Application of alpha-cyperone in treatment of sepsis

Abstract

The invention discloses application of alpha-cyperone in preparation of drugs for treating sepsis, a mouse sepsis model is constructed by adopting a cecum ligation perforation (CLP) method, and through sepsis symptom clinical scoring and open field experiments, it is found that alpha-cyperone reverses the sepsis symptom, recovers the weight of a mouse and reduces the death rate of the mouse; through a Q-PCR (Quantitative Polymerase Chain Reaction) method, a Western Blot method and the like, the alpha-cyperone is found to alleviate oxidative stress and cell inflammatory factor expression, alleviate brain synaptic dysfunction and alleviate nerve cell pyroptosis in a hippocampus area; animal experiments find that alpha-cyperone has the function of improving sepsis-related encephalopathy, and in a word, a new way is provided for sepsis treatment.

Description

Technical Field

[0001] The invention relates to application of α-cyperone in preparing a medicament for treating sepsis, and belongs to the technical field of medicine. Background Art

[0002] Sepsis is a systemic inflammatory response syndrome caused by the invasion of pathogenic microorganisms such as bacteria and fungi. It results from an imbalanced response to infection, ultimately leading to life-threatening organ dysfunction. The brain is one of the organs most vulnerable to sepsis, and brain damage caused by sepsis is known as sepsis-associated encephalopathy (SAE). Clinical studies have shown that approximately 70% of patients with sepsis develop encephalopathy, which significantly increases mortality and causes long-term cognitive impairment in sepsis survivors. Clinical manifestations such as confusion, anxiety, irritability, and cognitive impairment severely impact patient prognosis and reduce quality of life. Patients require long-term rehabilitation and adequate nursing care, which creates a significant economic burden. SAE is associated with factors such as neuronal damage, oxidative stress, and increased blood-brain barrier permeability. Neuronal damage is a key process in the development of SAE. Infection causes an inflammatory response, which increases the permeability of the blood-brain barrier. Inflammatory mediators in the plasma pass through the damaged blood-brain barrier and enter the central nervous system. Proinflammatory mediators such as nitric oxide (NO), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6) and other inflammatory factors are released to activate microglia. Their activation can cause tissue damage and synaptic dysfunction, resulting in neurological dysfunction.

[0003] α-Cyperone, primarily extracted from Cyperus rotundus, is a natural product with significantly lower toxic side effects than synthetic drugs. Animal studies have shown no significant toxicity with long-term administration, making it suitable for long-term use. α-Cyperone is a sesquiterpenoid known for its anti-inflammatory properties. However, there are currently no reports on its use in the treatment of sepsis. Summary of the Invention

[0004] The present invention provides a new use of α-cyperone, namely, use of α-cyperone in preparing a medicament for treating sepsis.

[0005] The α-cyperone in the present invention is a conventional commercial product.

[0006] The component (or active ingredient) of the drug for treating sepsis-related encephalopathy of the present invention is α-cyperone, and one or more pharmaceutically acceptable excipients may be added, or the drug may be compounded with other active ingredients to exert a therapeutic effect. In addition to being made into tablets, the drug can also be made into various pharmaceutically acceptable forms such as pills, powders, capsules, granules, oral solutions and injections.

[0007] This study established a mouse sepsis model using the cecal ligation and puncture (CLP) method. The septic mice were then treated with intraperitoneal injections of α-cyperone. Clinical scores of sepsis symptoms and open-field tests revealed that α-cyperone reversed sepsis symptoms, restored mouse body weight, and reduced mortality. Furthermore, α-cyperone was found to reduce oxidative stress and the expression of inflammatory factors, alleviate brain synaptic dysfunction, and mitigate pyroptosis in the hippocampus. Animal studies have shown that α-cyperone ameliorates sepsis-related encephalopathy, likely due to its ability to reduce neuronal damage, oxidative stress, and pyroptosis.

[0008] The present invention reveals the therapeutic potential of α-cyperone against the pathological mechanisms of sepsis (neuronal cell damage, cell pyroptosis, and increased oxidative stress levels). α-cyperone has the specific properties of high lipid solubility and suitable molecular weight, and can be rapidly distributed to brain tissue to treat brain damage and neurological dysfunction caused by sepsis. α-cyperone also has few side effects and high compliance, making it suitable for long-term use in patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 The results of the CCK8 assay for the toxicity of α-cyperone to BV2 cells; Figure 2 Clinical scoring results for mice; Figure 3 This is the result of mouse weight test; Figure 4 The results are the mouse survival rate; Figure 5 The trajectory diagram (left) and trajectory heat map (right) of the mouse open field test; Figure 6 Schematic diagram of the statistical results of the open field test for mice, where the left figure shows the total distance the mice travel, the middle figure shows the average movement speed of the mice, and the right figure shows the maximum movement speed of the mice; Figure 7 The results of Q-PCR detection of mRNA expression of inflammatory factors (TNF-α, IL-6, IL-1β, iNOS) in mouse brain; Figure 8 Professional test kits are used to detect the levels of lactate dehydrogenase (LDH), nitric oxide (NO), and glutathione (GSH); Figure 9 The results of Q-PCR detection of mRNA expression of synaptic plasticity-related proteins (BDNF, PSD95, SYP) in mouse brain; Figure 10 Western Blot was used to detect the expression of pyroptosis-related proteins (NLRP3, Caspase1, GSDMD) in the mouse hippocampus. DETAILED DESCRIPTION

[0010] The present invention will be further described below with reference to the examples. However, the scope of the present invention is not limited to the following examples. Those skilled in the art will appreciate that various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. The instruments, reagents, and materials involved in the following examples, unless otherwise specified, are conventional instruments, reagents, and materials already available in the prior art and can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following examples, unless otherwise specified, are conventional experimental methods and detection methods already available in the prior art.

[0011] Example 1: Toxicity detection experiment of α-cyperone on BV2 cells Prepare DMEM medium containing 10% fetal bovine serum (FBS) and 100 U / mL penicillin-streptomycin, and then adjust the BV2 cell density to 5×10 4 cells / mL, and then the BV2 cell suspension with adjusted cell density was inoculated into 96-well plates at a volume of 100 μL per well, and cultured in a humidified atmosphere of 5% CO2 at 37°C for 24 h to allow BV2 cells to adhere to the plate; BV2 cells adhered to the wall of a 96-well plate were incubated with DMEM medium (100 μL per well) containing 0, 6.25, 12.5, 25, and 100 μM α-cyperone for 24 hours. 10 μL of CCK8 reagent was then added to each well, gently mixed, and incubated at 37°C in the dark for 2 hours. The absorbance (OD) was then measured at 450 nm using a microplate reader.

[0012] Cell viability was calculated as follows: cell viability (%) = × 100%; See the results Figure 1 As can be seen from the figure, there is no difference between the α-cyperone-treated group and the control group. The results show that the α-cyperone concentration is lower than 100 μM and has no cytotoxicity to BV2 cells.

[0013] Example 2: Treatment of α-cyperone on cecal ligation and puncture-induced sepsis in mice C57BL / 6J male mice, 20–22 g, were housed at the Experimental Animal Center of Kunming University of Science and Technology with free access to food and water at room temperature of 22 ± 1°C, relative humidity of 55–65%, and a 12-h light cycle. The above mice were randomly divided into 3 groups, with 10 mice in each group; All experiments were performed after one week of acclimatization. Mice were randomly divided into three groups: control, model, and α-cyperone-treated groups. A sepsis model was established in the model and α-cyperone-treated groups using cecal ligation and puncture (CLP), while the control group underwent laparotomy and suturing (sham surgery). Mice were anesthetized with isoflurane, and abdominal hair was shaved with an electric shaver and disinfected with iodine. A scalpel was used to longitudinally incise the midline of the skin, identify the white line of the abdominal muscle tissue, and perform an incision between the muscles and the fascia. The cecum was located using forceps and ligated at different locations with sutures. A needle was used to penetrate the cecum and squeeze out a small amount of cecal contents. The contents were cleaned with an alcohol cotton ball and the cecum was placed in the abdominal cavity. The muscle layer and skin were sutured, and the wound was disinfected with iodine to complete the model construction. Six hours after modeling, mice in the α-cyperone treatment group were intraperitoneally injected with α-cyperone (10 mg / kg) once, and again 12 hours later, and once daily from the second to the eighth day. At the same time, the control and model groups were injected with an equal amount of normal saline. Twenty-four hours after modeling, the following sepsis symptoms were clinically scored in the three experimental groups: lethargy, piloerection, tremor, periorbital exudate, respiratory distress, and diarrhea (each positive sign was scored as 1 point, with a maximum score of 6 points). Survival rates and body weight changes of the mice were observed and calculated on day 8 of modeling. Anxiety and spontaneous activity behavior of the mice were observed using an open field test. The results are as follows Figure 2-4 As shown, within 8 days of modeling, the mice in the model group lost weight, had an increased mortality rate, and had significantly stronger sepsis symptoms than those in the α-cyperone-treated group; The results of the open field test are shown in Figure 5 、 Figure 6 As can be seen from the figure, the average speed, maximum speed and average moving distance of the mice in the model group were significantly decreased, and from the trajectory map and heat map, it can be observed that the mice in the model group showed a significantly shortened residence time in the central area in the open field test; this avoidance behavior of the central area is related to the enhanced tactility of rodents, reflecting a decreased willingness to explore novel environments under anxiety conditions, which indicates that the mice in the model group showed symptoms of anxiety and cognitive impairment of sepsis-related encephalopathy; and α-cyperone treatment reversed the symptoms of the mice, and the average speed, maximum speed and average moving distance were all restored.

[0014] Example 3: Regulatory effect of α-cyperone on the expression of inflammatory factors in the brain of mice with CLP-induced sepsis On the 9th day of modeling, the mice were dissected, and the hippocampal tissue of the mouse brain was obtained. Tizol lysis buffer was added to extract total RNA, and the RNA concentration and purity were determined. Then, the RNA was reverse transcribed into cDNA using a reverse transcription kit; The cDNA was used as a template and the following primers were used for amplification. The relative expression levels of TNF-α, IL-6, IL-1β, and iNOS were calculated (2^(-ΔΔCt) method), with β-actin as an internal reference.

[0015] TNF-α-F: CACCATGAGCACGGAAAGCA; TNF-α-R: GCAATGACTCCAAAGTAGACC; IL-6-F: GAGAAAAGAGTTGTGCAATGGCA; IL-6-R: AGTGCATCATCGCTGTTCATACA; IL-1β-F:TGGGCCTCAAAGGAAAGAAT; IL-1β-R:CAGGCTTGTGCTCTGCTTGT; iNOS-F: CACCTACTTCCTGGACATCACTAC; iNOS-R: GTACTCTGAGGGCTGACACAAG β-actin-F: CATGTGCAAGGCCGGCTTCG; β-actin-R: GTAGCAGGAGAAGTTGTTGG; The real-time PCR reaction system was as follows: 10 μL of SYBR Green Master Mix (2×), 0.4 μL of each primer (10 μmol / L), 1 μL of template cDNA, and ddH2O to a total volume of 20 μL. The reaction conditions were as follows: 94°C for 15 s, followed by 40 cycles of denaturation at 94°C for 15 s, annealing at 60°C for 5 s, and extension at 72°C for 10 s. After the reaction, the amplification curve was adjusted to a linear distribution, and the Ct value of each sample was read for relative quantification.

[0016] The results are as follows Figure 7 As shown in the results, the RNA of TNF-α, IL-6, IL-1β and iNOS in the brain of the model group mice increased significantly after modeling, while α-cyperone treatment reversed this process and significantly reduced the expression of inflammatory factors, proving that α-cyperone has the ability to alleviate neuroinflammation in mice in vivo experiments.

[0017] Example 4: Alleviating effect of α-cyperone on oxidative stress in the brain of mice with sepsis-related encephalopathy induced by CLP The levels of lactate dehydrogenase (LDH), nitric oxide (NO), and glutathione (GSH) were measured using commercially available professional kits (Nanjing Jiancheng Bioengineering Institute) to detect the level of oxidative stress.

[0018] The results are as follows Figure 8 As shown in the results, the release of LDH and NO in the brain of the model group mice was aggravated and the release of GSH was reduced, while after treatment with α-cyperone, the release of LDH and NO in the brain of the mice was reduced and the release of GSH was increased. The results showed that α-cyperone has the ability to reduce oxidative stress.

[0019] Example 5: Regulatory effect of α-cyperone on synaptic-related proteins in the hippocampus of CLP-induced septic mice On the 9th day of modeling, the mice were dissected, and the hippocampal tissue of the mouse brain was obtained. Tizol lysis buffer was added to extract total RNA, and the RNA concentration and purity were determined. Then, the RNA was reverse transcribed into cDNA using a reverse transcription kit; Then, cDNA was used as a template and amplified using the following primers to calculate the relative expression levels of BDNF, PSD95, and SYP (2^(-ΔΔCt) method), with β-actin as an internal reference; BDNF-F:TGGAACTCGCAATGCCGAACTAC; BDNF-R:TCCTTATGAACCGCCAGCCAATTC; PSD95-F:AAGAGAGATGTCCCAGAGACCAAGAG; PSD95-R:CATAATAGTCCAGGATGTCCAGCAAGG SYP-F:ACTTATGGTTCGTGTTCAAGGAGACAG SYP-R:AGCCCGCATCGCCGTAGG β-actin-F: CATGTGCAAGGCCGGCTTCG β-actin-R:GTAGCAGGAGAAGTTGTTGG The real-time PCR reaction system was as follows: 10 μL of SYBR Green Master Mix (2×), 0.4 μL of each primer (10 μmol / L), 1 μL of template cDNA, and ddH2O to a total volume of 20 μL. The reaction conditions were as follows: 94°C for 15 s, followed by 40 cycles of denaturation at 94°C for 15 s, annealing at 60°C for 5 s, and extension at 72°C for 10 s. After the reaction, the amplification curve was adjusted to a linear distribution, and the Ct value of each sample was read for relative quantification.

[0020] The results are as follows Figure 9 As shown in the results, the RNA expression of BDNF, PSD95, and SYP in the brains of mice in the model group was significantly reduced, while α-cyperone reversed this process and increased the expression of synapse-related proteins, proving that α-cyperone has the ability to restore synapses in in vivo experiments.

[0021] Example 6: Regulatory effect of α-cyperone on CLP-induced pyroptosis in the hippocampus of septic mice On the 9th day of modeling, the mice were dissected and the hippocampal tissue of the mouse brain was obtained. The hippocampal tissue of the mouse was ground and added with RIPA lysis buffer to extract protein. The expression of pyroptosis-related proteins in the hippocampus was detected by Western Blot technology; The results are as follows Figure 10 As shown in the results, the protein expressions of NLRP3, Caspase1, and GSDMD in the hippocampus of model group mice increased significantly after modeling, while α-cyperone reversed this process, proving that α-cyperone has the ability to alleviate cell pyroptosis in in vivo experiments.

Claims

1. Application of α-cyperone in the preparation of drugs for treating sepsis.

Images