Application of a kind of antrodia camphorata polysaccharide in preparation of anti-liver cancer drugs

Abstract

The application provides application of a tremella fuciformis polysaccharide in preparation of an anti-liver cancer drug, and relates to the technical field of biological medicine.The tremella fuciformis polysaccharide in the application can regulate differentiation of monocytes into macrophages, promote classical activation of the macrophages through cascade amplification, and secrete proinflammatory factors, so that the proliferation of liver cancer cells is inhibited, and the effect of resisting liver cancer is achieved.In addition, the tremella fuciformis polysaccharide in the application has good safety, no toxic side effects, can guarantee that the tremella fuciformis polysaccharide is used for preparing a drug for treating liver cancer, is easy to produce, is low in cost, has remarkable effect, has great market development value and good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of Antrodia camphorata polysaccharide in the preparation of drugs for treating liver cancer. Background Technology

[0002] Currently, the comprehensive use of surgical treatment, radiotherapy, platinum-based adjuvant chemotherapy, and molecular targeted therapy to treat liver cancer has improved the survival rate of liver cancer patients to some extent. However, the drug resistance, toxic side effects, and adverse reactions of the treatment drugs have greatly limited the effectiveness of liver cancer treatment. Therefore, there is an urgent need to find more effective treatment methods.

[0003] Antrodia camphorata (Taiwanofungus camphoratus), also known as Niuzhangzhi or Zhanggu, is a precious medicinal fungus from Taiwan, China. It belongs to the order Apophyceales, family Polyporaceae, genus Pleurotus, and is a perennial fungus with a wide range of pharmacological activities. Currently, over 220 compounds, including triterpenes, polysaccharides, nucleotides, fatty acids, benzoquinones, and proteins, have been isolated and identified from its fruiting bodies and mycelia. Submerged fermentation, due to its advantages of short cycle time, low cost, good batch stability, and ease of large-scale production, has become the most efficient and popular artificial cultivation method for Antrodia camphorata. Polysaccharides are one of the most important active products of submerged fermentation. Antrodia camphorata polysaccharides are commonly used to treat alcoholic liver injury and also possess anti-inflammatory, antioxidant, antitumor, hypoglycemic, hypotensive, neuromodulatory, immunomodulatory, and intestinal flora-regulating effects. Based on the excellent biological activity of Antrodia camphorata polysaccharides, more and more scholars are beginning to explore and develop their applications in the pharmaceutical field. Summary of the Invention

[0004] The purpose of this invention is to provide an application of Antrodia camphorata polysaccharide in the preparation of anti-liver cancer drugs.

[0005] In a first aspect, the present invention provides the application of Antrodia camphorata polysaccharide in the preparation of anti-liver cancer drugs.

[0006] Optionally, the Antrodia camphorata polysaccharide is a product extracted by deep fermentation of Antrodia camphorata.

[0007] Optionally, the extraction method of the deep fermentation extract of Antrodia camphorata includes: fermenting and culturing the Antrodia camphorata AC09 strain in a fermentation medium and then extracting and separating the extract to obtain the extract product.

[0008] Optionally, the fermentation medium comprises: glucose at 15 g / L-25 g / L, yeast extract at 8 g / L-12 g / L, peptone at 8 g / L-12 g / L, potassium dihydrogen phosphate at 0.05 g / L-0.15 g / L, magnesium sulfate at 0.3 g / L-0.7 g / L, and vitamin B1 at 0.05 g / L-0.15 g / L.

[0009] The fermentation conditions are as follows: the inoculum size of Antrodia camphorata AC09 strain in the fermentation medium is 8%-12%; and / or, the fermentation temperature is 24℃-28℃; and / or, the flask is shaken at a speed of 100r / min-150r / min; and / or, the fermentation period is 5d-9d.

[0010] Optionally, the extraction and separation process includes the following steps: after the deep fermentation of Antrodia camphorata is completed, the fermentation product is filtered, and the filter residue is collected to obtain Antrodia camphorata mycelium, which is used to extract Antrodia camphorata polysaccharides.

[0011] Optionally, the extraction of Antrodia camphorata polysaccharides includes using Antrodia camphorata mycelium as raw material, freeze-drying and grinding it, followed by defatting, hot water extraction, water bath enzymatic hydrolysis, protein removal, alcohol precipitation and freeze-drying to obtain crude Antrodia camphorata polysaccharides; and then separating and purifying the crude Antrodia camphorata polysaccharides to obtain Antrodia camphorata polysaccharides.

[0012] Optionally, the separation and purification method includes fractional purification by sequential anion exchange chromatography and molecular sieve chromatography; the anion exchange chromatography includes the use of a DEAE cellulose column; and the molecular sieve chromatography includes the use of a dextran gel column.

[0013] Optionally, the Antrodia camphorata polysaccharide plays a role in the preparation of anti-liver cancer drugs by regulating macrophage function.

[0014] Secondly, the present invention also provides a *Antrodia camphorata* polysaccharide used in the above-mentioned applications, having a molecular weight of 15.0 kDa-17.5 kDa; comprising galactose, glucose, and mannose in a molar ratio of (0.10-0.15):(0.80-0.85):(0.03-0.05); and comprising the following two structural components: heteroglucan: the main chain is →4)-α-D-Glcp-(1→ and →6)-α-D-Galp-(1→, with side chains located at the O-6 position of α-Glc and at the O-2 position of α-Gal; β-glucan: the main chain is →6)-β-D-Glcp-(1→ and →3)-β-D-Glcp-(1→, with side chains located at the O-6 position of β-Glc. Attached Figure Description

[0015] Figure 1 This is the DEAE52 elution curve of the crude polysaccharide of Antrodia camphorata in this invention;

[0016] Figure 2 This is the elution curve of the G25 gel of the crude polysaccharide of Antrodia camphorata in this invention;

[0017] Figure 3 This is the G50 elution curve of the dextran gel of Antrodia camphorata crude polysaccharide of the present invention;

[0018] Figure 4 This is a full-wavelength scan of the Antrodia camphorata polysaccharide of the present invention;

[0019] Figure 5 This is the near-infrared spectrum of the Antrodia camphorata polysaccharide of the present invention;

[0020] Figure 6 The regression curve and chromatogram are for determining the molecular weight of Antrodia camphorata polysaccharide of the present invention;

[0021] Figure 7 This is an ion chromatogram for the determination of monosaccharide components of Antrodia camphorata polysaccharide in this invention;

[0022] Figure 8 NMR of Antrodia camphorata polysaccharide of the present invention 1 H spectrum;

[0023] Figure 9 NMR of Antrodia camphorata polysaccharide of the present invention 13 C spectrum;

[0024] Figure 10 This is the HSQC spectrum of the NMR of Antrodia camphorata polysaccharide of the present invention;

[0025] Figure 11 This is the COSY spectrum of the NMR of Antrodia camphorata polysaccharide of the present invention;

[0026] Figure 12 This is the HMBC spectrum of the NMR of Antrodia camphorata polysaccharide of the present invention;

[0027] Figure 13 This is the NOESY spectrum of the NMR of Antrodia camphorata polysaccharide of the present invention;

[0028] Figure 14 This is a schematic diagram showing the repeating unit features of the primary structure of Antrodia camphorata polysaccharide in this invention;

[0029] Figure 15 This is a schematic diagram illustrating the experimental results of how Antrodia camphorata polysaccharide promotes the differentiation of THP-1 monocytes into macrophages according to the present invention.

[0030] Figure 16 This is a schematic diagram illustrating the experimental results of how Antrodia camphorata polysaccharide of the present invention increases the protein level of CD14 in THP-1 mononuclear cells;

[0031] Figure 17 This is a figure showing the effect of Antrodia camphorata polysaccharide of the present invention on the mRNA levels of THP-1-derived macrophage activation-related markers;

[0032] Figure 18 This is a graph showing the effect of Antrodia camphorata polysaccharide of the present invention on the mRNA levels of bone marrow-derived macrophage activation-related markers;

[0033] Figure 19 The figure shows the experimental results of how Antrodia camphorata polysaccharide of the present invention inhibits the activity of liver cancer cells by promoting classical activation of macrophages;

[0034] Figure 20 The figure shows the experimental results of how Antrodia camphorata polysaccharide of the present invention inhibits the growth of liver cancer cells by promoting classical activation of macrophages;

[0035] Figure 21 The figure shows the experimental results of the present invention, which shows the inhibition of cyst and tumor nodule formation in the liver tissue of mice with liver cancer by Antrodia camphorata polysaccharide.

[0036] Figure 22 The figure shows the experimental results of the inhibition of Ki-67 and PCNA protein levels in the liver of mice with liver cancer by Antrodia camphorata polysaccharide of the present invention. Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, the technical or scientific terms used herein should have the ordinary meaning understood by those skilled in the art to which this invention pertains.

[0038] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer. The Antrodia camphorata strain used in this invention was purchased from the China Center for Type Culture Collection, CCTCC NO: M2015274.

[0039] This invention provides the application of Antrodia camphorata polysaccharide in the preparation of anti-liver cancer drugs, which relates to the field of biomedical technology.

[0040] In some embodiments, the use of Antrodia camphorata polysaccharide in the preparation of anti-liver cancer drugs includes the role of Antrodia camphorata polysaccharide in the preparation of anti-liver cancer drugs by regulating macrophage function.

[0041] In fact, the Antrodia camphorata polysaccharide in this invention can regulate the differentiation of monocytes into macrophages, promote the classical activation of macrophages through a cascade amplification effect, and secrete pro-inflammatory factors, thereby inhibiting the proliferation of liver cancer cells and achieving an anti-liver cancer effect. Furthermore, the Antrodia camphorata polysaccharide in this invention has good safety and no toxic side effects, ensuring its suitability for use in the preparation of drugs for treating liver cancer. It is also easy to produce, inexpensive, and highly effective, possessing significant market development value and promising application prospects.

[0042] Specifically, the Antrodia camphorata polysaccharide of the present invention is a deep fermentation extract of Antrodia camphorata. The extraction method includes: fermenting and culturing the Antrodia camphorata AC09 strain in a fermentation medium, followed by extraction and separation to obtain the extract. In fact, the extraction of Antrodia camphorata polysaccharide through deep fermentation technology, compared with traditional solid-state culture or wild fruiting body extraction, can achieve more efficient and large-scale production, and can precisely control product quality to ensure the structural consistency of each batch of polysaccharide and can target and optimize active ingredients.

[0043] In some embodiments, the fermentation medium for deep fermentation extraction of Antrodia camphorata polysaccharides comprises: glucose at 15 g / L-25 g / L, yeast extract at 8 g / L-12 g / L, peptone at 8 g / L-12 g / L, potassium dihydrogen phosphate at 0.05 g / L-0.15 g / L, magnesium sulfate at 0.3 g / L-0.7 g / L, and vitamin B1 at 0.05 g / L-0.15 g / L. In fact, glucose serves as the primary energy source for mycelial growth and participates in the construction of the carbon skeleton for polysaccharide synthesis. Therefore, the glucose concentration in the culture medium needs to be controlled. Too low a concentration will restrict cell growth and reduce polysaccharide yield, while too high a concentration may inhibit carbon metabolism and reduce polysaccharide yield. Yeast extract and peptone act as nitrogen sources, synergistically promoting rapid mycelial proliferation. Potassium dihydrogen phosphate provides phosphorus and acts as a pH buffer. Magnesium sulfate, as an enzyme cofactor, affects the polysaccharide chain elongation rate; too high a concentration may lead to osmotic imbalance. Vitamin B1, as a coenzyme precursor, has a low concentration that causes abnormal mycelial branching, while too high a concentration may inhibit secondary metabolism. Specifically, the preferred culture medium composition is: 20 g / L glucose, 10 g / L yeast extract, 10 g / L peptone, 0.1 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate, and 0.1 g / L vitamin B1, sterilized at 115°C for 30 min.

[0044] In some embodiments, the fermentation conditions are as follows: the inoculum size of Antrodia camphorata AC09 strain in the fermentation medium is 8%-12%; and / or, the fermentation temperature is 24℃-28℃; and / or, the rotation speed is 100r / min-150r / min; and / or, the fermentation period is 5d-9d. In practice, the inoculum size affects the fermentation period. Too low an inoculum size may increase the fermentation period, while too high an inoculum size may lead to increased nutrient competition and premature mycelial aging. Therefore, an appropriate inoculum size can achieve optimal biomass accumulation and stability control, ensuring the purity of the strain. In practice, a suitable fermentation temperature can protect enzyme activity and regulate metabolic balance; while a suitable rotation speed can increase dissolved oxygen and promote polysaccharide synthesis. Specifically, the preferred fermentation conditions are: an inoculum size of 10%, a fermentation temperature of 26℃, and shaking culture at 120r / min for 7 days.

[0045] In some embodiments, the extraction method of crude Antrodia camphorata polysaccharide includes using Antrodia camphorata mycelium as raw material, freeze-drying and grinding it, followed by defatting, hot water extraction, water bath enzymatic hydrolysis, protein removal, alcohol precipitation and freeze-drying to obtain crude Antrodia camphorata polysaccharide.

[0046] In fact, freeze-drying dehydrates the mycelial cells obtained from deep fermentation culture, forming ice crystals. After grinding, the cell walls rupture, improving subsequent extraction efficiency. Degreasing removes lipid-soluble impurities, and the removal of the lipid barrier facilitates the release of polysaccharides. Specifically, the preferred organic solvent for degreasing is petroleum ether, and the preferred mass ratio of solvent to mycelium is 20:1.

[0047] In fact, hot water extraction can break hydrogen bonds and hydrophobic interactions through high temperature, dissolve polysaccharides, and inactivate enzymes, preventing endogenous enzymes from degrading the target polysaccharides. Specifically, the preferred hot water extraction temperature is 85℃-95℃, and the preferred water bath time is 4.5 hours.

[0048] Specifically, water bath enzymatic hydrolysis is preferably performed using papain, which can target and degrade interfering substances, and enzymatically cleave long-chain impurities to reduce viscosity and facilitate subsequent centrifugation and filtration; during the protein removal process, the Sevag method (Sevag reagent includes: chloroform: n-butanol = 4:1) is preferred to denature the protein and remove impurities.

[0049] In some embodiments, the anhydrous ethanol concentration used for precipitation is 70%-90%, the temperature is 2°C-8°C, and the time is 6h-24h. In practice, when the ethanol concentration reaches 80%, the polysaccharide precipitates due to a sharp drop in solubility. Specifically, the final ethanol concentration is preferably 80%.

[0050] In fact, the freeze-drying process to obtain Antrodia camphorata crude polysaccharide is achieved by using low-temperature dehydration to avoid thermal denaturation of the polysaccharide and extend the shelf life of the extracted product.

[0051] In some embodiments, the purification method for Antrodia camphorata polysaccharides includes fractional purification by sequential anion exchange chromatography and molecular sieve chromatography; the anion exchange chromatography uses a DEAE cellulose column; and the molecular sieve chromatography uses a dextran gel column. In practice, anion exchange chromatography separates polysaccharides according to charge and can remove residual negatively charged protein impurities, thereby increasing the polysaccharide concentration; molecular sieve chromatography fractionates polysaccharides according to molecular weight, narrowing the molecular weight distribution and controlling the homogeneity of the polysaccharides.

[0052] The present invention also provides antrodia camphorata polysaccharide. In some embodiments, the antrodia camphorata polysaccharide has a molecular weight of 15.0 kDa-17.5 kDa; contains galactose, glucose and mannose in a molar ratio of (0.10-0.15):(0.80-0.85):(0.03-0.05); and contains the following two structural components: heteroglucan: the main chain is →4)-α-D-Glcp-(1→ and →6)-α-D-Galp-(1→, with side chains located at the O-6 position of α-Glc and at the O-2 position of α-Gal; β-glucan: the main chain is →6)-β-D-Glcp-(1→ and →3)-β-D-Glcp-(1→, with side chains located at the O-6 position of β-Glc.

[0053] Example 1: Extraction of Antrodia camphorata polysaccharides from deep fermentation of Antrodia camphorata

[0054] (1) The Antrodia camphorata strain was fermented and cultured under the following conditions:

[0055] Culture medium components: glucose 20 g / L, yeast extract 10 g / L, peptone 10 g / L, potassium dihydrogen phosphate 0.1 g / L, magnesium sulfate 0.5 g / L, vitamin B1 0.1 g / L; sterilized at 115℃ for 30 min; fermentation conditions: inoculum size 10%, fermentation temperature 26℃, rotation speed 120 r / min, shaken for 7 days. After the culture period, the fermented mycelium of Antrodia camphorata was obtained by filtration. The mycelium was freeze-dried, ground into powder, and passed through a 150-mesh sieve.

[0056] (2) Degrease the mycelium powder by shaking for 4 hours with a mass ratio of petroleum ether to mycelium powder of 20:1, repeat twice, and then dry the mycelium powder.

[0057] (3) Add 20-40 times the mass of deionized water to the mycelium, place it in a water bath at 85℃-95℃, extract for 4.5h, centrifuge at 4000r / min for 15min and take the supernatant. Repeat the extraction 3 times and combine the supernatants.

[0058] (4) Concentrate the supernatant 5-8 times, add papain to the supernatant at a ratio of 2%-3%, adjust the pH value to 4-6.6, place it in a water bath at 50℃-55℃, and enzymatically hydrolyze for 10 hours. After the hydrolysis is completed, adjust the water bath temperature to 95℃ to terminate the enzymatic hydrolysis.

[0059] (5) Add 1 / 3 volume of Sevag reagent (chloroform: n-butanol = 4:1) to the supernatant after enzymatic hydrolysis to remove protein. Repeat several times until no protein layer appears. Remove residual organic reagent by rotary evaporation and concentrate 2-4 times.

[0060] (6) Add anhydrous ethanol to the extract and adjust the final ethanol concentration to 80%. Incubate overnight at 4°C. Centrifuge and collect the precipitate to obtain the crude polysaccharide of Antrodia camphorata.

[0061] (7) Dissolve the crude polysaccharide of Antrodia camphorata in ultrapure water and load it into a DEAE-52 cellulose chromatography column. Elute sequentially with 0M NaCl solution, 0.1M NaCl solution, and 0.3M NaCl solution. Collect the eluent in test tubes at a flow rate of 0.8 mL / min, with each tube containing 5 mL. Detect the polysaccharide content in each tube using the anthrone-sulfuric acid method and plot the elution curve. The DEAE-52 elution curve of crude polysaccharide of Antrodia camphorata is shown below. Figure 1 As shown, the components eluted with 0M NaCl solution (as indicated by the arrows) were combined, concentrated, and lyophilized.

[0062] (8) Dissolve the lyophilized polysaccharide fraction from step (7) in ultrapure water, load it onto a dextran gel G25 column, and elute with ultrapure water. Collect the eluent in test tubes at a flow rate of 0.6 mL / min, with each tube containing 5 mL. Detect the polysaccharide content in each tube using the anthrone-sulfuric acid method and plot the elution curve. The dextran gel G25 elution curve of crude Antrodia camphorata polysaccharide is shown below. Figure 2 As shown, the main peak components (as shown in the horizontal line area) are combined, concentrated, and freeze-dried.

[0063] (9) Dissolve the lyophilized polysaccharide component from step (8) in ultrapure water, load it onto a dextran gel G50 chromatography column, elute with ultrapure water, and collect the eluent in test tubes at a flow rate of 0.6 mL / min, with each tube containing 5 mL. Detect the polysaccharide content in each tube using the anthrone-sulfuric acid method, plot the elution curve, combine the single-peak components, concentrate, and lyophilize to obtain Antrodia camphorata polysaccharide. The dextran gel G50 elution curve of crude Antrodia camphorata polysaccharide is shown below. Figure 3 As shown.

[0064] Test Example 1: Analysis of the Primary Structure Characteristics of Antrodia camphorata Polysaccharides

[0065] (1) Experimental materials

[0066] Antrodia camphorata polysaccharide (ACPSA) obtained in Example 1.

[0067] (2) Experimental methods and results

[0068] Full-wavelength spectral analysis: The *Antrodia camphorata* polysaccharide obtained in Example 1 was dissolved in an appropriate amount of ultrapure water to a concentration of 0.3 mg / mL. The solution was then placed in a microplate reader and scanned at wavelengths from 200 nm to 600 nm. The absorbance values ​​were recorded, with ultrapure water used as a blank control. The analytical results are as follows: Figure 4 As shown, Antrodia camphorata polysaccharide does not have obvious absorption peaks at 260 nm and 280 nm, indicating that no nucleic acids or proteins are present in this polysaccharide.

[0069] Near-infrared spectroscopy analysis: The freeze-dried powder of Antrodia camphorata polysaccharide obtained in Example 1 was mixed with KBr (mass ratio 1:200) and compressed into tablets, then subjected to near-infrared spectroscopy at 4000-4000 cm⁻¹. -1Infrared spectroscopy was performed within the specified range; KBr powder was compressed separately and used as a blank. The scanning results are as follows: Figure 5 As shown, the polysaccharide was at 3427.68 cm⁻¹ -1 The broad and strong absorption peak at 2923.27 cm⁻¹ is due to the stretching vibration of the OH groups in sugars. -1 The smaller absorption peak at 1400 cm⁻¹ is due to the stretching vibration of methyl or methylene CH₄; -1 -1200cm -1 The peaks between these peaks are likely due to the CH-angle vibration of sugars, exhibiting typical characteristics of polysaccharides. (1157.69 cm⁻¹) -1 1081.27cm -1 1022.95cm -1 The three absorption peaks indicate that the Antrodia camphorata polysaccharide sample contains pyranose rings. The peak at 930.88 cm⁻¹... -1 and 847.63cm -1 The presence of small characteristic peaks indicates that the polysaccharide sample contains both α- and β-configurations of sugar residues.

[0070] Molecular weight analysis: Standards (5000, 11600, 23800, 48600, 80900, 148000, 273000, 409800, 667800 Da dextran and Dextran standards 1152) and polysaccharide samples were weighed and prepared into 5 mg / mL test solutions using 0.05 M NaCl solution. The solutions were centrifuged at 12000 rpm for 10 min, and the supernatant was filtered through a 0.22 μm filter. The samples were then separated using a BRT105-104-102 tandem gel column (8 × 300 mm) and detected by a differential detector RI-10A at a flow rate of 0.6 mL / min. Regression analysis was performed with the logarithmic molecular weights of the ten selected standards of known molecular weights as the ordinate and the retention times of the corresponding chromatographic peaks as the abscissa. Figure 6 As shown, the retention time of the polysaccharide sample (41.716 min) was used as the X value and substituted into the regression equation for peak molecular weight (Mp), weight-average molecular weight (Mw), and number-average molecular weight (Mn) to calculate the Y values. The calculated Mp, Mw, and Mn values ​​for Antrodia camphorata polysaccharides were 13.924 kDa, 16.088 kDa, and 11.696 kDa, respectively.

[0071] Monosaccharide component analysis: Fucoido, rhamnose, arabinose, galactose, glucose, xylose, mannose, fructose, ribose, galacturonic acid, glucuronic acid, galactosyl hydrochloride, glucosamine hydrochloride, N-acetyl-D-glucosamine, guluronic acid, and mannuronic acid were selected as monosaccharide standards. 5 mg of each standard and Antrodia camphorata polysaccharide sample were weighed and placed in ampoules. 2 mL of 3M trifluoroacetic acid was added, and the mixture was hydrolyzed at 120℃ for 3 h. After hydrolysis, the acidic hydrolysate was transferred to a tube, dried under nitrogen, and 5 mL of ultrapure water was added and mixed. 50 μL of the mixture was added to 950 μL of ultrapure water, and the mixture was centrifuged at 12000 rpm for 5 min. The supernatant was collected and analyzed using ion chromatography; the chromatographic column was a Dionex Carbopac. TM PA20 (3 mm × 150 mm); mobile phase A was H2O, mobile phase B was 15 mM NaOH, and mobile phase C was 15 mM NaOH and 100 mM NaOAC; flow rate was 0.3 mL / min; analysis was performed using an electrochemical detector. Results are as follows: Figure 7 As shown, Antrodia camphorata polysaccharide contains three monosaccharide components: galactose, glucose, and mannose, with a molar ratio of 0.122:0.835:0.042.

[0072] Methylation analysis:

[0073] Weigh 3 mg of the Antrodia camphorata polysaccharide sample and dissolve it in 500 μL LDMSO. Add 1 mg NaOH and incubate for 30 min. Add 50 μL iodomethane solution and react for 1 h. Add 1 mL water and 2 mL dichloromethane, vortex to mix, centrifuge, discard the aqueous phase, and repeat the washing with water 3 times. Take the lower dichloromethane phase and evaporate to dryness. Add 100 μL TFA (2 M), react at 121 °C for 90 min, and evaporate to dryness at 30 °C. Then add 50 μL 2 M ammonia water and 50 μL 1 M NaBD4, mix well, and react at room temperature for 2.5 h. Add 20 μL acetic acid to terminate the reaction, blow dry with nitrogen, wash twice with 250 μL methanol, blow dry with nitrogen, add 250 μL acetic anhydride, vortex to mix, react at 100 °C for 2.5 h, add 1 mL water and let stand for 10 min. Add 500 μL dichloromethane, vortex to mix, centrifuge, discard the aqueous phase, and repeat the washing with water 3 times. The lower dichloromethane phase was collected and analyzed. The chromatographic system used was an Agilent gas chromatograph (Agilent 7890A; Agilent Technologies), with an HP-5MS capillary column (Agilent J&W Scientific). The carrier gas was high-purity helium (purity not less than 99.999%), the flow rate was 1.0 mL / min, and the injection port temperature was 260℃. The temperature program was: 50℃ for 1 min, increased to 130℃ at 50℃ / min, increased to 230℃ at 3℃ / min, and held for 2 min.

[0074] Based on the relative retention time and mass spectrum of each chromatographic peak, and by comparing with literature data and ion fragment mass spectra from the Complex Carbohydrates Research Center database at the University of Georgia, the sugar residue type corresponding to each chromatographic peak was analyzed, and the content of each was calculated using the peak area corresponding to the sugar residue type. Table 1 shows the methylation analysis results of Antrodia camphorata polysaccharides obtained in Example 1. The results indicate that ACPSA is mainly composed of 10 glycoside fragments.

[0075] Table 1. Methylation analysis results of Antrodia camphorata polysaccharides obtained in Example 1

[0076]

[0077] Nuclear magnetic resonance (NMR) analysis: 50 mg of lyophilized Antrodia camphorata polysaccharide was dissolved in 0.5 mL of D₂O and lyophilized twice. Finally, the sample was dissolved in 0.5 mL of D₂O, and one-dimensional NMR was measured using a 600 MHz Bruker NMR spectrometer. 1 H-NMR, 13 C-NMR and two-dimensional NMR HSQC, COSY, HMBC, and NOESY were obtained respectively. Figures 8 to 13 The results are shown to obtain complete H and C chemical shift information for each major sugar residue and to infer the connection order between each sugar residue.

[0078] like Figure 8 As shown, the polysaccharide sample 1 The H-NMR spectrum showed a large number of proton resonance signals concentrated in the δ3.0-5.5 ppm region, while multiple anodic hydrogen signals were found in the anodic region δ4.4-5.5 ppm, indicating the presence of various sugar residues. For example... Figure 9 As shown, with 1 Compared to H-NMR spectra, polysaccharides 13 The C-NMR spectrum showed multiple anterior carbons in the δ 90-110 ppm anterior carbon region. In the monosaccharide composition analysis and methylation analysis, the monosaccharide composition was mainly composed of Glc and Gal. The methylation analysis results showed the presence of 1,4-Glcp, 1,4,6-Glcp, 1,3-Glcp, 1,6-Glcp, 1,3,6-Glcp, 1,6-Galp, 1,2,6-Galp, and t-Glcp sugar residues, as well as t-Fucp sugar residues. It is speculated that the main chain of the polysaccharide sample may contain dextran and galactan structural units. Figures 10 to 13 The NMR spectra of Antrodia camphorata polysaccharides are shown in HSQC, COSY, HMBC, and NOESY. Based on the monosaccharide composition and methylation analysis results of the polysaccharide samples, the following analyses were performed. Figures 10 to 13 of 1 H-NMR, 13C-NMR, HSQC, and COSY NMR spectra revealed significant anodic signals, which can be used for structural analysis. Strong cross-peak signals were observed near the 5.20-5.38 ppm ¹H NMR and 98.9-100.5 ppm ¹H NMR regions in the HSQC anodic region. Based on literature reports, these signals can be inferred to primarily belong to the anodic signals of sugar residue α-Glcp. After determining the anodic signal attribution, further analysis was conducted using COSY, HSQC, HMBC, and NOESY spectra, combined with... 1 H-NMR, 13 Based on C-NMR and monosaccharide composition and methylation analysis results, the chemical shifts of the main sugar residues H and C in the polysaccharide samples were summarized and the summarized data are shown in Table 2. The results in Table 2 indicate that the *Antrodia camphorata* polysaccharide obtained in Example 1 is a complex polysaccharide. Its main structural features include heteroglucans with →4)-α-D-Glcp-(1→ and →6)-α-D-Galp-(1→) as the main chain, with side chains attached at the O-6 positions of some α-Glc and the O-2 positions of α-Gal. It also contains β-glucans with →6)-β-D-Glcp-(1→ and →3)-β-D-Glcp-(1→) as the main chain, with side chains attached at the O-6 positions of some β-Glc. Its possible structural repeating units are speculated to be as follows: Figure 14 As shown.

[0079] Table 2. Sugar residues of Antrodia camphorata polysaccharides 1 H and 13 C chemical shift assignment

[0080]

[0081] "--" indicates undetermined or not detected.

[0082] Test Example 2: Study on the regulation of macrophage function and inhibition of liver cancer cell proliferation by Antrodia camphorata polysaccharide

[0083] (1) Test materials

[0084] Drugs: Antrodia camphorata polysaccharide obtained in Example 1 and physiological saline.

[0085] Cells: THP-1 cells were purchased from the Cell Bank of the Chinese Academy of Sciences. Primary bone marrow-derived macrophages (BMDMs) were isolated from mice. The specific method was as follows: 4-8 week old wild-type C57BL / 6J mice were euthanized by cervical dislocation. The thighs and calves of the mice were harvested, washed with sterile PBS, and placed in a sterile laminar flow hood. Muscle tissue was dissected, washed with 75% alcohol, and then the joints at both ends of the bone were cut. DMEM culture medium was aspirated using a syringe to flush out the bone marrow, which was then placed in a culture dish and filtered through a 0.45 μM filter to obtain the cell suspension. The filtered cell suspension was centrifuged at 1000 rpm for 5 min and cultured in DMEM medium containing macrophage colony-stimulating factor (M-CSF) for 8 days. The adherent cells were the mature mouse bone marrow-derived macrophages.

[0086] (2) Test methods

[0087] Cell culture, grouping, and drug administration:

[0088] THP-1 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 0.05 mM β-mercaptoethanol. Cells were seeded in 6-well plates and divided into three groups: a blank control group, a low-dose polysaccharide treatment group, and a high-dose polysaccharide treatment group, with three replicates per group. The blank control group was treated with PBS, the low-dose polysaccharide treatment group was treated with 18.5 μM Antrodia camphorata polysaccharide, and the high-dose polysaccharide treatment group was treated with 37 μM Antrodia camphorata polysaccharide, all for 24 h.

[0089] BMDMs were cultured in DMEM medium with additional M-CSF. Cells were seeded in 6-well plates and divided into three groups: a blank control group, a low-dose polysaccharide treatment group, and a high-dose polysaccharide treatment group. The blank control group was treated with PBS, the low-dose polysaccharide treatment group was treated with 18.5 μM Antrodia camphorata polysaccharide, and the high-dose polysaccharide treatment group was treated with 37 μM Antrodia camphorata polysaccharide, all for 24 h.

[0090] Cell morphology analysis: THP-1 cells treated with different concentrations of Antrodia camphorata polysaccharide or untreated were used to observe and record changes in cell morphology under a microscope.

[0091] Real-time quantitative PCR (RT-qPCR) detection: THP-1 and BMDMs treated with different concentrations of Antrodia camphorata polysaccharides or untreated were collected, the culture medium was removed, and the samples were washed with PBS. 600 μL of Trizol was added, and the mixture was repeatedly pipetted and incubated at room temperature for 5 min to allow for complete lysis. 120 μL of chloroform was added to the lysis buffer, and the mixture was inverted and mixed thoroughly. The mixture was incubated at room temperature for 5 min, centrifuged at 12000 g for 15 min, and the supernatant was collected. 300 μL of isopropanol was added to the supernatant, and the mixture was inverted and mixed thoroughly. The mixture was incubated at room temperature for 10 min, centrifuged at 12000 g for 10 min, and the supernatant was discarded. The precipitate was washed with 600 μL of ice-cold ethanol, centrifuged at 7500 g for 5 min, and the supernatant was discarded. The precipitate was dried at room temperature for 20-30 min until it became transparent. Then, 30-60 μL of nuclease-free water was added, and the mixture was dissolved at 62℃ for 10 min. RNA concentration and purity were determined using Nanodrop.

[0092] qPCR was performed based on the primer sequence information, reverse transcription cDNA synthesis system preparation information, qPCR system preparation and program information to examine the mRNA levels of classical activation and alternative activation-related factors of macrophages in different groups of cells.

[0093] ①The primer sequences are as follows:

[0094] Primer name Serial Number Primer sequence GAPDH(h)-FP SEQ ID NO.1 GGAGCGAGATCCCTCCAAAAT GAPDH(h)-RP SEQ ID NO.2 GGCTGTTGTCATACTTCTCATGG IL-6-FP SEQ ID NO.3 ACTCACCTCTTCAGAACGAATTG IL-6-RP SEQ ID NO.4 CCATCTTTGGAAGGTTCAGGTTG IL-1β-FP SEQ ID NO.5 ATGATGGCTTATTACAGTGGCAA IL-1β-RP SEQ ID NO.6 GTCGGAGATTCGTAGCTGGA CD86-FP SEQ ID NO.7 CTGCTCATCTATACACGGTTACC CD86-RP SEQ ID NO.8 GGAAACGTCGTACAGTTCTGTG TNF-α-FP SEQ ID NO.9 GAGGCCAAGCCCTGGTATG TNF-α-RP SEQ ID NO.10 CGGGCCGATTGATCTCAGC CD163-FP SEQ ID NO.11 TTTGTCAACTTGAGTCCCTTCAC CD163-RP SEQ ID NO.12 TCCCGCTACACTTGTTTTCAC CD206-FP SEQ ID NO.13 GGGTTGCTATCACTCTCTATGC CD206-RP SEQ ID NO.14 TTTCTTGTCTGTTGCCGTAGTT TGFβ-FP SEQ ID NO.15 CTAATGGTGGAAACCCACAACG TGFβ-RP SEQ ID NO.16 TATCGCCAGGAATTGTTGCTG

[0095] ② Reverse transcription system for synthesizing cDNA:

[0096] 4×gDNAwiperMix 4μL RNA 1μg Enzyme-free water Add to 16 μL

[0097] Mix thoroughly by blowing and stirring, 42°C, 2 min

[0098] 5×HiScriptⅢqRTSuperMix 4μL Step 1 reaction solution 16μL

[0099] Mix well by blowing and beating

[0100] 37℃ 15min 85℃ 5 seconds

[0101] ③ qPCR system:

[0102] Components Volume (μL) Final concentration HieffUNICON®UniversalBlueqPCRSYBRGreenMasterMix 10 1× ForwardPrimer (10μM) 0.4 0.2μM ReversePrimer (10μM) 0.4 0.2μM Diluted template DNA 2 Enzyme-free water 7.2

[0103] ④ qPCR standard procedure:

[0104] Loop steps temperature time Cycle number Pre-variation 95℃ 2min 1 Transmutation Annealing / Extension 95℃60℃ 10sec 30sec 40 Melting curve stage Instrument default settings 1

[0105] Western blot analysis of proteins: THP-1 samples treated with different concentrations of Antrodia camphorata polysaccharide or untreated were collected, the culture medium was removed, and the samples were washed with PBS. 200 μL of 2× loading buffer was added to each well, and the samples were repeatedly pipetted to ensure complete lysis. The lysate was collected in EP tubes. EP tubes were placed in boiling water for 10 min and then stored at -20℃. A 10% sodium dodecyl sulfate-polyacrylamide gel was prepared and placed in an electrophoresis tank. 10 μL-20 μL of the prepared protein samples were added to each well. Electrophoresis was performed at 80V for 20-30 min and at 120V for 50-60 min. A transfer system was prepared using a "sandwich" structure, and transfer was performed at 90V for 100 min to transfer the protein samples from the gel onto a PVDF membrane. The PVDF membrane was then completely immersed in 5% skim milk powder and blocked at room temperature for 90 min. After blocking, the membrane was washed with TBST buffer and incubated overnight at 4℃ with CD14 and GAPDH antibodies. The membrane was washed three times with TBST for 10 min each time, and then placed in secondary antibody solution and incubated at room temperature for 60 min. After incubation, the membrane was washed three times with TBST for 10 min each time. The target band was exposed using ECL luminescent solution in a gel imaging system of a chemiluminescence imaging system to detect the protein level of CD14 in each group of THP-1 cells.

[0106] Detection of hepatocellular carcinoma cell proliferation: Hepatocellular carcinoma cell lines (HLE and HCCLM3) were seeded in 96-well plates. After 12 hours, the culture medium was removed, and 100 μL of the culture supernatant of BMDMs treated with different concentrations of Antrodia camphorata polysaccharide or without treatment for 24 hours was added. The hepatocellular carcinoma cells were cultured for another 20 hours, and then MTT solution was added. After 4 hours, the supernatant was removed, and 100 μL of dimethyl sulfoxide was used to dissolve the formazan formed in the hepatocellular carcinoma cells at the bottom of the plate. The absorbance of the solution at 490 nm was measured using a microplate reader to reflect the viability of each group of hepatocellular carcinoma cells.

[0107] Hepatocellular carcinoma cell growth capacity assay: Hepatocellular carcinoma cell lines (HLE and HCCLM3) were seeded in 24-well plates. After 12 hours, the culture medium was removed, and 500 μL of the supernatant from BMDMs cultured for 24 hours (treated with different concentrations of Antrodia camphorata polysaccharide or untreated) was added. Hepatocellular carcinoma cells were cultured for 0, 2, 4, and 6 days, respectively. After culture, the cell supernatant was removed, the cells were washed once with PBS, and 200 μL of paraformaldehyde solution was added for fixation at room temperature for 15 minutes. The cells were washed once with PBS, and stained with 10% crystal violet solution at room temperature for 15 minutes. After staining, excess crystal violet dye was washed away with deionized water, and the cells were air-dried at room temperature. The crystal violet in each well was dissolved in 10% glacial acetic acid solution, and the absorbance at 595 nm was measured using a microplate reader to reflect the growth capacity of each group of hepatocellular carcinoma cells.

[0108] (3) Test results

[0109] Effects of Antrodia camphorata polysaccharides on monocyte differentiation: Macrophages are leukocytes located in tissues, derived from monocytes. THP-1, as a type of monocyte, is cultured in suspension, has a round shape, good light transmittance, and strong proliferative capacity. Figure 15 As shown, compared with the control group, treatment with 18.5 μM and 37 μM Antrodia camphorata polysaccharide induced THP-1 cells to adhere and grow, changing their morphology from round to flattened omelet-like, with tentacles at the cell edges and decreased light transmittance, indicating differentiation into macrophages. During the differentiation of monocytes into macrophages, CD14 expression significantly increased. Figure 16 To detect the protein level of CD14 in THP-1 cells treated with and untreated with Antrodia camphorata polysaccharide using Western blotting, the results showed that treatment with Antrodia camphorata polysaccharide significantly increased CD14 expression in a dose-dependent manner. These results confirm that Antrodia camphorata polysaccharide can promote the differentiation of monocytes into macrophages.

[0110] Effects of Antrodia camphorata polysaccharides on macrophage activation: Macrophage activation includes two forms: classical activation and alternative activation. Figure 15 and Figure 16 The results showed that Antrodia camphorata polysaccharide could promote the differentiation of monocytes into macrophages. To determine the effect of Antrodia camphorata polysaccharide on the activation patterns of THP-1-derived macrophages, the mRNA levels of classical activation markers IL-6, IL-1β, CCL2, and TNFα, and alternative markers CD163 and CD206 in THP-1 cells treated with or without Antrodia camphorata polysaccharide were detected using RT-qPCR. Figure 17 As shown, compared to the control group, Antrodia camphorata polysaccharide significantly increased the mRNA levels of classical activation markers, including IL-6 (…). Figure 17 A in IL-1β Figure 17 B), TNF-α ( Figure 17 C), CCL2 ( Figure 17 In the D), the proportions of IL-6 and IL-1β increased by more than a thousandfold; while the alternative activation marker CD163 ( Figure 17 E in the middle) and CD206 ( Figure 17 The effect of F) on the mRNA level was relatively small. To determine the effect of Antrodia camphorata polysaccharide on the activation patterns of bone marrow-derived macrophages (BMDMs), mouse bone marrow macrophages were isolated, and the mRNA levels of classical and alternative activation markers in BMDMs treated with or untreated with Antrodia camphorata polysaccharide were detected using RT-qPCR. Figure 18 As shown, we select CD163 ( Figure 18 F), VEGFα ( Figure 18 G), YM-1 ( Figure 18H) in it as a marker of alternative activation. Similarly, compared with the impact on this type of marker, the polysaccharide of Ganoderma tsugae has a greater enhancing effect on the mRNA levels of classical activation markers, such as IL-6 ( Figure 18 A) in it, IL-1β ( Figure 18 B) in it, TNF-α ( Figure 18 C) in it, CD86 ( Figure 18 D) in it, and iNOS ( Figure 18 E) in it. Therefore, the polysaccharide of Ganoderma tsugae can promote the classical activation of macrophages.

[0111] Effect of the polysaccharide of Ganoderma tsugae on regulating macrophage activation on the viability and growth ability of liver cancer cells: Prepare conditioned media with or without the polysaccharide of Ganoderma tsugae treatment of BMDMs, and use this conditioned media to culture liver cancer cells, and combine the MTT method to detect cell viability. As Figure 19 shown, compared with the blank group, the culture medium supernatant after treating BMDMs with the polysaccharide of Ganoderma tsugae can significantly inhibit the viability of liver cancer cells HLE ( Figure 19 A) in it and HCCLM3 ( Figure 19 B) in it. As Figure 20 shown, the culture medium supernatant after treating BMDMs with the polysaccharide of Ganoderma tsugae can significantly inhibit the growth ability of liver cancer cells HLE ( Figure 20 A) in it and HCCLM3 ( Figure 20 B) in it.

[0112] Test Example 3: Study on the inhibition of the progression of primary liver cancer by the polysaccharide of Ganoderma tsugae

[0113] (1) Test materials

[0114] Drugs: The polysaccharide of Ganoderma tsugae obtained in Example 1, normal saline.

[0115] Animals: A total of 18 6-week-old male C57BL / 6J mice, purchased from Nanchang Kaiyihe Biotechnology Co., Ltd. The animal experiment was carried out under the approval and supervision of the Laboratory Animal Management Committee of Nanchang University, permit number: SYXK (Gan) 2021-0004.

[0116] (2) Test methods

[0117] Animal husbandry, grouping, and administration: Mice were housed in an environment of 23±1℃, 50±5% humidity, and 12h light exposure. After one week of acclimatization, mice were randomly divided into three groups: a control group, a model group, and an Antrodia camphorata polysaccharide group, with six mice in each group. The model group and the Antrodia camphorata polysaccharide group were induced to develop primary liver cancer by tail vein injection of Akt / N-ras plasmid solution (50μL / g); mice in the control group were injected with an empty vector plasmid solution. Three weeks later, mice in the control group and the model group were administered physiological saline (10mL / kg / day) by gavage, while mice in the Antrodia camphorata polysaccharide group were administered 30mg / kg / day of Antrodia camphorata polysaccharide by gavage for a period of four weeks.

[0118] Sample collection: Two hours after the last administration, mice in each group were weighed and the data were recorded. Mice were euthanized, livers were harvested, excess blood was removed with physiological saline, moisture was blotted dry with filter paper, and the livers were weighed. Subsequently, the livers of mice in each group were immersed in tissue fixative containing 4% paraformaldehyde for later use.

[0119] Liver histopathological examination: Liver tissue fixed for 48 hours was dehydrated by soaking in 50%, 70%, 85%, 95%, and 100% ethanol solutions, followed by clearing in xylene and embedding in molten paraffin. The embedded liver tissue was cut into 5μm thick slices and rehydrated by soaking in xylene, xylene-ethanol solution, 100% ethanol, 80% ethanol, and distilled water, respectively. Hematoxylin and eosin staining was performed, and the pathological changes in each group of liver tissue were observed and recorded under a microscope.

[0120] Immunohistochemical detection of liver: Liver tissue sections were prepared and rehydrated according to the methods described in the liver histopathology section above. The rehydrated liver sections were blocked and co-incubated overnight at 4°C with Ki67 and PCNA antibodies, respectively. After rinsing, they were co-incubated with secondary antibodies at room temperature, rinsed, and co-incubated with DAB staining solution. Positive areas in each group of liver sections were observed and recorded under a microscope.

[0121] (3) Test results

[0122] Effects of Antrodia camphorata polysaccharides on liver histopathology in mice with hepatocellular carcinoma: such as Figure 21 As shown, compared with the control group, the liver tissue of the liver cancer mice showed an increased nucleocytoplasmic ratio and deeper nuclear staining, and more cysts and tumor nodules appeared in the liver. Treatment with Antrodia camphorata polysaccharide for 4 weeks could effectively alleviate the formation of cysts and tumor nodules in the liver of liver cancer mice, reflecting its good inhibitory effect on the occurrence and development of liver cancer.

[0123] Effects of Antrodia camphorata polysaccharides on the proliferation of liver cells in mice with hepatocellular carcinoma: Ki-67 and PCNA are nuclear antigens related to cell proliferation. Both are expressed more strongly in cells with high proliferation capacity, and therefore can serve as markers of cell proliferation. Cancer cells have a stronger proliferative capacity than normal cells, which is also related to... Figure 21 The results are similar to those in the previous section, from Figure 22 As can be seen, compared with the control group, the rate of Ki-67 and PCNA positive cells in the liver tissue of hepatocellular carcinoma mice was significantly increased. Antrodia camphorata polysaccharide significantly inhibited the rate of Ki-67 and PCNA positive cells in hepatocellular carcinoma mice, confirming its ability to inhibit hepatocellular carcinoma cell proliferation and alleviate hepatocellular carcinoma formation.

[0124] While embodiments of the present invention have been described in detail above, it will be apparent to those skilled in the art that various modifications and variations can be made to these embodiments. However, it should be understood that such modifications and variations fall within the scope and spirit of the invention as set forth in the claims. Furthermore, the invention described herein may have other embodiments and can be implemented or carried out in various ways.

Claims

1. The application of Antrodia camphorata polysaccharide in the preparation of anti-liver cancer drugs, characterized in that, The weight-average molecular weight (Mw) of the *Antrodia camphorata* polysaccharide is 15.0 kDa-17.5 kDa; it contains galactose, glucose, and mannose in a molar ratio of (0.10-0.15):(0.80-0.85):(0.03-0.05); and it contains the following two structural components: heteroglucan, whose main chain is →4)-α-D-Glcp-(1→ and →6)-α-D-Galp-(1→, the side chains include α-D-Glcp and α-L-Fucp, and the side chain α-D-Glcp is located at the O-6 position of α-D-Glcp and is linked to the main chain in the form of a 1→6 glycosidic bond, and the side chain α-L-Fucp is located at the α- The O-2 position of D-Galp is linked to the main chain via a 1→2 glycosidic bond; the β-glucan has a main chain of →6)-β-D-Glcp-(1→ and →3)-β-D-Glcp-(1→, with a side chain of β-D-Glcp, and the side chain β-D-Glcp is located at the O-6 position of β-D-Glcp and linked to the main chain via a 1→6 glycosidic bond; the Antrodia camphorata polysaccharide is obtained by fermentation extraction from the Antrodia camphorata strain with accession number CCTCC NO: M2015274; The camphor polysaccharide is a product extracted from the deep fermentation of camphor. The extraction method for the deep fermentation extract of Antrodia camphorata includes: fermenting and culturing Antrodia camphorata strain CCTCCNO: M2015274 in a fermentation medium, followed by extraction and separation of the extract; the fermentation medium includes: glucose 15g / L-25g / L, yeast extract 8g / L-12g / L, peptone 8g / L-12g / L, potassium dihydrogen phosphate 0.05g / L-0.15g / L, magnesium sulfate 0.3g / L-0.7g / L, and vitamin B1 0.05g / L-0.15g / L; the fermentation conditions are: Antrodia camphorata strain CCTCC NO: The inoculum size of M2015274 in the fermentation medium was 8%-12%; the fermentation temperature was 24℃-28℃; the flasks were shaken at a speed of 100r / min-150r / min; the fermentation cycle was 5d-9d; the extraction and separation process included the following steps: after the deep fermentation of Antrodia camphorata, the fermentation product was filtered, and the filter residue was collected to obtain Antrodia camphorata mycelium, which was used to extract Antrodia camphorata polysaccharides; the extraction of Antrodia camphorata polysaccharides included: using Antrodia camphorata mycelium as raw material, freeze-drying and grinding, followed by defatting, hot water extraction, water bath enzymatic hydrolysis, protein removal, alcohol precipitation and freeze-drying to obtain crude Antrodia camphorata polysaccharides, and then separating and purifying the crude Antrodia camphorata polysaccharides; the separation and purification method included fractional purification by sequential anion exchange chromatography and molecular sieve chromatography; the anion exchange chromatography included the use of a DEAE cellulose column; the molecular sieve chromatography included the use of a dextran gel column.

2. The application according to claim 1, characterized in that, The Antrodia camphorata polysaccharide plays a role in the preparation of anti-liver cancer drugs by regulating macrophage function.

Images