color score of each female's offspring was calculated as the genetic potential for feather color in Cherry Valley ducks. Wing vein blood was collected from all 300 Cherry Valley ducks, and genomic DNA was extracted. Genome resequencing was performed using an Illumina sequencer. After initial quality control of the off-line data, alignment with the duck reference genome ZJU1.0 was performed, and further SNPs were identified using Plink software. A total of 4,995,395 high-quality SNPs were identified for subsequent genome-wide association studies.

[0014] A genome-wide association analysis of the maternal plumage genetic potential was performed using the gemma software, using a mixed linear model. The model formula is as follows: , where y is the genetic potential of feather color vector, represents the group structure effect, W is the covariate matrix (including a column vector and 5 principal components with fixed effects), is a column vector of corresponding coefficients including the intercept; represents the SNP effect, is the marker genotype vector, is the size of the marker site effect; is the individual random effect vector, subject to distributed, is calculated by SNPs markers Kinship matrix, is the polygenic additive variance; represent Random error vector.

[0015] The results of GWAS analysis found that 645 significant loci related to the genetic potential of feather color were identified on chromosome 10 (NC_051781.1). After functional annotation, two loci, 2674 and 1782 upstream of the EDNRB2 gene, and two loci in the intron region of the EDNRB2 gene, had a significant effect on the genetic potential of feather color. The information of the four loci is shown in Table 1. Table 1

[0016] Molecular marker validation Primers were designed for the four loci, Table 2

[0017] (1) The total length of the SNP1 amplification product is 334 bp, with a t / c mutation at bp 143 (based on SEQ ID NO: 9). Its nucleotide sequences are shown in SEQ ID NO: 9, SEQ ID NO: 10, and their reverse complement sequences are shown in SEQ ID NO: 11 and SEQ ID NO: 12.

[0018] tgctgacatt gccacgtagt gattggactg catcattttg ctttcttttc tcctgcttcattgcctatct cagcttagct tttttctccc cgcaatgttc cttctcccag gtagccccca tgtacctctgggggtggaag tgtagggaaa aggcagccag tggtctgtgc tgcatgggta cagcccatgc cagaggcattcatctggtac ctcctgcctt ggtcagcaat gctcacagat gtctccagct tgcctgactc tggacctcggtgaactcttt ctacaccctg gtggatgtcc ctgacacagg caggcctggg ttggggtgtt tttg SEQ IDNO:9 tgctgacatt gccacgtagt gattggactg catcattttg cttcttttc tctgcttcattgcctatct cagcttagct ttttctccc cgcaatgttc cttctcccag gtagccccca tgtacctctgggggtggaag tgcagggaaa aggcagccag tggcatgctc tgcatcgcgc cagaggcattcatctggtac ctcctgcctt ggtcagcaat gctcacagat gtctccagct tgcctgactc tggacctcggtgaactcttt ctacaccctg gtggatgtcc ctgacacagg caggcctggg ttggggtgtt tttg SEQ IDNO:10 caaaaacacc ccaacccagg cctgcctgtg tcagggacat ccaccagggt gtagaaagagttcaccgagg tccagagtca ggcaagctgg agacatctgt gagcattgct gaccaaggca ggaggtaccagatgaatgcc tctggcatgg gctgtaccca tgcagcaggcag accactttccct gccc tacatggggg ctacctggga gaaggaacat tgcggggaga aaaaagctaa gctgagataggcaatgaagc aggagaaaag aaagcaaaat gatgcagtcc aatcactacg tggcaatgtc agca SEQ IDNO:11 caaaaacacc ccaacccagg cctgcctgtg tcagggacat ccaccagggt gtagaaagagttcaccgagg tccagagtca ggcaagctgg agacatctgt gagcattgct gaccaaggca ggaggtaccagatgaatgcc tctggcatgg gctgtaccca tgcagcacag accactggct gccttttccc tacacttccacccccgagg tacatggggg ctacctggga gaaggaacat tgcggggaga aaaaagctaa gctgagataggcaatgaagc aggagaaaag aaagcaaaat gatgcagtcc aatcactacg tggcaatgtc agca SEQ IDNO:12 (2) The total length of the SNP2 amplification product is 281 bp, with a g / a mutation at the 197th bp (based on SEQ ID NO: 11). Its nucleotide sequences are shown in SEQ ID NO: 13, SEQ ID NO: 14, and their reverse complementary sequences SEQ ID NO: 15 and SEQ ID NO: 16.

[0019] aaatgagcag tgtcgggagg aaacttgcaa attattccca gttacacatc aaacgtagga aataaaataa ccaaatccct tcagccacag ttcagacctc accaactaga cagcttagct ctcagttctg ttaaagcagc cacattttga agaggttttc tttctagttt gaacccctgt gttgtgatgg caccttggat atggtttcac cacaggaaag ttaaagaccc catcgctttt cttttcagct caccatcagc atgcttcccc gcgctaaaat a SEQ ID NO:13 aaatgagcag tgtcgggagg aaacttgcaa attattccca gttacacatc aaacgtagga aataaaataa ccaaatccct tcagccacag ttcagacctc accaactaga cagcttagct ctcagttctg ttaaagcagc cacattttga agaggttttc tttctagttt gaacccctgt gttgtgatgg caccttagat atggtttcac cacaggaaag ttaaagaccc catcgctttt cttttcagct caccatcagc atgcttcccc gcgctaaaat a SEQ ID NO:14 tattttagcg cggggaagca tgctgatggt gagctgaaaa gaaaagcgat ggggtcttta actttcctgt ggtgaaacca tatccaaggt gccatcacaa cacaggggtt caaactagaa agaaaacctc ttcaaaatgt ggctgcttta acagaactga gagctaagct gtctagttgg tgaggtctga actgtggctg aagggatttg gttattttat ttcctacgtt tgatgtgtaa ctgggaataa tttgcaagtt tcctcccgac actgctcatt t SEQ ID NO:15 tattttagcg cggggaagca tgctgatggt gagctgaaaa gaaaagcgat ggggtcttta actttcctgt ggtgaaacca tatctaaggt gccatcacaa cacaggggtt caaactagaa agaaaacctc ttcaaaatgt ggctgcttta acagaactga gagctaagct gtctagttgg tgaggtctga actgtggctg aagggatttg gttattttat ttcctacgtt tgatgtgtaa ctgggaataa tttgcaagtt tcctcccgac actgctcatt t SEQ ID NO:16 (3) The total length of the SNP3 amplification product is 251 bp, with a t / c mutation at the 97th bp (based on SEQ ID NO:13). Its nucleotide sequences are shown in SEQ ID NO:17, SEQ ID NO:18 and their reverse complementary sequences SEQ ID NO:19 and SEQ ID NO:20.

[0020] ggaaccactc ctttccccag gggctcgtgg ttgacaccta cgtggaggga tggtccaggc aacaggtcct gaacccacac cctgggtgtt tttgggtgga ctggaatccg aaaaaccaca atgggctttg ggtcgctttt gggggtgtc gtgctccgag cagccagagt ccaacaagga gagcttgttt cagagccatg taggctcatg tcctcaccgt gctctgccct tctgccatgc ctttgtgcaa a SEQ ID NO:17 ggaaccactc ctttccccag gggctcgtgg ttgacaccta cgtggaggga tggtccaggc aacaggtcct gaacccacac cctgggtgtt tttgggcgga ctggaatccg aaaaaccaca atgggctttg ggtcgctttt gggggtgtc gtgctccgag cagccagagt ccaacaagga gagcttgttt cagagccatg taggctcatg tcctcaccgt gctctgccct tctgccatgc ctttgtgcaa a SEQ ID NO:18 tttgcacaaa ggcatggcag aagggcagag cacggtgagg acatgagcct acatggctct gaaacaagct ctccttgttg gactctggct gctcggagca cgacaccccc caaaagcgac ccaaagccca ttgtggtttt tcggattcca gtccacccaa aaacacccag ggtgtgggtt caggacctgt tgcctggacc atccctccac gtaggtgtca accacgagcc cctggggaaa ggagtggttc c SEQ ID NO:19 tttgcacaaa ggcatggcag aagggcagag cacggtgagg acatgagcct acatggctct gaaacaagct ctccttgttg gactctggct gctcggagca cgacaccccc caaaagcgac ccaaagccca ttgtggtttt tcggattcca gtccgcccaa aaacacccag ggtgtgggtt caggacctgt tgcctggacc atccctccac gtaggtgtca accacgagcc cctggggaaa ggagtggttc c SEQ ID NO:20 (4) The total length of the SNP4 amplification product is 284 bp, with a c / t mutation at the 164th bp (based on SEQ ID NO:15). Its nucleotide sequences are shown in SEQ ID NO:21, SEQ ID NO:22 and their reverse complementary sequences SEQ ID NO:23 and SEQ ID NO:24.

[0021] ctcggtccca gtagttgagc tctaccatgt caaaggctat ggcttcgggg actgccagca cgatggccac tgcccagatc agcgtcacct ccactgcctt ccacatgggg atccctatcc cctggatccg actccaggag gccactgctc ggtacctgct caacgcgtgg ggacacaaca ggagcagaga ggagtgagaa gagccaccaa caggaaaggg gcctggaagg tgtgtgttag agttgtcccc tttccttgcc ccttcttcca ccacccttga gctt SEQ ID NO:21 ctcggtccca gtagttgagc tctaccatgt caaaggctat ggcttcgggg actgccagca cgatggccac tgcccagatc agcgtcacct ccactgcctt ccacatgggg atccctatcc cctggatccg actccaggag gccactgctc ggtacctgct caatgcgtgg ggacacaaca ggagcagaga ggagtgagaa gagccaccaa caggaaaggg gcctggaagg tgtgtgttag agttgtcccc tttccttgcc ccttcttcca ccacccttga gctt SEQ ID NO:22 aagctcaagg gtggtggaag aaggggcaag gaaaggggac aactctaaca cacaccttcc aggccccttt cctgttggtg gctcttctca ctcctctctg ctcctgttgt gtccccacgc gttgagcagg taccgagcag tggcctcctg gagtcggatc caggggatag ggatccccat gtggaaggca gtggaggtga cgctgatctg ggcagtggcc atcgtgctgg cagtccccga agccatagcc tttgacatgg tagagctcaa ctactgggac cgag SEQ ID NO:23 aagctcaagg gtggtggaag aaggggcaag gaaaggggac aactctaaca cacaccttcc aggccccttt cctgttggtg gctcttctca ctcctctctg ctcctgttgt gtccccacgc attgagcagg taccgagcag tggcctcctg gagtcggatc caggggatag ggatccccat gtggaaggca gtggaggtga cgctgatctg ggcagtggcc atcgtgctgg cagtccccga agccatagcc tttgacatgg tagagctcaa ctactgggac cgag SEQ ID NO:24 Samples were amplified using a multiplex PCR method. A PCR mix was prepared using four primer pairs and aliquoted into 96-well plates corresponding to 200 individuals. The plates were thoroughly thawed, shaken, and centrifuged at 1000 rpm for 1 second before loading.

[0022] The PCR amplification system was as follows: Primer (50 nM) 2 μL, dNTP (2.5 mM) 0.8 μL, Taq enzyme (5 U / μL) 0.2 μL, 10× PCR Buffer (containing Mg 2+ ) 2 μL, genomic DNA (20 ng / μL) 2 μL, and ultrapure water less than 20 μL.

[0023] PCR amplification conditions were as follows: ① 95°C for 5 min, 1 cycle; ② 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, 30 cycles; ③ 72°C for 10 min.

[0024] After PCR amplification of 200 independent mule duck mothers, the products were sent to a biological company for Sanger sequencing. After sequencing, the five mutation sites corresponding to each individual were checked. A total of four haplotypes were obtained from the 200 individuals, namely CGCC, TACC, CGTT and TATT, with corresponding haplotype frequencies of 0.200, 0.095, 0.363 and 0.342, respectively. The feather color score of the mule duck offspring of each female duck was statistically analyzed as the genetic potential of the mule duck mother's feather color. Variance analysis was performed using R software. The results are shown in Table 3 and Figure 2 , data are presented as mean ± standard deviation.

[0025] Haplotype combination Number of observations Feather color score CGCC / CGCC 21 <![CDATA[5.77±2.33 a ]]> CGCC / TACC 38 <![CDATA[8.41±1.93 b ]]> CGTT / CGTT 58 <![CDATA[9.27±1.92 b ]]> CGTT / TATT 29 <![CDATA[10.77±1.70 bc ]]> TATT / TATT 54 <![CDATA[12.31±2.22 c ]]> In addition to the above embodiments, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the scope of protection required by the present invention.

Claims

1. A haplotype SNP primer related to the genetic potential of female feather color in Mule ducks, characterized by: The nucleotide sequences of the SNP primers are shown in SEQ ID NO: 1-SEQ ID NO: 8, and every two primers correspond to one SNP site. The SNP sites are located sequentially at base 6462091 on chromosome 10 of the duck reference genome ZJU1.0 version, and the base mutation is T or C; at base 6456655, the base mutation is G or A; at base 6453471, the base mutation is T or C; at base 6452579, the base mutation is T or C.

2. An application of a haplotype SNP primer related to the genetic potential of the female parent's feather color in a Mule duck, characterized by: For detecting the genetic potential of feather color of the female parent of the Mule duck, the detection method includes the following steps: The first step is to provide a DNA sample of a maternal Mule duck to be tested, and perform PCR amplification using the SNP primers shown in SEQ ID NOs: 1-8 to obtain a PCR product; The second step is to perform Sanger sequencing on the PCR products; The third step is to determine the genotype of the PCR product based on the sequencing results of the second step.

3. The use of the haplotype SNP primers related to the genetic potential of the female parent feather color of the Mule duck according to claim 2, characterized in that: The final volume of the PCR amplification reaction system is 20 μL, and the upstream and downstream primers are 50 nM and 2 μL, dNTP 2.5 mM 0.8 μL, Taq enzyme 5 U / μL 0.2 μL, Contains Mg 2+ 2 μL of 10× PCR Buffer, 2 μL of DNA from the female parent of the Mule duck to be tested (20 ng / μL), Add ultrapure water to make up to 20 μL.

4. The use of the haplotype SNP primers related to the genetic potential of the female parent feather color of the Mule duck according to claim 3, characterized in that: PCR amplification conditions were as follows: 95°C for 5 min, 1 cycle; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, 30 cycles; and 72°C for 10 min.

5. The use of the haplotype SNP primers related to the genetic potential of the female parent feather color of the Mule duck according to claim 2, characterized in that: The nucleotide sequences of the amplified products are shown in SEQ ID NO: 9 to SEQ ID NO:

24.

6. The use of the haplotype SNP primers related to the genetic potential of the female parent feather color of the Mule duck according to claim 2, characterized in that: When the PCR products were CGCC homozygous genotypes, the corresponding offspring of the Mule duck mother had a higher white feather rate; when the PCR products were TATT homozygous genotypes, the corresponding offspring of the Mule duck mother had a lower white feather rate.

Images