Escherichia coli for producing dodecanedioic acid as well as construction method and application thereof

By constructing the quorum sensing system luxI/luxR and key enzyme genes in Escherichia coli, the self-induced synthesis of dodecanedioic acid was achieved, solving the environmental problems of chemical synthesis and the problem of insufficient cell growth, and achieving the effect of efficient production of dodecanedioic acid.

CN120648629APending Publication Date: 2025-09-16SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410283418.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-03-13
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

In the existing technology, the chemical synthesis of dodecanedioic acid requires harsh conditions such as high temperature and high pressure, and uses petroleum-based raw materials, which is not environmentally friendly. At the same time, prematurely starting the synthesis of dodecanedioic acid will affect acetyl-CoA for cell growth, resulting in insufficient cell growth.

Method used

A type of Escherichia coli was constructed, and by integrating the quorum sensing system luxI/luxR and key enzyme genes into its genome, the auto-induced synthesis of dodecanedioic acid was achieved, balancing cell growth and product synthesis. The LuxI/LuxR system and key enzymes such as UcfatB and CYP153A-BM3 in Vibrio fischeri were used to optimize gene expression regulation.

Benefits of technology

The efficient production of dodecanedioic acid in Escherichia coli was achieved, with a yield of more than 300 mg/L, balancing cell growth and product synthesis, avoiding the environmentally unfriendly problems of chemical synthesis, and not relying on petroleum-based raw materials.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention provides Escherichia coli for producing dodecanedioic acid. The genotypes of the Escherichia coli are as follows: tesA: PtluxR-PluxluxIUcfatB, adhE: PtluxR-PluxluxIUc fatB, fadE: PluxCYP153A-BM3, pgi: PluxCYP153A-BM3, and pCDF-Pl uxpaoBaldB-PluxpuuCbetaB-PluxpatDfeaBgadB. The invention further provides a preparation method of the Escherichia coli for producing the dodecanedioic acid. The Escherichia coli can be used for preparing the dodecanedioic acid. The invention also provides a construction method of Escherichia coli for producing dodecanedioic acid, a quorum sensing system in Vibrio fischeri is constructed in Escherichia coli and the synthesis rate of AHL is slowed down, so that an engineering strain for efficiently producing dodecanedioic acid is obtained, and self-induced synthesis of dodecanedioic acid and balance of cell growth and product synthesis can be realized. The constructed Escherichia coli can be used for producing dodecanedioic acid from glucose or dodecanedioic acid from 12-hydroxydodecanoic acid.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial engineering, and particularly relates to an Escherichia coli producing dodecanedioic acid, a construction method thereof, and an application thereof. Background Art

[0002] Escherichia coli is widely used in fields such as enzyme engineering, metabolic engineering and pharmaceutical engineering, and is the most commonly used strain in genetic engineering. At present, the genetic modification strategy commonly used in Escherichia coli is mainly to carry out static regulation through gene overexpression and gene knockout. Although these strategies have improved the production performance of the strain to a certain extent, they are usually unable to balance the growth of the strain and the synthesis of the target product. In addition, although the inducible promoter commonly used in Escherichia coli can achieve the balance of growth and production to a certain extent, due to the expensive and toxic inducer, it is restricted in the large-scale production process. Therefore, it is necessary to develop a dynamic control element with wide adaptability to adapt to different industrial production processes.

[0003] Quorum sensing is a system used by microorganisms to regulate gene expression. The inducer is a signaling molecule secreted by the microorganism itself. As the microorganism grows and its population density increases, the concentration of the inducer accumulates. When the inducer concentration reaches a threshold, the expression of the relevant genes is induced. Quorum sensing systems vary among microorganisms. For example, the LuxI / LuxR system in Vibrio fischeri: as cell density increases, the amount of the signaling molecule acylhomoserine lactone (AHL) synthesized by the signaling molecule synthase LuxI increases. AHL freely enters and exits the cell along a concentration gradient, accumulating inside and outside the cell. When the AHL concentration reaches a certain threshold, AHL binds to the signaling molecule binding protein LuxR, forming a LuxR-AHL dimer. This dimer acts as an activator of the promoter Plux, thereby activating transcription of genes controlled by Plux.

[0004] Dodecanedioic acid is a long-chain dicarboxylic acid used in the production of high-value-added nylon 6 / 12, nylon 12 / 12, paints, and coatings. As early as 2015, the market value of dodecanedioic acid reached US$370 million. Currently, the chemical synthesis of dodecanedioic acid requires high temperatures and high pressures, along with the use of large quantities of strong acids and highly toxic oxidants. This not only places high demands on the synthesis equipment but is also environmentally unfriendly. While it is currently possible to convert dodecane to dodecanedioic acid through bioconversion using the yeast Candida viswanathii, this still requires the use of non-renewable energy sources such as petroleum. Therefore, the development of an environmentally friendly, green, and renewable method for synthesizing dodecanedioic acid is crucial.

[0005] The heterologous synthesis of dodecanedioic acid in Escherichia coli proceeds as follows: 1. Acetyl-CoA is synthesized into dodecanedioic acid by lauroyl-ACP thioesterase (UcfatB); 2. Dodecanedioic acid is converted to 12-hydroxydodecanedioic acid under the catalysis of cytochrome P450 enzyme (CYP153A-BM3); 3. 12-hydroxydodecanedioic acid is finally converted to dodecanedioic acid under the action of aldehyde dehydrogenase (paoB), acetaldehyde dehydrogenase B (AldB), aldehyde dehydrogenase (puuC), betaine aldehyde dehydrogenase (betB), aldehyde dehydrogenase (patD), phenylacetaldehyde dehydrogenase (feaB), or succinate semialdehyde dehydrogenase (GabD). However, intracellular acetyl-CoA is a critical precursor for cell growth. Premature initiation of dodecanedioic acid synthesis can result in insufficient acetyl-CoA for cell growth, thus affecting cell growth. Summary of the Invention

[0006] The purpose of the present invention is to overcome the problem in the prior art that premature initiation of dodecanedioic acid synthesis leads to insufficient acetyl-CoA for growth in cells, thereby affecting cell growth.

[0007] To this end, the present invention provides an Escherichia coli that produces dodecanedioic acid, wherein the genotype of the Escherichia coli is tesA::P tet _luxR-P lux _luxI_UcfatB, adhE::P tet _luxR-P lux _luxI_UcfatB, fadE::P lux _CYP153A-BM3, pgi::P lux _CYP153A-BM3, pCDF-P lux _paoB_aldB-P lux _puuC_betB-P lux _patD_feaB_gadB;

[0008] Among them, P lux The nucleotide sequence of luxI is shown in SEQ ID NO 1; the nucleotide sequence of luxR is shown in SEQ ID NO 3; tet The nucleotide sequence is shown in SEQ ID NO 4; M12The nucleotide sequence of UcfatB is shown in SEQ ID NO 5; the amino acid sequence of UcfatB is shown in SEQ ID NO 6; the amino acid sequence of CYP153A-BM3 is shown in SEQ ID NO 7; the amino acid sequence of paoB is shown in SEQ ID NO 8; the amino acid sequence of AldB is shown in SEQ ID NO 9; the amino acid sequence of puuC is shown in SEQ ID NO 10; the amino acid sequence of betB is shown in SEQ ID NO 11; the amino acid sequence of patD is shown in SEQ ID NO 12; the amino acid sequence of feaB is shown in SEQ ID NO 13; and the amino acid sequence of GabD is shown in SEQ ID NO 14.

[0009] The present invention also provides a method for constructing Escherichia coli for producing dodecanedioic acid, comprising the following steps:

[0010] (1) Integrate the luxI, luxR, and UcfatB genes and the promoters that control their expression into the tesA gene locus of the Escherichia coli genome to construct strain M22;

[0011] (2) Based on the M22 strain, the same sequence as in step (1) was integrated into the ad hE gene locus to obtain strain M73;

[0012] (3) Based on the M73 strain, the CYP153A-BM3 encoding gene and the promoter controlling CYP153A-BM3 expression were integrated into the fadE site of Escherichia coli to obtain strain M209;

[0013] (4) Based on the M209 strain, the CYP153A-BM3 encoding gene and the promoter controlling CYP153A-BM3 expression were integrated into the pgi site of Escherichia coli to obtain strain M210;

[0014] (5) The genes encoding paoB, aldB, puuC, betB, patD, feaB, and gabD and the promoters controlling the expression of paoB, aldB, puuC, betB, patD, feaB, and gabD were constructed into the pCDF plasmid to obtain a recombinant plasmid, which was then transformed into strain M210 to obtain Escherichia coli that produces dodecanedioic acid.

[0015] Specifically, the promoter for controlling the expression of luxI and UcfatB in the above step (1) is selected from P lux ; The promoter controlling luxR expression is selected from P tet .

[0016] Specifically, the promoter for controlling the expression of CYP153A-BM3 in the above step (3) is selected from Plux .

[0017] Specifically, the promoter for controlling the expression of paoB, aldB, puuC, betB, patD, feaB, and gabD in step (5) above is selected from P lux The gene and promoter were constructed into pCDF plasmid to obtain the recombinant plasmid pCDF-P lux _paoB_aldB-P lux _puuC_betB-P lux _patD_feaB_gadB.

[0018] The present invention also provides a method for producing dodecanedioic acid: the dodecanedioic acid-producing Escherichia coli is inoculated into a culture medium for fermentation, and the dodecanedioic acid in the fermentation product is collected.

[0019] Specifically, the culture medium is a TB culture medium supplemented with 5-50 g / L glucose, 0.1-1 g / L ferrous sulfate heptahydrate, and 5-50 mM 5-aminolevulinic acid hydrochloride.

[0020] Specifically, the culture medium is TB culture medium supplemented with 1-100 g / L 12-hydroxydodecanoic acid.

[0021] The present invention also provides an engineered bacterium for producing dodecanedioic acid, wherein the genome of the engineered bacterium is deleted from an aldehyde dehydrogenase encoding gene, an acetaldehyde dehydrogenase encoding gene, an aldehyde dehydrogenase encoding gene, a betaine aldehyde dehydrogenase encoding gene, an aldehyde dehydrogenase encoding gene, a phenylacetaldehyde dehydrogenase encoding gene or a succinate semialdehyde dehydrogenase encoding gene.

[0022] Specifically, the above-mentioned engineered bacteria uses Escherichia coli as the starting bacteria.

[0023] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0024] 1. The E. coli shake flask fermentation method for producing dodecanedioic acid provided by the present invention can produce dodecanedioic acid from glucose with a yield of more than 300 mg / L; or produce dodecanedioic acid from 1 g / L of 12-hydroxydodecanoic acid with a yield of more than 900 mg / L.

[0025] 2. The method for constructing the dodecanedioic acid-producing Escherichia coli provided by the present invention constructs the quorum sensing system of Vibrio fischeri in Escherichia coli and slows down the synthesis rate of AHL to obtain an engineered strain that efficiently produces dodecanedioic acid. This can achieve self-induced synthesis of dodecanedioic acid, balance cell growth and product synthesis, and realize the synthesis of dodecanedioic acid from glucose.

[0026] 3. The engineered bacteria for producing dodecanedioic acid provided by the present invention are preferably Escherichia coli as the starting bacteria, and by knocking out the aldehyde dehydrogenase encoding gene, acetaldehyde dehydrogenase encoding gene, aldehyde dehydrogenase encoding gene, betaine aldehyde dehydrogenase encoding gene, aldehyde dehydrogenase encoding gene, phenylacetaldehyde dehydrogenase encoding gene or succinate semialdehyde dehydrogenase encoding gene in its genome, it is possible to prevent the overoxidation of dodecanedioic acid during the synthesis process. DETAILED DESCRIPTION

[0027] The technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Although the representative embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes can be made to the present invention without departing from the scope of the present invention. Therefore, the scope of the present invention should not be limited to the embodiments, but should be defined by the appended claims and their equivalents.

[0028] The effects of the dodecanedioic acid-producing Escherichia coli and the construction method of the present invention are studied below through specific examples.

[0029] Example 1:

[0030] The method for constructing dodecanedioic acid-producing Escherichia coli based on the quorum sensing system of this embodiment includes the following steps:

[0031] (1) The luxI, luxR, and UcfatB genes and the promoters that control their expression were integrated into the tesA gene site of the Escherichia coli MG1655 genome to construct strain M22.

[0032] The promoters controlling the expression of luxI and UcfatB were selected from P lux ; The promoter controlling luxR expression is selected from P tet The genotype of strain M22 is tesA::P tet _luxR-P lux _luxI_UcfatB.

[0033] (2) Based on the M22 strain, the same sequence as in step (1) was integrated into the adh E gene locus to obtain strain M73, whose genotype was tesA::P tet _luxR-P lux _luxI_Ucfat B、adhE::P tet _luxR-P lux _luxI_UcfatB.

[0034] (3) Based on the M73 strain, the cytochrome P450 enzyme (CYP153A-BM3) encoding gene and the promoter controlling the expression of CYP153A-BM3 were integrated into the fadE site of Escherichia coli. The promoter controlling the expression of CYP153A-BM3 was selected from P lux , and obtained strain M209, whose genotype was tesA::P tet _luxR-P lux _luxI_UcfatB, adhE::P tet _luxR-P lux _luxI_UcfatB, fadE::P lux _CYP153A-BM3.

[0035] (4) Based on the M209 strain, the CYP153A-BM3 encoding gene and the promoter controlling the expression of CYP153A-BM3 were integrated into the pgi site of Escherichia coli. The promoter controlling the expression of CYP153A-BM3 was selected from P lux , and obtained strain M210, whose genotype was tesA::P tet _luxR-P lux _luxI_UcfatB, adhE::P tet _luxR-P lux _luxI_UcfatB, fadE::P lux _CYP153A-BM3, pgi::P lux _CYP153A-BM3.

[0036] (5) The genes encoding aldehyde dehydrogenase (paoB), acetaldehyde dehydrogenase B (aldB), aldehyde dehydrogenase (puuC), betaine aldehyde dehydrogenase (betB), aldehyde dehydrogenase (patD), phenylacetaldehyde dehydrogenase (feaB), and succinate semialdehyde dehydrogenase (gabD) and the promoters controlling the expression of paoB, aldB, puuC, betB, patD, feaB, and gabD were constructed into the pCDF plasmid, and the promoters controlling the expression of paoB, aldB, puuC, betB, patD, feaB, and gabD were selected from P lux Obtained recombinant plasmid pCDF-P lux _paoB_aldB-P lux _puuC_betB-P lux _patD_feaB_gadB.

[0037] The recombinant plasmid was transformed into strain M210 to obtain Escherichia coli M420 producing dodecanedioic acid, whose genotype was tesA::P tet _luxR-Plux _luxI_UcfatB, adhE::P tet _luxR-P l ux _luxI_UcfatB, fadE::P lux _CYP153A-BM3, pgi::P lux _CYP153A-BM3, fadE::P lux _CYP153A-BM3, pgi::P lux _CYP153A-BM3, pCDF-P lux _pao B_aldB-P lux _puuC_betB-P lux _patD_feaB_gadB.

[0038] The nucleotide sequence of Plux is shown in SEQ ID NO 1; the nucleotide sequence of luxI is shown in SEQ ID NO 2; the nucleotide sequence of luxR is shown in SEQ ID NO 3; the nucleotide sequence of Ptet is shown in SEQ ID NO 4; the nucleotide sequence of PM12 is shown in SEQ ID NO 5; the nucleotide sequence of UcfatB is shown in SEQ ID NO 6; the nucleotide sequence of CYP153A-BM3 is shown in SEQ ID NO 7; the nucleotide sequence of aldehyde dehydrogenase (paoB) is shown in SEQ ID NO 8; the nucleotide sequence of acetaldehyde dehydrogenase B (aldB) is shown in SEQ ID NO 9; the nucleotide sequence of aldehyde dehydrogenase (puuC) is shown in SEQ ID NO 10; the nucleotide sequence of betaine aldehyde dehydrogenase (betB) is shown in SEQ ID NO 11; the nucleotide sequence of aldehyde dehydrogenase (patD) is shown in SEQ ID NO 12; the nucleotide sequence of phenylacetaldehyde dehydrogenase (feaB) is shown in SEQ ID NO 13; the nucleotide sequence of the succinate semialdehyde dehydrogenase (gabD) is shown in SEQ ID NO 14.

[0039] SEQ ID NO 1:

[0040] ACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTG TTATAGTCGAATAAA

[0041] SEQ ID NO 2:

[0042] ATGACCATCATGATCAAAAAATCTGATTTCCTGGCGATCCCGAGCGAAGAATACAAAGGCATCCTGAGCCTGCGTTACCAGGTTTTCAAACAGCGTCTGGAATGGGATCTGGTTGTTGAAAACAACCTGGAAAGCGATGAATACGATAACAGCAACGCGGAATACATCTACGCGTGCGATGATACCGAAAACGTTAGCGGCTGCTGGCGTCTGCTGCCGACCACCGGCGATTACATGCTGAAAAGCGTTTTCCCGGAACTGCTGGGCCAGCAGAGCGCGCCGAAAGATCCGAACATCGTTGAACTGAGCCGTTTCGCGGTTGGCAAAAACAGCAGCAAAATCAACAACAGCGCGAGCGAAATCACCATGAAACTGTTCGAAGCGATCTACAAACACGCGGTTAGCCAGGGCATCACCGAATACGTTACCGTTACCAGCACCGCGATCGAACGTTTCCTGAAACGTATCAAAGTTCCGTGCCACCGTATCGGCGATAAAGAAATCCACGTTCTGGGCGATACCAAAAGCGTTGTTCTGAGCATGCCGATCAACGAACAGTTCAAAAAAGCGGTTCTGAACTAA

[0043] SEQ ID NO3:

[0044] ATGAAAAACATCAACGCGGATGATACCTACCGTATCATCAACAAAATCAAAGCGTGCCGCAGCAACAACGATATCAACCAGTGCCTGTCTGATATGACCAAAATGGTTCACTGCGAATACTACCTGCTGGCGATCATCTACCCGCACAGCATGGTGAAAAGCGACATCAGCATCCTGGACAACTACCCGAAAAAATGGCGTCAGTACTACGATGATGCGAACCTGATCAAATACGATCCGATCGTGGACTACTCTAACAGCAACCACAGCCCGATCAACTGGAACATCTTCGAAAACAACGCGGTTAACAAAAAATCCCCGAACGTTATCAAAGAAGCGAAAACCAGCGGCCTGATCACCGGTTTCAGCTTCCCGATCCACACCGCGAACAACGGCTTCGGCATGCTGAGCTTCGCGCACAGCGAAAAAGACAACTACATCGATTCTCTGTTCCTGCACGCGTGCATGAACATCCCGCTGATCGTTCCGAGCCTGGTTGATAACTACCGTAAAATCAACATCGCGAACAACAAAAGCAACAACGACCTGACCAAACGTGAAAAAGAATGCCTGGCGTGGGCGTGCGAAGGCAAATCCAGCTGGGATATCTCTAAAATCCTGGGCTGCAGCGAACGTACCGTTACCTTCCACCTGACCAACGCGCAGATGAAACTGAACACCACCAACCGCTGCCAGAGCATCAGCAAAGCGATCCTGACCGGCGCGATCGATTGCCCGTACTTCAAAAACTAA

[0045] SEQ ID NO4:

[0046] TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGA

[0047] SEQ ID NO5:

[0048] TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCCTTTTGGTGCGTCAGTCAGTTTAAACCAGGAAACAGCT

[0049] SEQ ID NO6:

[0050] ATGCTGGAATGGAAACCAAAACCGAAACTGCCACAACTGCTGGACGATCACTTCGGCCTGCATGGTCTGGTGTTCCGTCGTACGTTCGCTATTCGCAGCTACGAAGTTGGTCCGGATCGCAGCACCTCTATCCTGGCTGTAATGAACCATATGCAGGAAGCGACCCTGAACCACGCTAAAAGCGTTGGTATTCTGGGCGACGGTTTCGGTACTACCCTGGAAATGTCCAAACGTGACCTGATGTGGGTGGTGCGTCGTACTCACGTGGCGGTTGAACGTTACCCGACTTGGGGCGATACTGTCGAAGTTGAATGTTGGATCGGCGCTTCCGGTAACAACGGTATGCGTCGCGATTTTCTGGTGCGCGATTGCAAAACCGGCGAAATTCTGACGCGCTGCACTTCCCTGTCTGTACTGATGAACACCCGCACCCGTCGCCTGTCTACCATCCCGGACGAAGTACGTGGTGAGATCGGTCCGGCGTTTATTGACAACGTGGCGGTTAAAGACGACGAAATCAAGAAGCTGCAGAAGCTGAACGACTCCACCGCAGACTATATCCAGGGTGGCCTGACCCCGCGCTGGAACGATCTGGACGTAAACCAGCACGTGAACAACCTGAAATACGTTGCCTGGGTTTTCGAAACCGTTCCGGACAGCATCTTCGAATCTCACCACATCTCTTCCTTCACCCTGGAGTACCGCCGTGAATGTACCCGCGATTCTGTTCTGCGTTCCCTGACTACCGTTTCCGGTGGTTCTTCTGAAGCTGGCCTGGTCTGTGATCATCTGCTGCAACTGGAAGGCGGTAGCGAGGTACTGCGTGCTCGCACTGAATGGCGCCCGAAACTGACGGATTCTTTCCGTGGCATTTCCGTGATCCCGGCAGAACCACGTGTT*

[0051] SEQ ID NO7:

[0052] ATGCCTACCCTGCCGCGCACCTTCGACGACATCCAAAGCCGCCTGATCAATGCAACCTCTCGTGTTGTTCCGATGCAGCGCCAGATCCAGGGTCTGAAATTTCTGATGTCCGCGAAACGTAAAACCTTCGGTCCGCGCCGCCCAATGCCGGAATTCGTTGAGACCCCAATCCCGGATGTAAACACCCTGGCCCTGGAAGACATCGATGTTAGCAATCCGTTCCTGTACCGTCAGGGCCAGTGGCGCGCATACTTTAAGCGTCTGCGTGACGAGGCCCCGGTACATTACCAGAAAAACTCCCCTTTCGGTCCGTTCTGGTCCGTGACTCGTTTCGAAGACATCCTGTTCGTGGATAAAAGCCACGATCTGTTCAGCGCGGAACCTCAGATCATCCTGGGCGATCCTCCTGAAGGTCTGTCCGTCGAGATGTTCATCGCGATGGATCCGCCGAAACACGACGTCCAGCGCTCTTCTGTCCAGGGTGTTGTAGCGCCGAAAAACCTGAAAGAAATGGAGGGTCTGATCCGCAGCCGTACCGGTGATGTTCTGGACTCTCT

[0053] GCCGACTGACAAACCGTTCAACTGGGTGCCGGCGGTTTCTAAA

[0054] GAACTGACCGGCCGTATGCTGGCTACCCTGCTGGACTTCCCGT

[0055] ATGAAGAACGTCATAAGCTGGTAGAATGGTCTGATCGTATGGC

[0056] TGGCGCTGCTTCCGCCACCGGCGGCGAATTCGCTGATGAAAAC

[0057] GCCATGTTCGACGATGCCGCTGATATGGCTCGTAGCTTCTCTCG

[0058] TCTGTGGCGTGACAAAGAAGCGCGTCGCGCCGCGGGCGAAGA

[0059] GCCGGGTTTCGACCTGATTAGCCTGCTGCAGTCCAACAAAGAA

[0060] ACCAAAGACCTGATTAACCGCCCTATGGAATTCATTGGCAACC

[0061] TGACCCTGCTGATCGTTGCCGGCAACGATACCACCCGCAATTC

[0062] TATGTCCGGTGGCCTGGTTGCTATGAACGAATTCCCGCGCGAA

[0063] TTCGAAAAGCTGAAGGCTAAACCGGAACTGATCCCAAACATG

[0064] GTTAGCGAGATCATCCGTTGGCAAACCCCGCTGGCATACATGC

[0065] GTCGTATCGCGAAACAGGATGTGGAACTGGGCGGTCAGACCA

[0066] TCAAGAAAGGCGACCGCGTTGTGATGTGGTATGCATCCGGCAA

[0067] CCGTGACGAGCGCAAATTCGACAACCCGGACCAGTTTATCATC

[0068] GACCGTAAGGACGCACGCAACCACATGTCCTTCGGTTATGGTG

[0069] TTCATCGCTGTATGGGCAATCGCCTGGCTGAACTGCAGCTGCG

[0070] CATTCTGTGGGAAGAAATCCTGAAACGTTTCGACAACATCGAA

[0071] GTAGTGGAAGAACCAGAACGTGTACAGTCCAACTTCGTTCGTG

[0072] GCTATTCTCGTCTGATGGTAAAGCTGACCCCGAACTCTGGTGG

[0073] TTCCGGTGGCTCTGGCGGCTCTATTCCATCTCCGTCCACCGAGC

[0074] AGTCTGCTAAGAAAGTGCGTAAAAAAGCTGAGAACGCACACA

[0075] ACACTCCGCTGCTGGTGCTGTACGGTTCTAACATGGGTACGGC

[0076] TGAAGGTACCGCTCGCGATCTGGCCGATATCGCGATGTCCAAA

[0077] GGTTTTGCGCCGCAGGTCGCCACGCTGGACTCTCATGCTGGTA

[0078] ACCTGCCGCGTGAGGGTGCTGTGCTGATCGTTACCGCCTCCTA

[0079] CAACGGTCACCCACCGGACAATGCAAAGGAATTCGTGGATTG

[0080] GCTGGATCAGGCGTCTGCGGATGAAGTCAAGGGTGTCCGCTAT

[0081] TCCGTATTCGGCTGCGGTGACAAGAACTGGGCAACTACCTATC

[0082] AGAAGGTCCCGGCCTTCATCGACGAAACGCTGGCTGCTAAAGG

[0083] CGCAGAAAACATTGCGGAACGTGGTGAGGCAGACGCTAGCGA

[0084] TGACTTCGAGGGTACCTACGAGGAATGGCGCGAACATATGTGG

[0085] AGCGACCTGGCGGCGTACTTCAACCTGGACATCGAAAATTCCG

[0086] AAGAAAATGCCAGCACTCTGTCCCTGCAGTTTGTAGATTCCGC

[0087] CGCAGATATGCCGCTGGCTAAAATGCACCGTGCATTCAGCGCT

[0088] AACGTTGTGGCCTCTAAAGAACTGCAGAAGCCAGGTTCTGCAC

[0089] GCTCCACCCGTCACCTGGAAATCGAGCTGCCGAAAGAAGCTAG

[0090] CTACCAAGAAGGTGATCACCTGGGCGTTATCCCGCGCAACTAC

[0091] GAGGGTATTGTGAACCGCGTTGCAACCCGTTTCGGTCTGGATG

[0092] CAAGCCAGCAGATCCGTCTGGAAGCCGAAGAAGAAAAACTGG

[0093] CTCACCTGCCGCTGGGCAAAACGGTCAGCGTGGAAGAACTGCT

[0094] GCAGTATGTTGAACTGCAGGATCCGGTTACCCGTACTCAGCTG

[0095] CGTGCGATGGCGGCAAAAACCGTGTGCCCACCTCACAAAGTA

[0096] GAGCTGGAGGTACTGCTGGAAAAACAGGCGTATAAGGAACAG

[0097] GTCCTGGCCAAACGTCTGACCATGCTGGAACTGCTGGAAAAAT

[0098] ATCCGGCTTGCGAAATGGAATTCTCTGAATTCATCGCGCTGCT

[0099] GCCGTCCATGCGTCCGCGTTACTACTCTATCTCTTCCTCCCCAC

[0100] GTGTAGATGAGAAACAGGCAAGCATTACGGTCTCTGTTGTAAG

[0101] CGGTGAAGCTTGGTCTGGTTACGGTGAATACAAAGGTATCGCG

[0102] AGCAACTATCTGGCTAACCTGCAGGAAGGTGACACTATTACCT

[0103] GTTTCGTGTCCACCCCTCAGTCCGGCTTTACTCTGCCGAAAGGC

[0104] CCGGAAACGCCGCTGATCATGGTTGGTCCTGGTACCGGCGTTG

[0105] CCCCGTTTCGCGGCTTCGTGCAGGCGCGCAAGCAGCTGAAGGA

[0106] GCAGGGTCAGAGCCTGGGTGAAGCTCACCTGTACTTCGGCTGC

[0107] CGTTCTCCGCACGAAGACTACCTGTACCAGAAAGAACTGGAAA

[0108] ACGCTCAGAACGAAGGTATCATCACGCTGCATACTGCCTTTTC

[0109] TCGTGTGCCGAACCAGCCGAAAACCTATGTTCAGCACGTCATG

[0110] GAGCAAGACGGTAAAAAACTGATCGAACTGCTGGACCAGGGT

[0111] GCCCACTTCTATATCTGCGGCGACGGTTCTCAAATGGCACCGG

[0112] ACGTGGAAGCGACCCTGATGAAGTCTTACGCGGAGGTTCATCA

[0113] GGTAAGCGAAGCGGACGCACGTCTGTGGCTGCAGCAGCTGGAAGAAAAAGGTCGTTATGCGAAAGATGTTTGGGCGGGT*

[0114] SEQ ID NO8:

[0115]

[0116] SEQ ID NO9:

[0117]

[0118] SEQ ID NO10:

[0119]

[0120] SEQ ID NO11:

[0121]

[0122] SEQ ID NO12:

[0123]

[0124] SEQ ID NO13:

[0125] ATGACAGAGCCGCATGTAGCAGTATTAAGCCAGGTCCAAC

[0126] AGTTTCTCGATCGTCAACACGGTCTTTATATTGATGGTCGTCCT

[0127] GGCCCCGCACAAAGTGAAAAACGGTTGGCGATCTTTGATCCGG

[0128] CCACCGGGCAAGAAATTGCGTCTACTGCTGATGCCAACGAAGC

[0129] GGATGTAGATAACGCAGTCATGTCTGCCTGGCGGGCCTTTGTC

[0130] TCGCGTCGCTGGGCCGGGCGATTACCCGCAGAGCGTGAACGTA

[0131] TTCTGCTACGTTTTGCTGATCTGGTGGAGCAGCACAGTGAGGA

[0132] GCTGGCGCAACTGGAAACCCTGGAGCAAGGCAAGTCAATTGC

[0133] CATTTCCCGTGCTTTTGAAGTGGGCTGTACGCTGAACTGGATG

[0134] CGTTATACCGCCGGGTTAACGACCAAAATCGCGGGTAAAACGC

[0135] TGGACTTGTCGATTCCCTTACCCCAGGGGGCGCGTTATCAGGC

[0136] CTGGACGCGTAAAGAGCCGGTTGGCGTAGTGGCGGGAATTGT

[0137] GCCATGGAACTTTCCGTTGATGATTGGTATGTGGAAGGTGATG

[0138] CCAGCACTGGCAGCAGGCTGTTCAATCGTGATTAAGCCTTCGG

[0139] AAACCACGCCACTGACGATGTTGCGCGTGGCGGAACTGGCCA

[0140] GCGAGGCTGGTATCCCTGATGGCGTTTTTAATGTCGTCACCGG

[0141] GTCAGGTGCTGTATGCGGCGCGGCCCTGACGTCACATCCTCAT

[0142] GTTGCGAAAATCAGTTTTACCGGTTCAACCGCGACGGGAAAAG

[0143] GTATTGCCAGAACTGCTGCTGATCACTTAACGCGTGTAACGCT

[0144] GGAACTGGGCGGTAAAAACCCGGCAATTGTATTAAAAGATGC

[0145] TGATCCGCAATGGGTTATTGAAGGCTTGATGACCGGAAGCTTC

[0146] CTGAATCAAGGGCAAGTATGCGCCGCCAGTTCGCGAATTTATA

[0147] TTGAAGCGCCGTTGTTTGACACGCTGGTTAGTGGATTTGAGCA

[0148] GGCGGTAAAATCGTTGCAAGTGGGACCGGGGATGTCACCTGTT

[0149] GCACAGATTAACCCTTTGGTTTCTCGTGCGCACTGCGACAAAG

[0150] TGTGTTCATTCCTCGACGATGCGCAGGCACAGCAAGCAGAGCT

[0151] GATTCGCGGGTCGAATGGACCAGCCGGAGAGGGGTATTATGTT

[0152] GCGCCAACGCTGGTGGTAAATCCCGATGCTAAATTGCGCTTAA

[0153] CTCGTGAAGAGGTGTTTGGTCCGGTGGTAAACCTGGTGCGAGT

[0154] AGCGGATGGAGAAGAGGCGTTACAACTGGCAAACGACACGGA

[0155] ATATGGCTTAACTGCCAGTGTCTGGACGCAAAATCTCTCCCAG

[0156] GCTCTGGAATATAGCGATCGCTTACAGGCAGGGACGGTGTGGG

[0157] TAAACAGCCATACCTTAATTGACGCTAACTTACCGTTTGGTGG

[0158] GATGAAGCAGTCAGGAACGGGCCGTGATTTTGGCCCCGACTGG

[0159] CTGGACGGTTGGTGTGAAACTAAGTCGGTGTGTGTACGGTATT

[0160] AA

[0161] SEQ ID NO14:

[0162]

[0163] The engineered strain M420 constructed in Example 1 was inoculated into TB medium supplemented with 5 g / L glucose, 0.1 g / L ferrous sulfate heptahydrate, and 5 mM 5-aminolevulinic acid hydrochloride. Fermentation was performed in a shake flask. At 72 hours of fermentation, production of greater than 300 mg / L of dodecanedioic acid was detected during the fermentation.

[0164] The engineered strain M420 constructed in Example 1 was inoculated into TB medium containing 1 g / L of 12-hydroxydodecanoic acid. Fermentation was performed in a shake flask. After 24 hours of fermentation, it was detected that more than 900 mg / L of dodecanedioic acid was produced during the fermentation process.

[0165] The method for constructing the dodecanedioic acid-producing Escherichia coli provided by the present invention constructs the quorum sensing system of Vibrio fischeri in Escherichia coli and slows down the synthesis rate of AHL, thereby obtaining an engineered strain that efficiently produces dodecanedioic acid. This method can achieve auto-induced synthesis of dodecanedioic acid, balance cell growth and product synthesis, and produce dodecanedioic acid from glucose, with a yield of more than 300 mg / L, or produce dodecanedioic acid from 1-100 g / L of 12-hydroxydodecanoic acid, with a yield of more than 900 mg / L.

[0166] The above examples are merely illustrative of the present invention and do not limit the scope of protection of the present invention. Any design that is identical or similar to the present invention falls within the scope of protection of the present invention.

Claims

1. An Escherichia coli producing dodecanedioic acid, characterized in that: The genotype of the Escherichia coli is tesA::P tet _luxR-P lux _luxI_UcfatB, adhE::P tet _luxR-P lux _lux I_UcfatB, fadE::P lux _CYP153A-BM3, pgi::P lux _CYP153A-BM3, pC DF-P lux _paoB_aldB-P lux _puuC_betB-P lux _patD_feaB_gadB; Among them, P lux The nucleotide sequence of luxI is shown in SEQ ID NO 1; the nucleotide sequence of luxR is shown in SEQ ID NO 3; tet The nucleotide sequence is shown in SEQ ID NO 4; M12 The nucleotide sequence of UcfatB is shown in SEQ ID NO 5; the nucleotide sequence of UcfatB is shown in SEQ ID NO 6; the nucleotide sequence of CYP153A-BM3 is shown in SEQ ID NO 7; the nucleotide sequence of paoB is shown in SEQ ID NO 8; the nucleotide sequence of AldB is shown in SEQ ID NO 9; the nucleotide sequence of puuC is shown in SEQ ID NO 10; the nucleotide sequence of betB is shown in SEQ ID NO 11; the nucleotide sequence of patD is shown in SEQ ID NO 12; the nucleotide sequence of feaB is shown in SEQ ID NO 13; and the nucleotide sequence of gabD is shown in SEQ ID NO 14.

2. A method for constructing Escherichia coli that produces dodecanedioic acid, characterized in that: The following steps are involved: (1) Integrate the luxI, luxR, and UcfatB genes and the promoters that control their expression into the tesA gene locus of the Escherichia coli genome to construct strain M22; (2) Based on the M22 strain, the same sequence as in step (1) was integrated into the ad hE gene locus to obtain strain M73; (3) Based on the M73 strain, the CYP153A-BM3 encoding gene and the promoter controlling CYP153A-BM3 expression were integrated into the fadE site of Escherichia coli to obtain strain M209; (4) Based on the M209 strain, the CYP153A-BM3 encoding gene and the promoter controlling CYP153A-BM3 expression were integrated into the pgi site of Escherichia coli to obtain strain M210; (5) The genes encoding paoB, aldB, puuC, betB, patD, feaB, and gabD and the promoters controlling the expression of paoB, aldB, puuC, betB, patD, feaB, and gabD were constructed into the pCDF plasmid to obtain a recombinant plasmid, which was then transformed into strain M210 to obtain Escherichia coli that produces dodecanedioic acid.

3. The method for constructing Escherichia coli for producing dodecanedioic acid according to claim 2, wherein: The promoter for controlling the expression of luxI and UcfatB in step (1) is selected from P lux ; The promoter controlling luxR expression is selected from P tet .

4. The method for constructing Escherichia coli for producing dodecanedioic acid according to claim 2, wherein: The promoter for controlling the expression of CYP153A-BM3 in step (3) is selected from P lux .

5. The method for constructing Escherichia coli for producing dodecanedioic acid according to claim 2, wherein: The promoter for controlling the expression of paoB, aldB, puuC, betB, patD, feaB, and gabD in step (5) is selected from P lux , the gene and promoter were constructed into the pCDF plasmid.

6. A method for producing dodecanedioic acid, characterized in that: The dodecanedioic acid-producing Escherichia coli according to claim 1 is inoculated into a culture medium for fermentation, and the dodecanedioic acid in the fermentation product is collected.

7. The method for producing dodecanedioic acid according to claim 6, wherein: The culture medium is a TB culture medium supplemented with 4-40 g / L glucose, 0.1-1 g / L ferrous sulfate heptahydrate, and 5-50 mM 5-aminolevulinic acid hydrochloride.

8. The method for producing dodecanedioic acid according to claim 6, wherein: The culture medium is TB culture medium supplemented with 1-100 g / L 12-hydroxydodecanoic acid.

9. An engineered bacterium for producing dodecanedioic acid, characterized in that: In the genome of the engineered bacteria, an aldehyde dehydrogenase encoding gene, an acetaldehyde dehydrogenase encoding gene, an aldehyde dehydrogenase encoding gene, a betaine aldehyde dehydrogenase encoding gene, an aldehyde dehydrogenase encoding gene, a phenylacetaldehyde dehydrogenase encoding gene or a succinate semialdehyde dehydrogenase encoding gene is knocked out.

10. The engineered bacteria for producing dodecanedioic acid according to claim 9, characterized in that: The engineering bacteria uses Escherichia coli as the starting bacteria.