Cystathionine-beta synthetase mutant and application thereof
By mutating the N232E and I15L sites of cystathionine-β synthase, its thermal stability and catalytic activity are improved, solving the problems of insufficient thermal stability and catalytic activity of cystathionine-β synthase in the existing technology, and promoting the improvement of the accuracy of homocysteine detection and the storage performance of the reagent.
Patent Information
- Application Number
- CN202510636277.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-16
- Publication Date
- 2025-09-12
AI Technical Summary
The cystathionine-β synthase used for homocysteine detection in the prior art has deficiencies in thermal stability and catalytic activity, which affect the accuracy of the detection results and the long-term storage of the reagents.
By performing site-directed mutagenesis on the amino acid sequence of cystathionine-β synthase, especially modifying the N232E and I15L sites, its thermal stability and catalytic activity are improved, and a cystathionine-β synthase mutant with high thermal stability and high activity is constructed.
The thermal stability of cystathionine-β synthase has been improved, and it can withstand 55-60°C while maintaining enzyme activity above 79%, supporting efficient expression and industrial production, and improving the accuracy of homocysteine detection and reagent storage performance.
Smart Images
Figure BDA0005406740430000031 
Figure BDA0005406740430000032 
Figure BDA0005406740430000041
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of enzyme engineering, in particular to a cystathionine-β synthase mutant and application thereof. Background Art
[0002] Homocysteine (Hcy) is a sulfur-containing, non-protein amino acid. High blood homocysteine levels (called hyperhomocysteinemia) are considered a risk factor for various cardiovascular and cerebrovascular diseases. Therefore, accurate Hcy measurement is crucial for early diagnosis and risk assessment of clinical diseases.
[0003] Currently, homocysteine testing is primarily performed clinically using enzymatic assays, particularly the cyclic enzymatic assay, combined with fully automated biochemical analyzers. In this cyclic enzymatic assay, cystathionine β-synthase (CBS), the primary enzyme in the reaction, catalyzes the conversion of Hcy, playing a key role in the accuracy and efficiency of test results.
[0004] In existing technologies, CBS used for Hcy detection suffers from deficiencies in thermal stability and catalytic activity, particularly when compared to other enzymes used in the system, such as lactate dehydrogenase (LDH). Furthermore, the instability of CBL also impacts the long-term storage of diagnostic reagents. Therefore, developing highly thermally stable and highly active CBS through enzyme engineering has become a key approach to improving Hcy detection accuracy and reagent storage performance, and is of great significance for advancing related clinical diagnostic technologies. Summary of the Invention
[0005] In view of this, the present invention provides a cystathionine-β synthase mutant with higher thermal stability and its application.
[0006] The technical solution of the present invention is achieved as follows: In the first aspect, the present invention provides a cystathionine-β synthase mutant, which has the following site mutations on the basis of the cystathionine-β synthase with an amino acid sequence as shown in SEQ ID NO.1: N232E or I15L.
[0007] On the basis of the above technical solution, preferably, the amino acid sequence of the cystathionine-β synthase mutant after the N232E point mutation is as shown in SEQ ID NO.2.
[0008] On the basis of the above technical solution, preferably, the amino acid sequence of the cystathionine-β synthase mutant after the I15L point mutation is as shown in SEQ ID NO.3.
[0009] In a second aspect, the present invention provides a gene encoding the cystathionine-β synthetase mutant.
[0010] In a third aspect, the present invention provides a recombinant plasmid containing the above gene.
[0011] In a fourth aspect, the present invention provides Escherichia coli capable of expressing cystathionine-β synthase, which is obtained by transforming the above-mentioned recombinant plasmid into Escherichia coli.
[0012] In a fifth aspect, the present invention provides cystathionine-β synthase expressed and prepared by Escherichia coli.
[0013] In a sixth aspect, the present invention provides the use of the aforementioned cystathionine-β synthetase mutant, gene, or recombinant plasmid in the production of a homocysteine detection agent.
[0014] The cystathionine-β synthase mutant and its application of the present invention have the following beneficial effects compared with the prior art:
[0015] The present invention uses the amino acid sequence enzyme sequence shown in SEQ ID NO.1 as a parent, mutating positions 232 and 15 of the parent to GLU and LEU, respectively, thereby improving the thermal stability of cystathionine-β synthase, making it able to withstand temperatures of 55-60°C, and maintaining over 79% of its enzyme activity at 60°C. The method is simple and easy to implement, laying the foundation for mediating heterologous expression of cystathionine-β synthesis genes in an Escherichia coli expression system, and promoting the efficient expression and industrial production of cystathionine-β synthase. DETAILED DESCRIPTION
[0016] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0017] Example 1 Construction of cystathionine-β synthase mutants
[0018] In this example, cystathionine β-synthase (CBS) from Saccharomyces cerevisiae was expressed in Escherichia coli.
[0019] The protein sequence of Saccharomyces cerevisiae CBS (PDB ID: 6C2H) was obtained from an online database, and its amino acid sequence is shown in SEQ ID NO. 1. The CBS gene sequence was then optimized and artificially synthesized based on the codon preference of E. coli. Subsequently, the synthesized CBS gene was inserted into the expression vector pET-28a(+) through the NdeI and NotI restriction sites to construct the recombinant plasmid pET-28a-CBS. Finally, the recombinant plasmid was transformed into E. coli BL21(DE3) competent cells to obtain recombinant E. coli capable of expressing wild-type CBS.
[0020] Cystathionine β-synthase (CBS) amino acid sequence:
[0021]
[0022] (SEQ ID NO.1) The bold underline indicates the mutation point.
[0023] In this example, five cystathionine β-synthase (CBS) target mutants (I15L, S59A, M161N, N232E, and A293T) were designed and amplified by site-directed mutagenesis PCR using the recombinant plasmid pET-28a-CBS expressing the wild-type CBS gene as a template. Dedicated primers were designed for each mutation, and the specific sequences are detailed in Table 1.
[0024] Table 1 Primers used for site-directed mutagenesis
[0025] Primer Name Primer Sequence CBS-I15L-F GACCAACACCGCCTATGCCCCGAGTCAGGATTTCTGTAGCAAAATCCTC CBS-I15L-R GAAATCCTGACTCGGGGCATAGGCGGTGTTGGTCATCAACACATGATCG CBS-S59A-F GCATGGCCTACTCGTGGCCGGGGTATGAATCGTTGATCCTGGCAAATCAAC CBS-S59A-R GATTCATACCCCGGCCACGAGTAGGCCATGCTGAATAAACTGAAGTTATCC CBS-M161N-F GATTGTTGCCGCCGTACGCAGTGTGGTGCCGGATGCCATCATTATGATC CBS-M161N-R GGCACCACACTGCGTACGGCGGCAACAATCGCCGGAACGTCGTGG CBS-N232E-F TTTTAGCCCAACCTGAAAACTTGAATAAGACTGATATCACTGACTACAAAG CBS-N232E-R CAGTCTTATTCAAGTTTTCAGGTTGGGCTAAAATTGAACCGAATGGGTCAG CBS-A293T-F CTAAAATCGTGTTTCTGGAATCGCCAGGCTCCATCACCATGGAAGTCC CBS-A293T-R GTCGTGGACTTCCATGGTGATGGAGCCTGGCGATTCCAGAAACACG
[0026] The PCR reaction setup was as follows: initial denaturation at 95°C for 5 minutes; followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 60 seconds; and a final extension at 72°C for 5 minutes. After purification, the template plasmid was digested with DpnI (37°C for 2 hours) to remove the unmutated original template.
[0027] The PCR products, after enzyme digestion, were transformed into competent E. coli DH5α cells, and positive clones were screened. Subsequently, three single clones were selected for sequencing verification; those with completely correct sequencing results were the desired CBS mutants. Finally, recombinant plasmids of the five mutant CBSs were extracted and stored using a plasmid extraction kit in preparation for subsequent expression and purification experiments. The target backbone DNA was separated by agarose gel electrophoresis and recovered and purified using a Gel Extraction Kit (OMEGA). The purified mutant backbone DNA was added to competent E. coli DH5α cells, where the vector circularized using the strain's own repair mechanism. The transformed bacterial suspension was then plated on culture plates containing kanamycin (Kan) resistance and incubated at 37°C to screen for positive clones.
[0028] Colony PCR was performed on the resulting transformants using pET28a-F and pET28a-R primers. If the amplified fragment was consistent with the expected size, vector sequencing was performed (contracted to the Wuhan Branch of Beijing Qingke Biotechnology Co., Ltd.). If the obtained sequence was completely consistent with the design, the mutant vector was confirmed to be constructed correctly.
[0029] Finally, the verified mutation vector was transformed into Escherichia coli BL21 (DE3) to obtain a recombinant engineering strain that can be used for subsequent protein expression.
[0030] Example 2 Expression, purification and activity determination of recombinant cystathionine β-synthase (CBS)
[0031] The recombinant E. coli was streaked onto a solid LB plate containing 45 μg / mL kanamycin and cultured at 37°C overnight to obtain a single clone. A single clone was picked and inoculated into 5 mL of liquid LB medium and placed in a 37°C constant temperature shaker for overnight culture. Subsequently, the cultured seed liquid was inoculated into 700 mL of double LB medium at a ratio of 1% and cultured at 30°C until the cells grew to an OD of 600 When the kinetics reaches 0.8-1.0, add IPTG to a final concentration of 0.2 mM for induction and continue culturing at 25°C for 10-15 hours. After induction, collect the cells by centrifugation at 4°C.
[0032] After the bacteria were collected, 10 mL of crushing liquid was added to each 1 g of wet weight of bacteria for suspension and placed in an ice-water bath for ultrasonic crushing (450 W, ultrasonic 3s, interval 5s, continuous 30 min). The crushed mixture was centrifuged at 11,000 rpm for 13-35 minutes, and the supernatant was taken as crude protein. The supernatant was loaded onto a pre-equilibrated nickel affinity chromatography column, and non-specific binding proteins were removed using PBS buffer containing 25 mM imidazole. The purified target protein CBS was then collected with an eluent containing 340 mM imidazole. The eluted protein was further desalted by molecular sieves to finally obtain a high-purity CBS enzyme solution.
[0033] Next, the CBS enzyme activity assay was performed. The assay system, with a total volume of 200 μL, included Tris-HCl buffer (100 mmol / L, pH 8.0), L-serine (5 mmol / L), homocysteine (10 mmol / L), NADH (1 mmol / L), lactate dehydrogenase (LDH, 2 KU / mL), and cystathionine β-lyase (CBL, 50 U / mL).
[0034] Add the mixed reaction system to a 96-well plate and incubate in a microplate reader at 37°C for 5 minutes. Add 2 μL of the CBS enzyme solution to be tested, diluted to 0.2 mg / mL, to each well. Incubate for 10 minutes, and record the absorbance change at 340 nm in real time. Use the system without CBS enzyme solution as a blank control.
[0035] The activity of CBS enzyme is defined as the amount of enzyme that catalyzes the production of 1 μmol of L-cystathionine per minute at pH 8.0 and 37°C, which is 1 unit (U).
[0036] Example 3 Screening of cystathionine-β synthetase mutants:
[0037] The enzyme activity of the supernatants of wild-type CBS and five CBS mutants was measured, with the activity of each enzyme before heat treatment set to 100%. The supernatants of wild-type and five mutant CBS were also treated at 50°C, 55°C, and 60°C for 30 minutes, and the residual enzyme activity after heat treatment was measured. The ratio of the residual enzyme activity after heat treatment to the untreated enzyme activity was calculated as the residual enzyme activity rate after heat treatment. The results are shown in the table below.
[0038] Table 2 Enzyme activity after heat treatment at 50℃
[0039]
[0040] As shown in the table above, the wild-type CBS had a residual enzyme activity of 18% after treatment at 50°C for 30 minutes. The CBS mutants N232E and I15L showed significantly improved thermostability, with residual enzyme activities of 86% and 76%, respectively, after treatment at 55°C for 30 minutes. The other mutants exhibited thermostability issues.
[0041] Table 3 Enzyme activity after heat treatment at 55℃
[0042]
[0043] As shown in the table above, the wild-type CBS had a residual enzyme activity of 19% after treatment at 55°C for 30 minutes. The CBS mutants N232E and I15L showed significantly improved thermostability, with residual enzyme activities of 84% and 85%, respectively, after treatment at 55°C for 30 minutes. Other mutants exhibited thermotolerance.
[0044] Table 4 Enzyme activity after heat treatment at 60℃
[0045]
[0046] As shown in the table above, the wild-type CBS had a residual enzyme activity of 10% after treatment at 60°C for 30 minutes, while the thermal stability of the CBS mutants N232E and I15L was significantly improved, with the residual enzyme activities being 81% and 70% respectively after treatment at 60°C for 30 minutes.
[0047] Next, the specific enzyme activities of the purified CBS mutants N232E and I15L were determined. The CBS activity determination conditions are shown in Example 2. The results are shown in Table 5
[0048] The purification scheme is as follows: the crude enzyme sample after cleavage is filtered through a 0.45 μm filter membrane and then subjected to Ni affinity chromatography. 25 mM imidazole is first used to remove impurities, and then 340 mM imidazole is used to elute the target protein. Finally, the eluted protein is desalted with a molecular sieve to obtain a high-purity CBS enzyme solution. The eluates of each part are as follows:
[0049] Ni column equilibration solution: PBS buffer containing 5 mM imidazole, pH 7.4;
[0050] Ni column wash solution: PBS buffer containing 25 mM imidazole, pH 7.4;
[0051] Ni column eluent: PBS buffer containing 340 mM imidazole, pH 7.4;
[0052] Molecular sieve equilibration solution: PBS buffer, pH 7.4.
[0053] Table 5 Enzyme activity of CBS mutants after purification
[0054] Mutation Site Specific Activity (U / mg) WT 35 N232E 49 I15L 40
[0055] The results showed that the specific activity of CBS mutant N232E was 49 U / mg, and that of mutant I15L was 40 U / mg. Compared with the activity of wild-type CBS (35 U / mg), the specific activity of mutant N232E increased by 40%, but the specific activity of mutant I15L did not increase significantly.
[0056] In summary, the thermal stability and catalytic activity of mutant N232E were greatly improved, while the thermal stability of mutant I15L was greatly improved, but the improvement in enzyme activity was not obvious. Mutant N232E had the best effect.
[0057] The amino acid sequence of mutant I15L is:
[0058] (SEQ ID NO. 2) The bold underline indicates the mutation point.
[0059] The amino acid sequence of mutant N232E is: (SEQ ID NO.3) The bold underline indicates the mutation point.
[0060] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A cystathionine-β synthase mutant, characterized in that: Based on the amino acid sequence of cystathionine-β synthase as shown in SEQ ID NO.1, the following site mutations occur: N232E or I15L.
2. A cystathionine-β synthase mutant according to claim 1, characterized in that: The amino acid sequence of the cystathionine-β synthase mutant after the N232E point mutation is shown in SEQ ID NO.
2.
3. A cystathionine-β synthase mutant according to claim 1, characterized in that: The amino acid sequence of the cystathionine-β synthase mutant after the I15L point mutation is shown in SEQ ID NO.
3.
4. A gene encoding the cystathionine-β synthetase mutant according to any one of claims 1 to 3.
5. A recombinant plasmid containing the gene according to claim 4.
6. An Escherichia coli capable of expressing cystathionine-β synthase, characterized in that: The recombinant plasmid according to claim 4 is transformed into Escherichia coli to obtain the result.
7. Cystathionine-β synthetase produced by expression in Escherichia coli according to claim 6.
8. Use of the cystathionine-β synthetase mutant according to any one of claims 1 to 3, or the gene according to claim 4, or the recombinant plasmid according to claim 5 in the production of a homocysteine detecting agent.