Polynucleotide molecule for inhibiting DMPK expression and application thereof
By designing a polynucleotide molecule complementary to the DMPK gene mRNA and using RNAi technology to reduce DMPK mRNA expression, the problem of etiology and treatment of DM1 was solved, and effective treatment of muscular atrophy and myotonic dystrophy was achieved.
Patent Information
- Application Number
- CN202410301247.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-15
- Publication Date
- 2025-09-16
AI Technical Summary
Currently, there is a lack of effective treatments for myotonic dystrophy (DM1), especially for the muscle atrophy and spasticity symptoms caused by the accumulation of cytotoxic RNA-protein complexes due to CTG repeats and loss of MBNL function. Existing drugs such as mexiletine and carbamazepine can only relieve symptoms but not treat the cause.
The polynucleotide molecules are designed to complement the mRNA target sequence of the DMPK gene, and through RNA interference (RNAi) technology, the expression of DMPK mRNA is reduced, the function of MBNL protein is restored, and muscle atrophy and myotonic dystrophy are inhibited.
The causal treatment of DM1 has been achieved. Through RNAi mediated by polynucleotide molecules, the accumulation of DMPK mRNA was significantly reduced, muscle cell vitality was restored, splicing errors were corrected, and muscle atrophy and spasticity symptoms were reduced.
Smart Images

Figure CN120648679A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to a polynucleotide molecule for inhibiting DMPK expression and uses thereof. Background Art
[0002] Myotonic dystrophy (DM) is an autosomal dominant genetic disorder characterized by multisystem impairments, including muscle weakness, atrophy, and myotonia (delayed relaxation after muscle contraction, resulting in muscle stiffness). In addition to skeletal muscle involvement, DM is often accompanied by cataracts, cardiac arrhythmias, diabetes, premature balding, excessive sweating, sexual dysfunction, and intellectual impairment.
[0003] Myotonic dystrophy is divided into two types: DM1 and DM2, depending on the gene mutation site. DM1 (hereafter referred to as DM1) is caused by an abnormal expansion of a trinucleotide CTG repeat sequence in the 3' untranslated region of the dystrophia myotonica protein kinase (DMPK) gene located on chromosome 19q13.3, accounting for 95% of all DM cases. DM2 (hereafter referred to as DM2) is caused by an abnormal expansion of a tetranucleotide CCTG repeat sequence in the first intron of the zinc finger protein 9 (ZNF9) gene located on chromosome 3q21.3, accounting for 5% of all DM cases. DM1 and DM2 have similar clinical symptoms, with both primarily affecting the distal upper limb muscles in the early stages. However, DM2 is less common and less severe in the presence of muscle atrophy.
[0004] Recent studies indicate a global incidence of DM1 of 9.27 per 100,000 people. This disease exhibits significant global disparity, with rates in the United States at 47.6 per 100,000 people, Japan at only 9.1 per 100,000 people, and South Korea at 0.77 per 100,000 people. Regarding the prevalence of DM1 in my country, while large-scale epidemiological data collection is lacking in mainland China, the prevalence in Taiwan is 0.46 per 100,000 people. It is estimated that the prevalence in East Asian populations is lower than the global average. However, due to my country's large population base, a large number of patients remain.
[0005] The severity of DM1 disease is positively correlated with the number of CTG repeats. The number of CTG repeats in the DMPK gene accumulates continuously during intergenerational inheritance, causing the symptoms to worsen. The pathophysiology of DM1 is that when the DMPK gene containing CTG repeats is transcribed into pre-mRNA, the CUG repeats form a hairpin structure. These hairpins bind with high affinity to the myocardial blind-like (MBNL) family of splicing proteins to form an RNA-protein complex. The accumulation of RNA-protein complexes in muscle cells produces cytotoxicity, while the loss of MBNL protein function leads to an increase in mis-splicing events, which in turn leads to myotonia and other clinical symptoms. There are currently no approved therapies for DM1. Antiarrhythmic drugs such as mexiletine and carbamazepine have been used to relieve the myotonic symptoms of DM1, but failed to achieve positive results in double-blind, placebo-controlled clinical trials.
[0006] Currently, RNA interference (RNAi) targeting the pathogenic DMPK gene has gradually become a treatment for DM1. On the one hand, RNAi can reduce DMPK mRNA with CUG repeats in muscle cells with high specificity, thereby reducing the accumulation of RNA-protein complexes in muscle cells and restoring muscle cell vitality. On the other hand, RNAi-mediated reduction of DMPK mRNA with CUG repeats can release MBNL bound to the CUG repeat hairpin and correct downstream splicing errors caused by MBNL loss. Unlike mexiletine and carbamazepine, which only treat symptoms, RNAi provides a new solution for treating the cause of DM1. Summary of the Invention
[0007] One of the purposes of the present application is to provide a polynucleotide molecule that is complementary to the mRNA target sequence of the DMPK gene, and the polynucleotide molecule mediates RNA interference against the DMPK, thereby treating muscular dystrophy or myotonic dystrophy in a subject.
[0008] Another object of the present application is to provide a pharmaceutical composition comprising the polynucleotide molecule.
[0009] Another object of the present application is to provide use of the polynucleotide molecule in a drug for preventing or treating muscular atrophy or myotonic dystrophy.
[0010] In the first aspect of the present application, a polynucleotide molecule is provided that binds to the mRNA of the DMPK gene, wherein the polynucleotide molecule comprises at least 12 consecutive nucleotides in any one nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 200, and SEQ ID NO: 281 to SEQ ID NO: 490, or a sequence that differs from the at least 12 consecutive nucleotides by no more than 3 nucleotides, or a sequence complementary thereto, and the nucleotides are in a modified or unmodified state.
[0011] Preferably, the length of the polynucleotide molecule is 8 to 50 nucleotides, preferably 10 to 30 nucleotides, more preferably 15 to 25 nucleotides, and most preferably 19 to 23 nucleotides.
[0012] Preferably, the mRNA target sequence of the DMPK gene comprises a disease-associated repeat unit, the disease-associated repeat unit comprises a repeat unit of a trinucleotide sequence, and the length of the disease-associated repeat is 50 to 10,000 repeat units.
[0013] Preferably, the disease-associated repeat unit comprises a CUG trinucleotide sequence.
[0014] Preferably, the polynucleotide molecule is complementary to at least 8 consecutive nucleotides of the mRNA target sequence of the DMPK gene.
[0015] Preferably, the polynucleotide molecule is a single-stranded oligonucleotide or a double-stranded oligonucleotide.
[0016] Preferably, one or more nucleotides in the polynucleotide molecule are modified to form modified nucleotides.
[0017] Preferably, the polynucleotide molecule comprises at least 12 consecutive nucleotides of any one of the nucleotide sequences of SEQ ID NO:201 to SEQ ID NO:280, SEQ ID NO:491 to SEQ ID NO:580, and SEQ ID NO:589 to SEQ ID NO:620, or a sequence that differs from the at least 12 consecutive nucleotides by no more than 3 nucleotides, or a sequence complementary thereto.
[0018] Preferably, the polynucleotide molecule comprises a double-stranded structure of an antisense strand and a sense strand.
[0019] Preferably, the sense strand and / or antisense strand independently comprises one or more modified nucleotides, one or more modified internucleotide linkages or one or more inverted abasic moieties.
[0020] Preferably, the modified nucleotide is a 2'-modified nucleotide. Preferably, the 2'-modified nucleotide comprises a 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-dimethylaminoethoxyethyl (2'-O-DMAEOE) or 2'-O-N-methylacetamide (2'-O-NMA) modified nucleotide, and also includes a locked nucleic acid (LNA) or ethylene nucleic acid (ENA) or ethylene glycol nucleic acid (GNA). Further preferably, the ethylene glycol nucleic acid (GNA) is located at any point between positions 5 and 8 of the antisense strand.
[0021] Preferably, the modified internucleotide linkage comprises a phosphorothioate linkage, a phosphorodithioate linkage, a methylphosphonate linkage, a phosphodiester linkage, a phosphotriester linkage or an amide linkage.
[0022] Preferably, the inverted abasic portion is at at least one end of the polynucleotide molecule.
[0023] Preferably, the antisense strand comprises any one of SEQ ID NOs: 101-200, SEQ ID NOs: 221-240, SEQ ID NOs: 261-280, SEQ ID NOs: 386-490, SEQ ID NOs: 536-580 or SEQ ID NOs: 589-620, or a sequence that differs therefrom by no more than 3 nucleotides.
[0024] Preferably, the sense strand comprises any one of SEQ ID NOs: 1-100, SEQ ID NOs: 201-220, SEQ ID NOs: 241-260, SEQ ID NOs: 281-385 or SEQ ID NOs: 491-535, or a sequence that differs therefrom by no more than 3 nucleotides.
[0025] In a second aspect, the present application provides a conjugate comprising the above-mentioned polynucleotide molecule and an antibody, an antibody fragment or an antigen-binding sequence.
[0026] Preferably, the polynucleotide molecule and the antibody or antigen-binding sequence are coupled to each other by random coupling or site-specific coupling.
[0027] Preferably, the antibody, antibody fragment or antigen binding sequence is used to bind to anti-transferrin receptor.
[0028] A third aspect of the present application provides a pharmaceutical composition, characterized in that the pharmaceutical composition comprises the polynucleotide molecule or the conjugate as described above, and the pharmaceutical composition is used to treat muscular dystrophy or myotonic dystrophy.
[0029] Preferably, the pharmaceutical composition is formulated for intravenous, subcutaneous, parenteral, oral, intranasal, buccal, rectal or transdermal administration.
[0030] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.
[0031] Preferably, the pharmaceutical composition further comprises a therapeutic agent, which comprises a small molecule drug, an antibody, an antibody fragment and / or a vaccine.
[0032] In a fourth aspect, the present application provides a method for delivering a polynucleotide molecule to a cell, the method comprising coupling the above-mentioned polynucleotide molecule with an antibody, an antibody fragment or an antigen-binding sequence.
[0033] In a fifth aspect, the present application provides a method for inhibiting DMPK activity in a cell, comprising contacting the cell with the above-mentioned polynucleotide.
[0034] In a sixth aspect, the present application provides a method for treating muscular atrophy or myotonic dystrophy in a subject in need thereof, comprising: administering to the subject a therapeutically effective amount of the polynucleotide or pharmaceutical composition as described above to treat muscular atrophy or myotonic dystrophy in the subject.
[0035] Preferably, wherein the subject is a human.
[0036] In a seventh aspect, the present application provides a use of the above-mentioned polynucleotide molecule or the above-mentioned conjugate for preparing a drug, wherein the drug is used to reduce the expression of DMPK mRNA, or to prevent and / or treat muscular atrophy or myotonic dystrophy.
[0037] Preferably, the muscle atrophy includes muscle atrophy or myotonic dystrophy associated with insulin deficiency, chronic renal failure, congestive heart failure, chronic respiratory disease, chronic infection, fasting, denervation, sarcopenia or glucocorticoid treatment.
[0038] Preferably, the muscle atrophy includes diabetes-related muscle atrophy or cancer cachexia-related muscle atrophy.
[0039] Preferably, the disease or condition comprises muscle atrophy associated with myotonic dystrophy type 1 (DM1).
[0040] Beneficial effect: In the embodiment of the present invention, 19 / 21mer siRNA naked sequences and 21 / 23mer siRNA naked sequences were designed respectively, and primary screening was performed. In the primary screening of the 19 / 21mer siRNA naked sequence (results are shown in Table 7), the mRNA content of DMPK and the percentage of the control group were minimum 17.05% (2pmol) and 29.68% (0.02pmol), and in the primary screening of the 21 / 23mer siRNA naked sequence (results are shown in Tables 14 and 15), the mRNA content of DMPK and the percentage of the control group were minimum 11.33% (1nM) and 34.71% (0.01nM). The inventors selected the naked sequences with good effects according to the primary screening results for modification, screened and verified the modified sequences, and the knockdown levels of the modified 19 / 21mer siRNA and the modified 21 / 23mer siRNA were improved, and the serum stability was significantly improved, and the comprehensive drugability was significantly improved.
[0041] The inventors also conducted studies on the modified 19 / 21mer siRNA and the modified 21 / 23mer siRNA for human-mouse cross-reactivity, serum stability, cytotoxicity, immunogenicity, and off-target risk. The human-mouse cross-reactivity results showed a maximum mRNA knockdown of 25.88%. Serum stability tests demonstrated good stability of the modified siRNA. Cytotoxicity tests revealed that the candidate siRNAs did not significantly reduce cell viability compared to the control. Immunogenicity tests revealed that the candidate siRNAs had no significant immunogenicity. Off-target risk studies demonstrated that GNA modifications at different positions effectively reduced the knockdown efficiency of off-target genes, while having no significant effect on the knockdown efficiency of the target gene DMPK.
[0042] The inventors coupled siRNA and TfR1 antibodies to achieve targeted delivery of siRNA through the interaction between the antibody and TfR1. The antibody-siRNA conjugate of the present application can enter the RD cell line under in vitro co-incubation conditions without the assistance of lipofectamine and exert a dose-dependent target gene knockdown effect. This result explains the working principle of the antibody-siRNA conjugate for the first time, verifies the feasibility of antibodies as siRNA delivery vectors across the cell membrane, and gets rid of the dependence of traditional siRNA drugs on transfection reagents.
[0043] The antibody-siRNA conjugates described in this application achieved dose-dependent knockdown of target genes in skeletal muscle, diaphragm, and myocardium in vivo, while exhibiting no significant knockdown effect in non-targeted liver, kidney, and brain tissues. This target gene knockdown was not limited to the specific siRNA target site, demonstrating the universal applicability of this delivery technology. Furthermore, the tissue distribution, efficacy, and safety of the antibody-siRNA conjugates were validated in rodents and cynomolgus macaques.
[0044] In addition, the experimental results also show that the antibody-siRNA conjugate of the present application significantly improves the yield and purity of the final product through the site-specific coupling technology based on cysteine thiol. The improvement in yield helps to reduce the waste of nucleic acids and antibodies during the synthesis process and greatly reduces production costs. The higher purity final product helps to reduce the impurities ingested by patients in future clinical practice and avoid the occurrence of adverse reactions. The results of in vivo experiments confirmed that the high-purity DAR1 antibody-siRNA conjugate produced by site-specific coupling technology prolonged the plasma half-life of the conjugate compared to the random coupling product, significantly improved the enrichment of the antibody-siRNA conjugate in muscle, and achieved more and faster knockdown of target genes (Example 7).
[0045] The above results show that the selected modified 19 / 21mer siRNA and modified 21 / 23mer siRNA have good DMPK mRNA degradation content and drug-forming properties; the conjugates obtained by coupling them with anti-TfR1 antibodies can achieve targeted muscle delivery of siRNA; through site-specific coupling technology, higher yield and purer DAR1 molecules are obtained, which can further extend the plasma half-life of the antibody-siRNA conjugate, achieve more muscle siRNA delivery, and have more superior drug-forming properties. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] Figure 1 Design flow chart for 19 / 21mer siRNA naked sequence;
[0047] Figure 2 Design flow chart for 21 / 23mer siRNA naked sequence;
[0048] Figure 3 A complete flowchart for siRNA design, modification and druggability research;
[0049] Figure 4 The main modes used for siRNA backbone modification;
[0050] Figure 5 The serum stability (PAGE) test results of modified siRNA;
[0051] Figure 6The cytotoxicity test results of the modified siRNA;
[0052] Figure 7 The cytotoxicity test results of the modified siRNA;
[0053] Figure 8 The immunogenicity (IL6) test results of the modified siRNA;
[0054] Figure 9 The immunogenicity (IFN-α) test results of the modified siRNA;
[0055] Figure 10 The immunogenicity (OAS1) test results of the modified siRNA;
[0056] Figure 11 The immunogenicity (P65) test results of the modified siRNA;
[0057] Figure 12 RNAseq results for siRNA ID#253;
[0058] Figure 13 This is the off-target gene confirmation result of siRNA ID#253;
[0059] Figure 14 The results show the off-target effect (DMPK) of GNA modification on siRNA ID#253.
[0060] Figure 15 The results show the off-target effect of GNA modification on siRNA ID#253 (COL4A1).
[0061] Figure 16 The results show the off-target effect of GNA modification on siRNA ID#253 (RPL38).
[0062] Figure 17 The results show the off-target effect of GNA modification on siRNA ID#253 (HIGD2A).
[0063] Figure 18 Schematic diagram of the Linker-siRNA positive chain;
[0064] Figure 19 The molecular chromatogram of CGBC-1001 (A280 upper, A260 lower);
[0065] Figure 20 The molecular chromatogram of CGBC-1002 (A280 upper, A260 lower);
[0066] Figure 21This is the molecular chromatogram of CGBC-1004-1 (A280 upper, A260 lower);
[0067] Figure 22 This is the molecular chromatogram of CGBC-1004-2 (A280 upper, A260 lower);
[0068] Figure 23 This is the molecular chromatogram of CGBC-1005-1 (A280 upper, A260 lower);
[0069] Figure 24 This is the molecular chromatogram of CGBC-1005-2 (A280 upper, A260 lower);
[0070] Figure 25 This is the molecular chromatogram of CGBC-1012-1 (A280 upper, A260 lower);
[0071] Figure 26 This is the molecular chromatogram of CGBC-1012-2 (A280 upper, A260 lower);
[0072] Figure 27 The results show that CGBC-1001 knocks down HPRT in the muscle tissue of wild-type CD-1 mice;
[0073] Figure 28 The results show that CGBC-1001 knocks down HPRT in non-muscle tissues of wild-type CD-1 mice;
[0074] Figure 29 The results show that CGBC-1002 knocks down HPRT in the muscle tissue of wild-type CD-1 mice;
[0075] Figure 30 The results show that CGBC-1002 knocks down HPRT in non-muscle tissues of wild-type CD-1 mice;
[0076] Figure 31 The results of CGBC-1004 (DAR1 and DAR2) knocking down DMPK in muscle tissue of wild-type CD-1 mice;
[0077] Figure 32 The results of CGBC-1005 (DAR1 and DAR2) knocking down DMPK in muscle tissue of wild-type CD-1 mice;
[0078] Figure 33 Figure 2 shows the distribution of siRNA of CGBC-1004 (DAR1 and DAR2) in plasma, muscle, and liver of wild-type CD-1 mice.
[0079] Figure 34Figure 2 shows the distribution of siRNA of CGBC-1005 (DAR1 and DAR2) in plasma, muscle, and liver of wild-type CD-1 mice.
[0080] Figure 35 Muscle:liver AUC ratios for different designed antibody-siRNA conjugates;
[0081] Figure 36 is the PK curve of CGBC-1012 (DAR1) in cynomolgus monkey plasma;
[0082] Figure 37 This is the PK curve of CGBC-1012 (DAR1) in the gastrocnemius muscle of cynomolgus monkeys;
[0083] Figure 38 In vitro activity of CGBC-1012 (DAR1 and DAR2) in human rhabdomyosarcoma cells. DETAILED DESCRIPTION
[0084] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments and drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0085] Definition of terms
[0086] In this application, the terms "nucleic acid" and "polynucleotide / polynucleotide molecule" are used interchangeably and refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides or analogs thereof) of any length, which can be double-stranded or single-stranded molecules. A polynucleotide can be modified or substituted at one or more bases, sugars, and / or phosphates with any of a variety of modifications or substitutions known in the art. A polynucleotide can contain modified nucleotides, such as methylated nucleotides and nucleotide analogs.
[0087] In this application, "target nucleic acid" or "target sequence" generally refers to a nucleic acid molecule to which an antisense compound is intended to hybridize to produce a desired effect (e.g., antisense activity). Exemplary antisense compounds include antisense oligonucleotides, which have sufficient complementarity with their target nucleic acid to allow hybridization under physiological conditions. In this application, "target nucleic acid" includes, but is not limited to, a DNA or RNA encoding a mammalian DMPK, such as human DMPK mRNA, which comprises a disease-associated repeat unit as a target sequence / target nucleic acid.
[0088] In this application, the term "disease-associated repeat" refers to a repetitive nucleotide sequence at a genomic location, wherein the number of units of the repetitive nucleotide sequence is associated with a genetic disease and / or directly or indirectly contributes to or causes a genetic disease. The length of each repetitive unit of the disease-associated repeat can be 2, 3, 4, 5 or more nucleotides. Disease-associated repeats include CAG repeats, CTG repeats, CUG repeats, CGG repeats, CCTG repeats, or any nucleotide complement thereof.
[0089] In this application, the term "DMPK" refers to the gene encoding myotonic kinase (also known as myotonic dystrophy protein kinase or dystrophic myotonic kinase), which is a serine / threonine protein kinase. Substrates of this enzyme may include myogenin, the beta subunit of the L-type calcium channel, and phosphorlemman. DMPK can be a human gene (Gene ID: 1760), a non-human primate gene (e.g., Gene ID: 456139, Gene ID: 715328), or a rodent gene (e.g., Gene ID: 13400). In humans, a CTG repeat expansion in the 3' noncoding, untranslated region of DMPK is associated with myotonic dystrophy type 1 (DM1), i.e., the disease-associated repeat unit is CTG.
[0090] As used herein, the term "DMPK allele" refers to any alternative form (eg, wild-type or mutant form) of the DMPK gene that encodes wild-type myotonic kinase that retains its normal and typical function and that may contain one or more disease-associated repeat expansions.
[0091] As used herein, the term "myotonic dystrophy (DM)" refers to a genetic disease caused by mutations in the DMPK gene or the CNBP (ZNF9) gene. It is a multisystemic neuromuscular disease characterized by muscle loss, weakness, and dysfunction. There are two main types: myotonic dystrophy type 1 (DM1) and myotonic dystrophy type 2 (DM2). DM1 is associated with an expansion of the CTG trinucleotide repeat in the 3' noncoding region of DMPK, while DM2 is associated with an expansion of the CCTG tetranucleotide repeat in the first intron of ZNF9.
[0092] In this application, the term "oligonucleotide" generally refers to a polymer composed of a plurality of nucleotide residues (deoxyribonucleotides or ribonucleotides, or related structural variants or synthetic analogs thereof) linked by phosphodiester bonds (or related structural variants or synthetic analogs thereof). Oligonucleotides are generally short in length, typically having about 10-30 nucleotide residues, but the term can also refer to molecules of any length, although the terms "polynucleotide" or "nucleic acid" are generally used for larger oligonucleotides.
[0093] In this application, the term "small interfering RNA" (siRNA, also known as short interfering RNA or silencing RNA) is used. siRNA targets nucleic acids (e.g., mRNA) for degradation via the RNA interference (RNAi) pathway in cells. The specificity of an siRNA molecule can be determined by the binding of the antisense strand of the molecule to its target RNA.
[0094] In this application, the term "antisense oligonucleotide" refers to a single-stranded oligonucleotide molecule having a nucleobase sequence that is complementary to a corresponding fragment of a target nucleic acid (e.g., a target genomic sequence, an mRNA precursor, or an mRNA molecule). The length of the antisense oligonucleotide can be 12 to 30 nucleobases. The antisense oligonucleotide can include unmodified or modified nucleic acids.
[0095] In this application, the term "antisense strand" generally refers to the strand of a region of a polynucleic acid molecule (e.g., dsRNA) that is substantially complementary to a target sequence. As used in this application, the term "region of complementarity" generally refers to the region on the antisense strand that is substantially complementary to a sequence defined herein (e.g., a target sequence). When the region of complementarity is not completely complementary to the target sequence, mismatches may be in the interior or terminal regions of the molecule.
[0096] In this application, the term "sense strand" (S) generally refers to a chain of a polynucleic acid molecule comprising a region that is substantially complementary to the region of the term antisense strand as defined herein. A "sense" strand is sometimes referred to as a "sense" strand. By means of their sequence, the antisense strand targets the desired mRNA, while the sense strand targets different targets. Therefore, if the antisense strand is incorporated into RISC, the correct target is targeted. The incorporation of the sense strand can result in off-target effects. These off-target effects can be limited by using modifications or using 5' end caps on the sense strand.
[0097] In the present application, the term "complementary" refers to the ability to accurately pair between two nucleotides or two groups of nucleotides. In particular, complementary is a term that characterizes the degree of binding between two nucleotides or two groups of nucleotides caused by hydrogen bond pairing. For example, if the base at one position of an oligonucleotide can hydrogen bond with the base at the corresponding position of a target nucleic acid (for example, mRNA), it is believed that the bases at this position are complementary to each other. "Complementary" does not necessarily have core base complementarity on each nucleoside. On the contrary, some mispairings can be tolerated.
[0098] In this application, the term "fully complementary" generally means that all (100%) bases in the continuous sequence of one chain in a double-stranded polynucleotide molecule will hybridize with the same number of bases in the continuous sequence of the other chain. The continuous sequence can comprise all or a portion of one chain or the other chain in a double-stranded polynucleotide molecule. As used in this application, "partially complementary" generally means that in the base sequence pairs that hybridize, at least about 70% of the bases in the continuous sequence of one chain in a double-stranded polynucleotide molecule will hybridize with the same number of bases in the continuous sequence of the other chain. As used in this application, "substantially complementary" generally means that in the base sequence pairs that hybridize, at least about 90% of the bases in the continuous sequence of one chain in a double-stranded polynucleotide molecule will hybridize with the same number of bases in the continuous sequence of the other chain.
[0099] In this application, the term "internucleoside linkage" generally refers to the covalent linkage between adjacent nucleosides in an oligonucleotide. "Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage. "Modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring internucleoside linkage.
[0100] In this application, the term "expression" generally refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (eg, splicing, polyadenylation, addition of a 5'-cap), and translation.
[0101] In this application, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. Such formulations may generally contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salt should be a pharmaceutically acceptable salt, including salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts can also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts, or calcium salts.
[0102] In this application, the term "prevention and / or treatment" includes not only preventing and / or treating a disease, but also generally includes preventing the onset of a disease, slowing or reversing the progression of a disease, preventing or slowing the onset of one or more symptoms associated with the disease, reducing and / or alleviating one or more symptoms associated with the disease, reducing the severity and / or duration of the disease and / or any symptoms associated therewith and / or preventing a further increase in the severity of the disease and / or any symptoms associated therewith, preventing, reducing or reversing any physiological damage caused by the disease, and generally any pharmacological effect that is beneficial to the patient being treated.
[0103] In this application, the terms "disease" or "disorder" are used interchangeably and generally refer to any deviation of a subject from the normal state, such as any change in the state of the body or some of its organs that prevents or disrupts the performance of functions and / or causes symptoms such as discomfort, dysfunction, suffering or even death in people who are afflicted or exposed to the disease.
[0104] In this application, the term "contact" generally refers to the contact of two or more different types of substances in any order, in any manner, and for any duration. Contact can occur in vivo, ex vivo, or in vitro. In some embodiments, it can refer to direct or indirect contact of the polynucleic acid molecules or compositions of the present application with cells or tissues.
[0105] As used herein, the term "administer" generally refers to introducing the pharmaceutical formulation of the present invention into the body of a subject by any route of introduction or delivery. Any method known to those skilled in the art for contacting cells, organs, or tissues with the drug may be employed. Administration may include, but is not limited to, intravenous, intraarterial, intranasal, intraperitoneal, intramuscular, subcutaneous, or oral administration.
[0106] In this application, the term "subject" generally refers to a human or non-human animal (including mammals) in need of diagnosis, prognosis, improvement, prevention and / or treatment of a disease. Human subjects include fetuses, newborns, infants, adolescents and adult subjects. Subjects include animal disease models.
[0107] As used herein, the term "effective amount" or "effective dose" generally refers to an amount sufficient to achieve, or at least partially achieve, a desired effect. A "therapeutically effective amount" or "therapeutically effective dose" of a drug or therapeutic agent is generally any amount of the drug that, when used alone or in combination with another therapeutic agent, promotes regression of a disease. A "prophylactically effective amount" or "prophylactically effective dose" of a drug generally refers to an amount of the drug that, when administered alone or in combination with another therapeutic agent to a subject at risk for developing or recurring the disease, inhibits the development or recurrence of the disease.
[0108] In this application, the terms "comprises," "comprising," "having," "containing," and variations thereof are generally intended to be open transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. The term "consisting of" generally indicates that no other components (or, similarly, features, integers, steps, etc.) can be present. Unless the context clearly dictates otherwise, nouns with an indefinite number also include plural referents.
[0109] When the term "about" is used in reference to a numerical range, a cutoff or specific value is used to indicate that the stated value may vary from the recited value by up to 10%. Thus, the term "about" can be used to encompass variations of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from the specified value.
[0110] polynucleotide molecules
[0111] The polynucleic acid molecules described herein have oligonucleotides with chains complementary to regions of DMPK alleles containing disease-associated repeat expansions, causing mRNA degradation and blocking translation, and are capable of inhibiting the expression of DMPK alleles containing expanded disease-associated repeats. Polynucleic acid molecules include, but are not limited to, short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), and short hairpin RNA (shRNA).
[0112] In some embodiments, the polynucleotide molecules can target DMPK.In some embodiments, the polynucleotide molecules can target mRNA, for example, for degradation.
[0113] In some embodiments, the polynucleotide molecule may have a region complementary to the human DMPK gene sequence.
[0114] In some embodiments, the polynucleotide molecule may have regions complementary to DMPK gene sequences from multiple species (eg, selected from human, mouse, and non-human species).
[0115] In some embodiments, the polynucleotide molecule can have a region complementary to a mutant form of DMPK, for example, DMPK transcript variant NM_004409.5, DMPK transcript variant NM_001081563.2, or NM_001081560.3.
[0116] In some embodiments, the polynucleotide molecule comprises a sequence of a nucleotide sequence (sometimes referred to as a target sequence) present in DMPK mRNA. In some embodiments, the polynucleotide molecule comprises a nucleotide sequence containing a region complementary to the target sequence. In some embodiments, the polynucleotide molecule comprises a region complementary to the target sequence. In some embodiments, the polynucleotide molecule can be complementary to the continuous nucleotides of the target sequence by at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%. In some embodiments, the complementary nucleotide sequence does not need to be 100% complementary to its targeted region to specifically hybridize or have specificity to the target nucleic acid.
[0117] In some embodiments, the polynucleotide molecule is complementary to at least 8 continuous nucleotides of the target nucleic acid. In some embodiments, the length of the region is 8 to 15, 8 to 30, 8 to 40 or 10 to 50 or 5 to 50 or 5 to 40 nucleotides. In some embodiments, the polynucleotide molecule can comprise 1, 2 or 3 base mispairings compared to the continuous nucleotide portion of the target nucleic acid. In some embodiments, the polynucleotide molecule can have up to 3 mispairings on 15 bases, or up to 2 mispairings on 10 bases.
[0118] When the complementary nucleic acid sequence of the polynucleotide molecule binds to the target sequence (e.g., mRNA), it interferes with the normal function of the target (e.g., mRNA) resulting in a lack of activity (e.g., inhibition of translation) or expression (e.g., degradation of the target mRNA), and has a sufficient degree of complementarity to avoid non-specific binding to non-targets.
[0119] In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a target sequence. In some embodiments, the polynucleic acid molecule consists of a target sequence.
[0120] In some embodiments, the polynucleotide molecule comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleotides comprising a sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 200, and SEQ ID NO: 281 to SEQ ID NO: 490. In some embodiments, the polynucleotide molecule comprises a sequence comprising any one of SEQ ID NO: 1 to SEQ ID NO: 200, and SEQ ID NO: 281 to SEQ ID NO: 490. In some embodiments, the polynucleotide molecule comprises a sequence that shares at least 70%, 75%, 80%, 85%, 90%, 95%, or 97% sequence identity with at least 12 or at least 15 consecutive nucleotides of any one of SEQ ID NO: 1 to SEQ ID NO: 200, and SEQ ID NO: 281 to SEQ ID NO: 490.
[0121] In some embodiments, the polynucleotide molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 200, and SEQ ID NO: 281 to SEQ ID NO: 490, or a sequence that differs therefrom by no more than 3 nucleotides. For example, when the polynucleotide differs from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 200, and SEQ ID NO: 281 to SEQ ID NO: 490 by at most one, two, or three nucleotide substitutions (e.g., adenosine is replaced by uracil), deletions, or additions, the derived polynucleotide can still have reduced inhibitory activity, not less than 20% of the inhibitory effect compared to the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 610 from which the derivative was derived.
[0122] In some embodiments, the polynucleotide molecule consists of 12 to 30 nucleotides. For example, the length of the polynucleotide molecule can be 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides long. For another example, the length of the polynucleotide molecule can be 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides long.
[0123] In some embodiments, wherein the polynucleotide molecule is a single-stranded oligonucleotide or a double-stranded oligonucleotide. In some embodiments, the polynucleotide molecule can be an antisense oligonucleotide. In some embodiments, the polynucleotide molecule is a siRNA, has RNAi activity, and regulates the expression of DMPK.
[0124] In some embodiments, the polynucleotide molecule may comprise only an antisense strand. In some embodiments, the polynucleotide molecule is a double-stranded structure, and may comprise a sense strand and an antisense strand.
[0125] In some embodiments, the sense strand and antisense strand of the polynucleic acid molecule are annealed to form a duplex. The sense strand and antisense strand of the polynucleic acid molecule are partially, substantially, or completely complementary to each other. Within the complementary duplex region, the sense strand core sequence is at least 90% complementary or 100% complementary to the antisense core sequence. In some embodiments, the sense strand core sequence contains a sequence of at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that are at least 90% or 100% complementary to the corresponding 17, 18, 19, 20, or 21 nucleotides of the antisense strand core sequence.
[0126] In some embodiments, the antisense strand comprises a nucleotide sequence that is complementary to the target sequence or an RNA encoded by the target sequence or a portion thereof, and the sense strand comprises a nucleotide sequence that is substantially similar to the target sequence or an RNA encoded by the target sequence or a portion thereof.
[0127] In some embodiments, the antisense strand sequence is 100% (perfect) complementary or at least 90% (substantially) complementary to the target sequence. The sense strand sequence is 100% (perfect) complementary or at least 90% (substantially) complementary to the sequence in the antisense strand, and thus the sense strand sequence is perfectly identical or at least 90% identical to the target sequence.
[0128] In some embodiments, the antisense strand comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleotides comprising the sequence of any one of SEQ ID NOs: 101-200, SEQ ID NOs: 221-240, SEQ ID NOs: 261-280, SEQ ID NOs: 386-490, SEQ ID NOs: 536-580, or SEQ ID NOs: 589-620.
[0129] In some embodiments, wherein the antisense strand comprises a nucleotide sequence selected from any one of the following sequences: SEQ ID NO: 101-200, SEQ ID NO: 221-240, SEQ ID NO: 261-280, SEQ ID NO: 386-490, SEQ ID NO: 536-580 or SEQ ID NO: 589-620, or a sequence that differs therefrom by no more than 3 nucleotides, when a maximum of one, two or three nucleotide substitutions (e.g., adenosine is replaced by uracil), deletions or additions occur, the derived polynucleotide can still have reduced inhibitory activity, not less than 20% of the inhibitory effect compared to the original nucleotide sequence.
[0130] In some embodiments, the sense strand comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleotides comprising the sequence of any one of SEQ ID NOs: 1-100, SEQ ID NOs: 201-220, SEQ ID NOs: 241-260, SEQ ID NOs: 281-385, or SEQ ID NOs: 491-535.
[0131] In some embodiments, wherein the positive strand comprises a nucleotide sequence selected from any one of the following sequences: SEQ ID NO: 1-100, SEQ ID NO: 201-220, SEQ ID NO: 241-260, SEQ ID NO: 281-385 or SEQ ID NO: 491-535, or a sequence that differs therefrom by no more than 3 nucleotides, when a maximum of one, two or three nucleotide substitutions (e.g., adenosine is replaced by uracil), deletions or additions occur, the derived polynucleotide can still have reduced inhibitory activity, not less than 20% of the inhibitory effect compared to the original nucleotide sequence.
[0132] In some embodiments, the antisense strand comprises the nucleotide sequence of any antisense strand sequence in Table 1 and Table 2. In some embodiments, the polynucleic acid molecule antisense strand comprises the sequence of nucleotides 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 3-22, 1-23, 2-23, 3-23, or 4-23 of any antisense strand sequence in Table 1 and Table 2. In some embodiments, the polynucleic acid molecule sense strand comprises the nucleotide sequence of any sense strand sequence in Table 1 and Table 2. In some embodiments, the polynucleic acid molecule sense strand comprises the sequence of nucleotides 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any sense sequence in Table 1 and Table 2. In some embodiments, the antisense strand and sense strand sequences of the polynucleic acid molecule are as shown in Table 1 and Table 2.
[0133] In some embodiments, the sense strand and antisense strand may be the same length or they may be different lengths. In some embodiments, the length of the sense strand and antisense strand of the polynucleic acid molecule is independently 17 to 30 nucleotides long. In some embodiments, the sense strand and antisense strand are independently 17 to 26 nucleotides long. In some embodiments, the sense strand and antisense strand are 19-26 nucleotides long. In some embodiments, the sense strand and antisense strand of the polynucleic acid molecule are independently 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides long. In some embodiments, the sense strand and antisense strand are each 26 nucleotides long. In some embodiments, the sense strand is 23 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, the sense strand is 22 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, the sense strand is 21 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, the sense strand is 19 nucleotides long and the antisense strand is 21 nucleotides long.
[0134] In some embodiments, the polynucleic acid molecule comprises a blunt end, an overhanging end, a scattered end, or a combination thereof. In some embodiments, the sense strand and / or antisense strand further comprises a blunt end, an overhanging end, a scattered end, or a combination thereof. As used herein, a blunt end refers to the end of a double-stranded polynucleic acid molecule in which the terminal nucleotides of the two annealed chains are complementary (forming complementary base pairs), an overhanging end is the end of one or more unpaired nucleotides at the end of one chain of a double-stranded polynucleic acid molecule, and a scattered end generally refers to the end of a double-stranded polynucleic acid molecule in which the terminal nucleotides of the two annealed chains form a pair (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, the blunt end is a 5' blunt end, a 3' blunt end, or both. In some embodiments, the overhanging end is a 5' overhanging end, a 3' overhanging end, or both. In some embodiments, the overhanging end comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 non-base pairing nucleotides. In some embodiments, the overhanging end comprises 1, 2, 3, 4, 5, or 6 non-base pairing nucleotides. In some embodiments, the overhanging end comprises 1, 2, 3 or 4 non-base pairing nucleotides. In some embodiments, the overhanging end comprises 1 non-base pairing nucleotide. In some embodiments, the overhanging end comprises 2 non-base pairing nucleotides. In some embodiments, the overhanging end comprises 3 non-base pairing nucleotides. In some embodiments, the overhanging end comprises 4 non-base pairing nucleotides. In some embodiments, the antisense strand has an overhanging end, and the overhanging end comprises uracil or thymidine nucleotides or nucleotides complementary to the corresponding DMPK mRNA sequence. In some embodiments, the antisense strand has an overhanging end, and the overhanging end comprises uracil or thymidine nucleotides or nucleotides complementary to the corresponding DMPK mRNA sequence. In some embodiments, the sense strand has an overhanging end, and the overhanging end comprises adenosine, uracil or thymidine nucleotides, AT dinucleotides or nucleotides corresponding to nucleotides in the DMPK mRNA sequence.
[0135] Modified nucleotides
[0136] The polynucleotide molecules described herein can be modified, for example, to comprise modified sugar moieties, modified internucleoside linkages, modified nucleotides, and / or combinations thereof.
[0137] In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the nucleotides in a polynucleic acid molecule are modified.
[0138] In some embodiments, the sense strand and / or antisense strand independently comprise one or more modified nucleotides. Any modified chemistry or format of the polynucleotide molecules described herein can be combined with each other. In some embodiments, one, two, three, four, five or more different types of modifications can be included in the same polynucleotide molecule.
[0139] In some embodiments, the nucleotide modifications render the oligonucleotides into which they are incorporated more resistant to nuclease digestion than natural oligodeoxynucleotides or oligoribonucleotide molecules, allowing them to survive intact for a longer period of time, i.e., to obtain their stability against degradation in the biological environment and to improve pharmacological properties, such as pharmacodynamic properties. The polynucleic acid molecules may comprise non-naturally occurring bases, or non-naturally occurring sugars, such as non-sugar compound annular carrier molecules, typical properties of non-naturally occurring sugars for polynucleic acid molecules. The polynucleic acid molecules may comprise bonds between nucleotides (e.g., chiral phosphorothioate bonds) for increasing nuclease resistance. The polynucleic acid molecules may further comprise, or alternatively comprise, ribose analogs to increase nuclease resistance.
[0140] In some embodiments, the polynucleotide molecule may exhibit one or more of the following properties: does not mediate alternative splicing; is not immunostimulatory; is nuclease resistant; has increased cellular uptake compared to an unmodified polynucleotide molecule; is non-toxic to cells or mammals; has increased exit from endosomes within cells; minimizes TLR stimulation; or avoids pattern recognition receptors.
[0141] Modified nucleotides include, but are not limited to, deoxynucleotides, nucleotide mimetics, abasic nucleotides (denoted herein as X, Ab), 2'-modified nucleotides, 3' to 3' linked (inverted) nucleotides (denoted herein as invdN, invN, invn, invX, invAb, nucleotides containing unnatural bases, bridged nucleotides, peptide nucleic acids (PNA), 2', 3'-broken nucleotide mimetics (unlocked nucleobase analogs, denoted herein as NUNA or NUNA), locked nucleotides (denoted herein as NLNA or NLNA), 3'-O-methoxy (2' internucleoside linked) nucleotides (denoted herein as In some embodiments, the present invention relates to a nucleic acid molecule comprising a nucleic acid sequence that is selected from the group consisting of 5'-Me, 2'-F-arabinonucleotides (denoted herein as 3'-OMen), 2'-F-arabinonucleotides (denoted herein as NfANA or NfANA), 5'-Me, 2'-fluoronucleotides (denoted herein as 5Me-Nf), morpholinonucleotides, vinylphosphonate deoxyribonucleotides (denoted herein as vpdN), vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides (cPrpN). Specifically, more than one modification can be incorporated into a single polynucleic acid molecule or even into a single nucleotide thereof. The sense and antisense strands of the polynucleic acid molecule can be synthesized and / or modified by methods known in the art. Modifications at one nucleotide are independent of modifications at another nucleotide.
[0142] Modified nucleotides also include nucleotides with modified bases. Modified bases include, but are not limited to, synthetic and natural bases, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiothymine and 2-thiocytosine, 5-halogenated uracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 8-halogenated, 8-amino, 8-thiol, 8-sulfanyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halogenated, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine.
[0143] In some embodiments, one or more nucleotides of a polynucleic acid molecule are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). In some embodiments, the modified internucleoside linkages are non-phosphate-containing covalent internucleoside linkages. Modified internucleoside linkages or backbones include 5'-phosphorothioate groups (denoted herein as a lowercase s before a nucleotide, as in sN, sn, sNf, or sdN) with normal 3'-5' linkages, chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl phosphonates and other alkyl esters including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-aminophosphoramidate and aminoalkyl phosphoramidates, thionylphosphoramidates, thionylalkyl-phosphonates, thionylalkylphosphotriesters, morpholino linkages, and boranophosphates; 2'-5' linked analogs of these, and those with reversed polarity where adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In other embodiments, the modified internucleoside linkage or backbone does not have a phosphorus atom. Modified internucleoside linkages without phosphorus atoms include, but are not limited to, short chain alkyl or cycloalkyl sugar intra-linkages, mixed heteroatom and alkyl or cycloalkyl sugar intra-linkages, one or more short chain heteroatom or heterocyclic sugar intra-linkages. In some embodiments, the modified internucleoside backbone includes, but is not limited to, siloxane backbones, sulfides, sulfoxides, and sulfone backbones; formacetyl and thioformyl backbones, methyleneformyl and thioformyl backbones, olefin-containing backbones, sulfamic acid ester backbones, methyleneimino and methylenehydrazinyl backbones, sulfonic acid ester and sulfonamide backbones, amide backbones; and others with mixed N, O, S, and CH2 component parts.
[0144] Polynucleic acid molecule synthesis
[0145] In some embodiments, the polynucleic acid molecules described herein are constructed using chemical synthesis and / or enzymatic ligation reactions using procedures known in the art. For example, polynucleic acid molecules are chemically synthesized using naturally occurring nucleotides or various modified nucleotides. Alternatively, polynucleic acid molecules are produced biologically using expression vectors into which the polynucleic acid molecules have been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted polynucleic acid molecule will be in an antisense orientation to the target polynucleic acid molecule of interest).
[0146] In some embodiments, polynucleic acid molecules are synthesized by a tandem synthesis method in which the two strands are synthesized as a single contiguous oligonucleotide fragment or strand separated by a cleavable linker, which is subsequently cleaved to provide separate fragments or strands that hybridize and allow purification of the duplex.
[0147] In some embodiments, the polynucleic acid molecule is also assembled from two different nucleic acid strands or fragments, where one fragment comprises the sense region and the second fragment comprises the antisense region of the molecule.
[0148] Other modification methods for incorporating modifications such as sugar, base, and phosphate modifications are described in the prior art and reference is made to the methods of the prior art.
[0149] In some embodiments, although adopting thiophosphate, dithiophosphate and / or 5 '-methylphosphonate to connect the chemical modification that polynucleic acid molecule internucleotide is connected has improved stability, excessive modification can cause toxicity or activity reduction sometimes.Therefore, when designing nucleic acid molecules, in some embodiments, the amount that these internucleotides connect is minimized.In such case, the reduction of the concentration of these connections causes the toxicity of these molecules to reduce, effect to improve and higher specificity.
[0150] Pharmaceutical composition
[0151] The present application provides a pharmaceutical composition comprising the aforementioned polynucleic acid molecule and optionally a pharmaceutically acceptable excipient.
[0152] In some embodiments, pharmaceutical composition or medicine can comprise at least one described polynucleic acid molecule and one or more pharmaceutically acceptable excipients of pharmacologically effective amount.Pharmaceutically acceptable excipient (excipient) is through suitable safety evaluation and is intended to be included in the material except active pharmaceutical ingredient (API, therapeutic product, such as polynucleic acid molecule) in the drug delivery system.Excipient does not play or is not intended to play therapeutic effect under predetermined dose.Excipient can be used for a) helping the processing of drug delivery system during manufacture, b) protecting, supporting or enhancing stability, bioavailability or patient acceptability of API, c) helping product identification and / or d) enhancing any other attribute of overall safety, effectiveness of delivering API during storage or use.Pharmaceutically acceptable excipient may or may not be an inert substance.
[0153] Excipients include: absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, adhesives, buffers, carriers, coatings, pigments, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavorings, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, hydrophobic agents, and wetting agents.
[0154] In some embodiments, the pharmaceutical composition may also include any other suitable therapeutic agent for treating a subject (e.g., a human subject suffering from DM1). In some embodiments, other therapeutic agents can enhance or supplement the effectiveness of the polynucleotide molecules described herein. In some embodiments, other therapeutic agents can function to treat symptoms or diseases different from the polynucleotide molecules described herein.
[0155] In some embodiments, the polynucleic acid molecule is combined with one or more additional therapeutic agents or treatments, including but not limited to small molecule drugs, antibodies, antibody fragments and / or vaccines. In some embodiments, the therapeutic agent or treatment comprises an anti-transferrin receptor antibody.
[0156] In some embodiments, the pharmaceutical composition can be in solid form, aqueous form, or liquid form. In some embodiments, the aqueous or liquid form can be aerosolized or lyophilized. In some embodiments, the aerosolized or lyophilized form can be reconstituted with an aqueous or liquid solution.
[0157] In some embodiments, the pharmaceutical composition (e.g., a polynucleotide molecule or an antibody) is lyophilized to extend its shelf life and subsequently prepared into a solution prior to use (e.g., administration to a subject). Thus, the excipient may be a lyoprotectant (e.g., mannitol, lactose, polyethylene glycol, or polyvinyl pyrrolidone) or a disintegration temperature regulator (e.g., dextran, ficoll, or gelatin).
[0158] In some embodiments, the pharmaceutical composition is formulated to be compatible with its intended route of administration. Some examples of routes of administration include parenteral administration, such as intravenous, intradermal, and subcutaneous administration. Typically, the route of administration is intravenous or subcutaneous.
[0159] The present application pharmaceutical composition can be used to inhibit the expression of DMPK gene in cell, tissue or organism. In some embodiments, the pharmaceutical composition is used to treat a subject suffering from a disease, illness or condition that will benefit from DMPK expression reduction or inhibition. In some embodiments, the disease, illness or condition that will benefit from DMPK expression reduction or inhibition include but are not limited to: amyotrophy or myotonic dystrophy, which is caused by cachexia (e.g., cancer cachexia), denervation, myopathy, motor neuron disease, diabetes, chronic obstructive pulmonary disease, liver disease, congestive heart failure, chronic renal failure, chronic infection, sepsis, fasting, sarcopenia, glucocorticoid-induced atrophy, disuse or space flight and / or is associated with it. In some embodiments, the amyotrophy includes the amyotrophy associated with diabetes or the amyotrophy associated with cancer cachexia. In some embodiments, myotonic dystrophy is DM1. In some embodiments, the subject is a mammal, including but not limited to people.
[0160] Consider comprising at least one polynucleic acid molecule described herein cell, tissue and non-human organism.Prepare this cell, tissue or non-human organism by polynucleic acid molecule is delivered to cell, tissue or non-human organism in any way obtainable in this area.In some embodiments, cell is mammalian cell, includes but not limited to human cell.Cell, tissue or non-human organism can be used for research or as research tool (such as drug test or diagnosis).
[0161] Use / treatment methods
[0162] The present application provides a method for preventing and / or treating a disease or condition, comprising administering to a target subject an effective amount of the aforementioned polynucleic acid molecule and / or the aforementioned pharmaceutical composition.
[0163] In some embodiments, the polynucleic acid molecules and / or pharmaceutical compositions described herein can be used to treat muscular dystrophy or myotonic dystrophy (DM1) by reducing DMPK expression.
[0164] In some embodiments, a therapeutically effective amount of one or more of the polynucleic acid molecules is administered to a subject, thereby inhibiting the expression of DMPK in the subject (e.g., an amount effective to inhibit the expression of DMPK in the subject). In some embodiments, the subject can be a human subject, a non-human primate subject, a rodent subject, or any suitable mammalian subject. In some embodiments, the subject has a DMPK allele that optionally includes a disease-associated duplication. In some embodiments, a subject may have a DMPK allele with an expanded disease-associated repeat comprising about 2 to 10 repeat units, about 2 to 50 repeat units, about 2 to 100 repeat units, about 50 to 1,000 repeat units, about 50 to 500 repeat units, about 50 to 250 repeat units, about 50 to 100 repeat units, about 500 to 10,000 repeat units, about 500 to 5,000 repeat units, about 500 to 2,500 repeat units, about 500 to 1,000 repeat units, or about 1,000 to 10,000 repeat units.
[0165] In some embodiments, the polynucleotide molecules or pharmaceutical compositions comprising the foregoing can be administered by a suitable route, wherein the route of administration is a route by which the polynucleotide molecules are brought into contact with the body. The route may include intravenous administration, for example as a bolus or by continuous infusion over a period of time. In some embodiments, intravenous administration can be performed by intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intraarticular, intrasynovial, or intrathecal routes.
[0166] In some embodiments, polynucleic acid molecules and / or pharmaceutical compositions are used with the effective concentration of giving the object therapeutic effect. As recognized by those skilled in the art, effective dose varies according to the severity of the disease, the unique characteristics (such as age, physical condition, health or body weight) of the treated object, the persistent period for treatment, the character of any simultaneous treatment, route of administration and related factors. These related factors are well known to those skilled in the art and can be solved only by routine experiments. In some embodiments, effective concentration is the maximum dose that is considered to patient safety. In some embodiments, effective concentration will be the minimum possible concentration that provides maximum effectiveness.
[0167] In general, for the administration of any polynucleic acid molecule and / or pharmaceutical composition described herein, according to the above factors, such as safety or effectiveness, the initial candidate dose can be about 1 to 100 mg / kg or higher. In some embodiments, a single treatment will be administered. In some embodiments, treatment will be administered every day, every two weeks, every week, every two months, every month, or at any time interval to minimize the safety risk to the object while providing maximum effectiveness. In general, effectiveness and treatment and safety risks can be monitored throughout the treatment process.
[0168] In some embodiments, a single dose or administration of the pharmaceutical composition to a subject is sufficient to inhibit the activity or expression of the target gene for at least 1 to 5 days, 1 to 10 days, 5 to 15 days, 10 to 20 days, 15 to 30 days, 20 to 40 days, 25 to 50 days or more. In some embodiments, a single dose or administration of the pharmaceutical composition to a subject is sufficient to inhibit the activity or expression of the target gene for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 weeks. In some embodiments, a single dose or administration of the pharmaceutical composition to a subject is sufficient to inhibit the activity or expression of the target gene for at least 1, 2, 3, 4, 5 or 6 months.
[0169] In some embodiments, the pharmaceutical composition is administered to a subject at an effective concentration sufficient to inhibit the activity or expression of the target gene by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% relative to a control (e.g., baseline level of gene expression prior to treatment).
[0170] In some embodiments, polynucleotide molecules delivery technology known in the art can be used to deliver polynucleic acid molecules described herein or compositions to cell, cell mass, tissue or experimenter.Generally, any suitable method for delivering nucleic acid molecules (in vitro or in vivo) recognized in the art can be applicable to polynucleic acid molecules described herein.For example, delivery can be by local application (local administration) (as, direct injection, implantation or local application (topicaladministering), systemic administration, or subcutaneous, intravenous, oral, intraperitoneal or parenteral approach, including intracranial (as intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, rectal or local (including through cheek and sublingual) use.In some embodiments, by subcutaneous or intravenous infusion or injection administration composition.
[0171] In some embodiments, the polynucleic acid molecules can be combined with lipids, nanoparticles, polymers, liposomes, micelles or other delivery systems available in the art. The polynucleic acid molecules can also be chemically conjugated to targeting groups, lipids (including but not limited to cholesterol and cholesterol-based derivatives), nanoparticles, polymers, liposomes, micelles or other delivery systems available in the art. The polynucleic acid molecules can be conjugated to delivery polymers. In some embodiments, the delivery polymer is an amphiphilic membrane-active polyamine that is reversibly masked / modified.
[0172] use
[0173] On the other hand, the present application provides use of the aforementioned polynucleic acid molecule or the aforementioned pharmaceutical composition in the preparation of a medicament for preventing and / or treating the risk of muscular atrophy or myotonic dystrophy.
[0174] In some embodiments, the muscle wasting is a muscle wasting associated with insulin deficiency, chronic renal failure, congestive heart failure, chronic respiratory disease, chronic infection, fasting, denervation, sarcopenia, or glucocorticoid therapy. In some embodiments, myotonic dystrophy is DM1.
[0175] Reagent test kit
[0176] In some embodiments, the present application discloses kits and articles for use with one or more compositions and methods described herein. Such kits include carriers, packaging, or compartmentalized containers that receive one or more containers, such as vials, tubes, etc., each container containing a separate element to be used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In one embodiment, the container is formed from various materials such as glass or plastic.
[0177] In one embodiment, the container comprises a polynucleotide molecule as described herein.Such a kit optionally comprises an identifying description or label or instructions for its use in the methods described herein.
[0178] The present application is further described below through specific examples.
[0179] About siRNA Sequence and Synthesis
[0180] siRNAs are initially designed to consist of fully complementary sense and antisense strands with a length of 19 or 21 nucleotides, with the antisense strand required to fully match the target mRNA for catalytic activity. In some cases, to increase the cell's preference for the antisense strand, a 2-nucleotide overhang can be added to the 3' end of the antisense strand, leaving the overhang unpaired with the sense strand. Therefore, 19 / 21mer can be used to describe an siRNA design that adds 2 nucleotides to the 3' end of the antisense strand of an initial 19-nucleotide siRNA, where 19 and 21 refer to the lengths of the sense and antisense strands, respectively; 21 / 23mer can be used to describe an siRNA design that adds two 2-nucleotide overhangs to the 3' end of the antisense strand of an initial 21-nucleotide siRNA, where 21 and 23 refer to the lengths of the sense and antisense strands, respectively.
[0181] In some cases, the base sequence of the 3' overhang of the antisense strand can completely match the target mRNA, or be composed of other non-related dinucleotide sequences, such as "UU", without affecting the activity of the siRNA. In some cases, when the antisense strand is loaded into Ago2, the first base at the 5' end binds to Ago2 but not to the target mRNA. At the same time, "U" is the most thermodynamically preferred base for binding to Ago2. Therefore, all antisense strands can replace the first base at the 5' end with "U", and accordingly, all sense strands can replace the last base at the 3' end (position 19) with "A" without affecting the activity of the siRNA.
[0182] The two single strands of siRNA used in this application were synthesized separately on a solid-phase support using standard phosphoramidite chemistry. The specific sequences are shown below. They were then purified by HPLC to a single-strand purity of greater than 95%. The two complementary single strands were then annealed and paired at a similar molar ratio to form a double-stranded siRNA, which was then lyophilized for later use.
[0183] Example 1 siRNA design, preliminary analysis and screening
[0184] 1A: 19 / 21mer siRNA naked sequence design and screening
[0185] In this embodiment, 100 pairs of 19 / 21mer siRNAs (siRNA ID#0001-0100) were designed for human DMPK transcript variants NM_001081563.2 or NM_001081560.3, wherein Seq ID NO:001-Seq ID NO:100 are positive strands and Seq ID NO:101-200 are antisense strands. The first 19 / 21mer siRNA is siRNA ID#0001, its positive strand is SeqID NO:001, its antisense strand is Seq ID NO:101, and so on. Sequences with non-functional siRNAs, high off-target risks, human-monkey mismatches, or low scores were removed from the sequence design of this application (see the specific design process for details). Figure 1 ), and the detailed sequence information is shown in the table.
[0186] Table 1 Specific sequences of 19 / 21mer siRNA
[0187]
[0188]
[0189]
[0190]
[0191] 1B: 21 / 23mer siRNA naked sequence design
[0192] 105 21 / 23mer siRNAs (siRNAID#0141-0245) were designed for the human DMPK transcript variant NM_004409.5. Seq ID NOs: 281-385 are the sense strands, and Seq ID NOs: 386-490 are the antisense strands. The first 19 / 21mer siRNA is siRNAID#0141, its sense strand is Seq ID NO: 281, its antisense strand is Seq ID NO: 386, and so on. Sequence design removed non-functional siRNAs, sequences with high off-target risk, human-monkey mismatches, or sequences with low scores (see the detailed design process for details). Figure 2 ), and the sequence information is shown in Table 2.
[0193] Table 2 21 / 23mer siRNA design
[0194]
[0195]
[0196]
[0197]
[0198]
[0199] Example 2. Preliminary screening of siRNA
[0200] The following in vitro siRNA evaluation method was used to preliminarily screen siRNA (different methods were used for different types of siRNA, see below for details).
[0201] 1. In vitro evaluation of siRNA
[0202] Human SJCRH30 rhabdomyosarcoma myoblasts were grown in DMEM supplemented with 10% v / v heat-inactivated fetal bovine serum, 4.5 mg / mL glucose, 4 mM L-glutamine, 10 mM HEPES, and 1 mM sodium pyruvate. To facilitate transfection, cells were seeded at a density of 5,000–10,000 cells / well in 24-well plates and transfected within 24 hours.
[0203] Using RNAiMax (ThermoFisher), siRNA diluted to the specified concentration was mixed with the cells to be transfected according to the instructions of the manufacturer. The transfected cells were incubated at 37°C in 5% CO2 for 2 days, then washed with PBS and harvested in TRIzol (ThermoFisher) and stored at -80°C. RNA was isolated using the Direct-zol-96 RNA Kit (ZymoResearch) according to the instructions of the manufacturer. Using ReverTra Ace TM RNA was reverse transcribed into cDNA using qPCR RT Master Mix (TOYOBO) according to the instructions. cDNA samples were evaluated by qPCR using Taqman Fast Advanced Master Mix (Applied Biosystems) with DMPK-specific and GAPDH-specific primers and SYBR Green. Detailed information on the primers used is shown in Table 3. In the two-dose screening experiment, DMPK values were normalized to GAPDH gene expression within each sample. DMPK downregulation was quantified using standard 2 -ΔΔCT All experiments were performed in triplicate, and the mean of the three replicates was calculated. In the multiple-dose validation experiments, data were analyzed by nonlinear regression using a 3-parameter dose-response inhibition function (GraphPad Prism 8.3.0) to calculate IC50 and KDmax.
[0204] Table 3 Human DMPK primer information
[0205]
[0206]
[0207] 2. In vitro evaluation of siRNA
[0208] Human SJCRH30 rhabdomyosarcoma myoblasts were grown in DMEM supplemented with 10% v / v heat-inactivated fetal bovine serum, 4.5 mg / mL glucose, 4 mM L-glutamine, 10 mM HEPES, and 1 mM sodium pyruvate. siRNA was prepared using electroporation according to the manufacturer's instructions. 24 hours before transfection, cells were seeded into 48-well tissue culture plates at 100,000 cells per well. DMPK siRNA was transfected into SJCRH30 cells. 48 hours after transfection, cells were washed with PBS and harvested using a reagent (Life Technologies).
[0209] RNA was isolated using the Direct-zol-96 RNA Kit (Zymo Research) according to the manufacturer's instructions. TM RNA was reverse transcribed into cDNA using qPCR RT Master Mix (TOYOBO) according to the manufacturer's instructions. cDNA samples were evaluated by qPCR using AceQ Universal U+Probe Master Mix V2 (Vazyme) with DMPK-specific and GAPDH-specific primers and human gene probes, with three replicates performed for each gene. Primer and probe information is shown in Table 4.
[0210] Table 4 Human DMPK primer information
[0211] Primers Sequence (5'-3') Human DMPK-F GAGACTTCATTCAGCGGTT(Seq ID NO:625) Human DMPK-R CTTCGAAATCCGGTGTAAAG(Seq ID NO:626) Human DMPK-Probe 5'-FAM-CCTTCTTCTTTGGCCTCGACTGGGA-BHQ1(Seq ID NO:627) Human GADPH-F ACCCAGAAGACTGTGGATGG(Seq ID NO:628) human GADPH-R TCAGCTCAGGGATGACCTTG(Seq ID NO:629) Human GADPH-Probe 5'-FAM-CCCACAGCCTTGGCAGCGCC-BHQ1(Seq ID NO:630)
[0212] 3. In vitro evaluation of siRNA
[0213] Human SJCRH30 rhabdomyosarcoma myoblasts were grown in DMEM supplemented with 10% v / v heat-inactivated fetal bovine serum, 4.5 mg / mL glucose, 4 mM L-glutamine, 10 mM HEPES, and 1 mM sodium pyruvate. siRNA was prepared using the transfection reagent Lipofectamine RNAiMAX (Life Technologies) according to the instructions provided. 24 hours before transfection, cells were seeded in triplicate onto 96-well tissue culture plates at 4,000 cells per well. DMPK siRNA was transfected into SJCRH30 cells. 48 hours after transfection, cells were washed with PBS and harvested using a reagent (Life Technologies).
[0214] RNA was extracted from cells according to the instructions of the FastPure Cell / Tissue Total RNA Isolation Kit V2 (Vazyme); ReverTra Ace TM RNA was reverse transcribed into cDNA using qPCR RT Master Mix (TOYOBO) according to the manufacturer's instructions. cDNA samples were evaluated by qPCR using AceQ Universal U+Probe Master Mix V2 (Vazyme) with DMPK-specific and GAPDH-specific human gene probes, with three replicates performed for each gene. Primer and probe information is as described in Table 4 above.
[0215] 4. In vitro evaluation of siRNA
[0216] Human SJCRH30 rhabdomyosarcoma myoblasts were grown in DMEM supplemented with 10% v / v heat-inactivated fetal bovine serum, 4.5 mg / mL glucose, 4 mM L-glutamine, 10 mM HEPES, and 1 mM sodium pyruvate. For transfection, cells were seeded in 96-well plates at a density of 4,000 cells / well and transfected within 24 hours. siRNA was prepared using the transfection reagent Lipofectamine RNAiMAX (Life Technologies) according to the instructions of the manufacturer's instructions. DMPK siRNA was transfected into SJCRH30 cells. 48 hours after transfection, cells were washed with PBS and harvested with a reagent (Life Technologies).
[0217] Using SuperScript TM IV CellsDirect TM cDNA was generated by lysing cells using a cDNA synthesis kit and reverse transcription according to the manufacturer's instructions. cDNA samples were evaluated by qPCR using Taqman Fast Advanced Master Mix (Applied Biosystems) with DMPK-specific and GAPDH-specific TaqMan human gene expression probes (Thermo Fisher), with three replicates per gene. The primers and probes used are shown in Table 5.
[0218] Table 5 Human DMPK primer kit
[0219] Human DMPK The product number is Hs01094329_m1 Human GADPH The product number is Hs02786624_g1
[0220] 5. In vitro evaluation of siRNA (mouse cells, WX)
[0221] C2C12 myoblasts (ATCC) were grown in DMEM supplemented with 10% v / v FBS. For transfection, cells were seeded at a density of 2,000 cells / well in 96-well plates and transfected within 24 hours. siRNA was prepared using the transfection reagent Lipofectamine RNAiMAX (Life Technologies) according to the manufacturer's instructions. DMPK siRNA was transfected into C2C12 cells. 48 hours after transfection, cells were washed with PBS and harvested using the reagent (Life Technologies).
[0222] Using SuperScript TM IV CellsDirect TM cDNA was generated by lysing cells using a cDNA synthesis kit and reverse transcription according to the manufacturer's instructions. cDNA samples were evaluated by qPCR using Taqman Fast Advanced Master Mix (Applied Biosystems) with DMPK-specific and GAPDH-specific TaqMan mouse gene expression probes (Thermo Fisher), with three replicates per gene. The primers and probes used are shown in Table 6.
[0223] Table 6 Mouse DMPK Primer Kit
[0224] Mouse DMPK The item number is Mm00446261_m1 Mouse GADPH The item number is Mm99999915_g1
[0225] Example 3 siRNA screening and verification and screening of modified siRNA
[0226] siRNA screening and validation mainly includes three parts: naked sequence screening and validation, modified sequence screening and validation, and druggability study of the selected siRNA. Among them, naked sequence screening and modified sequence screening of 19 / 21mer siRNA and 21 / 23mer siRNA are carried out separately, and head-to-head comparison is mixed in the final sequence activity validation and druggability study. The detailed process is shown in Figure 3 . Seven common siRNA modification methods have been used in siRNA screening and validation, including Figure 4 shown, specifically, Figure 4 In the figure, light gray and white text indicate 2'-O-methyl modifications; black text with open circles indicates T-deoxy-2'-fluoro modifications; solid black circles indicate glycol nucleic acids; and bold short lines indicate phosphorothioate linkages. The activity of modified siRNAs is sequence-dependent, meaning that the optimal modifications required often vary between different sequences.
[0227] A1: 19 / 21mer siRNA naked sequence screening
[0228] The siRNA was transfected into SJCRH30 cells at a predetermined concentration using the siRNA in vitro evaluation method 2 described in Example 2. The DMPK mRNA content was calculated according to the method described in Table 7, and the values are expressed as the percentage of the mRNA content relative to the control group and the coefficient of variation.
[0229] Table 7 19 / 21mer siRNA initial screening results
[0230]
[0231]
[0232]
[0233] A2: Screening of modified 19 / 21mer siRNA
[0234] According to the above results, 20 19 / 21mer siRNAs with better effects (combining the results of 2pmol and 0.02pmol, 20 with lower mRNA expression values were selected). For the preferred 20 19 / 21mer siRNAs, two chemical modification methods were used to synthesize modified siRNAs. Among them, siRNA ID#0101-0120 adopted modification mode A, and the modified sequence is shown in Table 8 below. The other is modification mode B, see below. Among them, Seq ID NO:201-220 is the positive chain, and Seq ID NO:221-240 is the antisense chain. The first modified 19 / 21mer siRNA is siRNA ID#0101, its positive chain is Seq ID NO:201, and its antisense chain is Seq ID NO:0221, and so on. The sequence information is shown in Table 8, where the first column of brackets is the naked sequence number before modification.
[0235] Using the in vitro evaluation method 2 of siRNA in Example 2, a preset amount of siRNA (see Table 9) was transfected into SJCRH30 cells. The mRNA content of DMPK was calculated according to the description of the method, and the results are shown in Table 8. The values in Table 8 represent the content of the mRNA. KDmax refers to the maximum mRNA knockdown level calculated based on the knockdown curve, the curve IC50 refers to the half-maximal inhibitory concentration calculated based on the knockdown curve, and the absolute IC50 refers to the intersection of the straight line with 50% mRNA content and the knockdown curve.
[0236] Table 8 Modified 19 / 21mer sRNA
[0237]
[0238]
[0239] Modification description: m = 2'-O-methyl; i2F = 2'-fluoro; gn = glycol nucleic acid; * / = phosphorothioate linkage; / = phosphodiester linkage.
[0240] Table 9 Screening results of modified 19 / 21mer siRNA
[0241]
[0242]
[0243] siRNA ID#0121-0140 uses modification pattern B (for details, see Figure 4 ), and the modified sequences are shown in Table 10. Seq ID NOs: 241-260 are the sense strands, and Seq ID NOs: 261-280 are the antisense strands. The first modified 19 / 21mer siRNA is siRNA ID#0121, its sense strand is Seq ID NO: 241, and its antisense strand is Seq ID NO: 261. Sequence information for the following sequences is shown in Table 10.
[0244] Using the in vitro siRNA evaluation method 2 described in Example 2, a preset amount of siRNA was transfected into SJCRH30 cells. The mRNA content of DMPK was calculated according to this evaluation method. The results are shown in Table 11. The values in the table represent the mRNA content. KDmax refers to the maximum mRNA knockdown level calculated based on the knockdown curve, the curve IC50 refers to the half-maximal inhibitory concentration calculated based on the knockdown curve, and the absolute IC50 refers to the intersection of the line with 50% mRNA content and the knockdown curve.
[0245] Table 10 Modified 19 / 21mer sRNA
[0246]
[0247]
[0248] Modification description: m = 2'-O-methyl; i2F = 2'-fluoro; gn = glycol nucleic acid; * / = phosphorothioate linkage; / = phosphodiester linkage.
[0249] Table 11 Screening results of modified 19 / 21mer siRNA
[0250]
[0251]
[0252] A3: Validation of modified 19 / 21mer siRNA
[0253] Based on the above results, 10 modified 19 / 21mer siRNAs were further selected. For these 10 modified 19 / 21mer siRNAs, the in vitro evaluation method 3 of siRNA in Example 2 was used for activity verification, and the preset content of siRNA was transfected into SJCRH30 cells. The mRNA content of DMPK was calculated according to the evaluation method, and the results are shown in Table 12, and the numerical values are expressed as the mRNA content. KDmax refers to the maximum mRNA knockdown level calculated based on the knockdown curve, the curve IC50 refers to the half-maximal inhibitory concentration calculated based on the knockdown curve, and the absolute IC50 refers to the intersection of the straight line with an mRNA content of 50% and the knockdown curve.
[0254] Table 12 Validation of modified 19 / 21mer siRNA
[0255]
[0256]
[0257] For the preferred 10 modified 19 / 21mer siRNAs, the in vitro evaluation method 4 of siRNA in Example 2 was used for activity verification, and the preset siRNA content was transfected into SJCRH30 cells. The mRNA content of DMPK was calculated according to the method description as shown in Table 12, and the numerical value is expressed as the mRNA content. KDmax refers to the maximum mRNA knockdown level calculated based on the knockdown curve, the curve IC50 refers to the half-maximal inhibitory concentration calculated based on the knockdown curve, and the absolute IC50 refers to the intersection of the straight line with 50% mRNA content and the knockdown curve.
[0258] Table 13 Validation of modified 19 / 21mer siRNA
[0259]
[0260] B1 21 / 23mer siRNA naked sequence initial screening
[0261] The siRNA was transfected into SJCRH30 cells at a predetermined concentration using the siRNA in vitro evaluation method 1 described in Example 2. The DMPK mRNA levels were calculated according to the method described and are shown in Tables 14-15. The values are expressed as percentages of the mRNA levels relative to the control group and the coefficient of variation.
[0262] Table 14 21 / 23mer siRNA initial screening results
[0263]
[0264]
[0265]
[0266]
[0267]
[0268] Table 15 21 / 23mer siRNA initial screening results
[0269]
[0270]
[0271] B2: 21 / 23mer siRNA naked sequence verification
[0272] Based on the above results, 20 21 / 23mer siRNA naked sequences were preferred. For the preferred 20 21 / 23mer siRNA naked sequences, the in vitro evaluation method 1 of siRNA in Example 2 was used for activity verification, and the preset amount of siRNA was transfected into SJCRH30 cells. The mRNA content of DMPK was calculated according to this method, and the results are shown in Table 16, with the numerical values expressed as the mRNA content. KDmax refers to the maximum mRNA knockdown level calculated based on the knockdown curve, the curve IC50 refers to the half-maximal inhibitory concentration calculated based on the knockdown curve, and the absolute IC50 refers to the intersection of the straight line with 50% mRNA content and the knockdown curve.
[0273] Table 16 21 / 23mer siRNA naked sequence verification
[0274]
[0275]
[0276] nd: Value not measured
[0277] Screening of 21 / 23mer siRNAs modified with B3
[0278] Based on the above results, 9 21 / 23mer siRNA naked sequences were selected. For the 9 preferred 21 / 23mer siRNAs, 5 chemical modification methods were used to synthesize modified siRNAs, totaling 45. The modified sequences are shown in Table 17, and the modification types are shown in Table 18. Among them, Seq ID NO: 491-535 is the sense strand, and Seq ID NO: 536-580 is the antisense strand. The first modified 21 / 23mer siRNA is siRNAID#0246, its sense strand is Seq ID NO: 491, and its antisense strand is Seq ID NO: 536, and so on. The sequence information is shown in Table 17.
[0279] The siRNA was transfected into SJCRH30 cells at a predetermined concentration using the siRNA in vitro evaluation method 1 described in Example 2. The DMPK mRNA levels were calculated according to the method described and are shown in Tables 18-19. The values are expressed as percentages of the mRNA levels relative to the control group and the coefficient of variation.
[0280] Table 17 Modified 21 / 23mer sRNA
[0281]
[0282]
[0283]
[0284] Modification description: m = 2'-O-methyl; i2F = 2'-fluoro; gn = glycol nucleic acid; * / = phosphorothioate linkage; / = phosphodiester linkage.
[0285] Table 18 Screening of modified 21 / 23mer siRNA
[0286]
[0287]
[0288]
[0289] Table 19 Screening of modified 21 / 23mer siRNA
[0290] siRNA ID# 1nM CV% 0.01nM CV% 0253 24.17 27.73 81.01 24.51 0263 50.37 18.55 87.46 16.29 0268 46.74 15.11 85.82 20.87 0270 34.44 16.01 98.89 23.62 0273 32.20 46.60 79.39 4.22 0275 41.13 38.87 84.06 21.08 0277 41.42 31.97 67.83 22.06 0280 48.36 2.80 97.04 17.01 0287 27.61 6.91 72.14 27.40 0288 30.58 46.41 96.92 11.18 0290 27.58 10.56 88.08 18.71
[0291] Validation of B4-modified 21 / 23mer siRNA
[0292] Based on the above results, 6 modified 21 / 23mer siRNAs are preferred. For the preferred 6 modified 21 / 23mer siRNAs, the activity was verified using the in vitro evaluation method 1 of siRNA in Example 2, and the preset amount of siRNA was transfected into SJCRH30 cells. The mRNA content of DMPK was calculated according to the above method, and the results are shown in Table 20, with the numerical values expressed as the mRNA content. KDmax refers to the maximum mRNA knockdown level calculated based on the knockdown curve, the curve IC50 refers to the half-maximal inhibitory concentration calculated based on the knockdown curve, and the absolute IC50 refers to the intersection of the straight line with an mRNA content of 50% and the knockdown curve.
[0293] Table 20 Validation of modified 21 / 23mer siRNA
[0294]
[0295] Example 4: Further verification and screening of modified siRNA
[0296] A1. The modified 19 / 21mer siRNA preferred in Example 3 and the modified 21 / 23mer siRNA preferred in Example 10 were mixed. For the 9 modified siRNAs with the best activity, the activity was verified using the in vitro evaluation method 2 of siRNA in Example 2, and the preset siRNA content was transfected into SJCRH30 cells. The mRNA content of DMPK was calculated according to the above method. The results are shown in Table 21, and the numerical values are expressed as the mRNA content. KDmax refers to the maximum mRNA knockdown level calculated based on the knockdown curve, the curve IC50 refers to the half-maximal inhibitory concentration calculated based on the knockdown curve, and the absolute IC50 refers to the intersection of the straight line with 50% mRNA content and the knockdown curve.
[0297] Table 21 Verification of modified siRNA
[0298]
[0299]
[0300] A2. The preferred modified 19 / 21mer siRNA and modified 21 / 23mer siRNA of Example 3 were mixed. For the 9 modified siRNAs with the best activity, the in vitro evaluation method 3 of siRNA in Example 2 was used for activity verification, and the preset siRNA content was transfected into SJCRH30 cells. The mRNA content of DMPK was calculated according to this method. The results are shown in Table 22, and the numerical values are expressed as the mRNA content. KDmax refers to the maximum mRNA knockdown level calculated based on the knockdown curve, the curve IC50 refers to the half-maximal inhibitory concentration calculated based on the knockdown curve, and the absolute IC50 refers to the intersection of the straight line with 50% mRNA content and the knockdown curve.
[0301] Table 22: Verification of modified siRNA
[0302]
[0303] B. Human-mouse cross-activity of modified siRNA
[0304] The preferred modified 19 / 21mer siRNA of embodiment 3 is mixed with the modified 21 / 23mer siRNA. Since the aforementioned screening and verification all use human cells, but the DMPK transcript of people and mice have larger differences, 8 modified siRNAs that may have human-mouse cross activity are predicted based on transcripts, see Table 23 (some predicted unreactive sequences in Table 22 are not selected, so the sequences in Table 23 and Table 22 are not completely repeated), the in vitro evaluation method 5 of the siRNA in Example 2 is used for activity verification, and the siRNA of preset content is transfected into SJCRH30 cells. The mRNA content of DMPK is calculated as shown in Table 23 according to the method description, and numerical value is expressed as the mRNA content. KDmax refers to the maximum mRNA knockdown level calculated according to the knockdown curve, and curve IC50 refers to the half-inhibitory concentration calculated according to the knockdown curve, and absolute IC50 refers to the intersection of the straight line and the knockdown curve of 50% mRNA content.
[0305] Table 23 Human-mouse cross-activity of modified siRNA
[0306]
[0307] C: Serum stability test of modified siRNA
[0308] Based on the activity, 6 modified siRNAs were selected (in order to cover different modification types, not for the purpose of screening active sequences) to evaluate their stability in serum. The experimental method includes: the siRNA to be tested is placed in 50% mouse serum and mixed, and incubated at 37°C for 0h, 24h, and 48h. The experiment set up three biological replicates, and after serum incubation, 10% non-deformed PAGE nucleic acid electrophoresis detection and LCMS detection were performed to determine the stability of the siRNA to be tested. At the same time, the following sequences were selected as controls, PCa is unmodified siRNA, and PCb is modified siRNA (Yangshen), from SEQ ID NO: 114-115 in U.S. Patent US2021 / 0299266A1, and the sequence information is shown in Table 24.
[0309] Table 24 Yangshen sequence for serum stability test
[0310]
[0311] Modification description: m = 2'-O-methyl; i2F = 2'-fluoro; gn = glycol nucleic acid; * / = phosphorothioate linkage; / = phosphodiester linkage.
[0312] PAGE electrophoresis results showed that the unmodified siRNA had poor stability in 50% serum. After 24 hours of incubation, the target band was completely degraded. The modified siRNA was similar to Yangshen. After 48 hours of incubation in 50% serum, the target band had no obvious degradation and good stability (see the results). Figure 5 LCMS results showed that the residual amount of both the sense and antisense chains of the modified siRNA was greater than 85% after 48 h of serum incubation, indicating good stability and no significant difference compared with Yangshen (Table 25).
[0313] Table 25 Serum stability test results of modified siRNA (LC-MS)
[0314]
[0315] D. Cytotoxicity of modified siRNA
[0316] The 8 sequences in Table 21 (siRNA ID: #0112, #0131, #0132, #0253, #0270, #0273, #0277, #0287) were further evaluated for their cytotoxicity in SJCRH30 cells. The specific method was as follows: 5×10 4 Cells (or 8×10 cells per well in a 96-well plate) 3Cells were transfected with the test siRNA at final concentrations of 1 nM and 20 nM using Lipofectamine RNAiMAX as described in the manufacturer's instructions. Blank (untransfected), luciferase siRNA (siLUC, 20 nM, commercially available), siRNA TX (1 nM and 20 nM, targeting PLK, commercially available), and PCb used in the serum stability test described above were also used as controls. Their sequence information is shown in Table 26. After a 48-hour incubation, cell viability was determined by measuring OD450 using a 10% CCK-8 solution.
[0317] The experimental results were normalized to the cell activity using the Blank results as the baseline. Figure 6-7 Results from two replicate experiments are shown. The results show that TX significantly reduced cell viability in all three experiments (independent experiments in a 24-well plate system), while none of the candidate siRNAs significantly reduced cell viability compared to siLUC.
[0318] Table 26 Control and Yangshen sequences for cytotoxicity testing
[0319]
[0320] E. Immunogenicity of modified siRNA
[0321] The eight sequences in Table 21 were further evaluated for their immunogenicity after siRNA transfection into peripheral blood mononuclear cells (PBMC). The commonly used transfection reagent lipofectamine is known to stimulate the immunogenicity of PBMC, so GenePORTER2 was used for transfection in the experiment. The specific method was: using the in vitro evaluation method 1 of siRNA, 10 cells were plated per well in a 24-well plate. 6 Cells were transfected with the siRNA to be tested at a final concentration of 100 nM according to the instructions. Blank (untransfected), Mock (only transfection reagent GenePORTER2, commercially available), luciferase siRNA (siLUC, 100 nM), polyI:C (2 ug / mL, commercially available), which is known to be immunogenic, and PCb used in the serum stability test were used as controls. After 6 hours of incubation, the cell supernatant was aspirated and IFN-α and IL-6 expression was detected by ELISA. After 24 hours of incubation, the total mRNA of PBMC cells was extracted and the expression of OAS1 and P56 mRNA was detected by qRT-PCR. The sequence information of the primers used is shown in Table 27.
[0322] The experimental results were normalized to the cell activity using the Blank results as the baseline. Figure 8-9The results of ELISA detection of IFN-α and IL-6 expression are shown. Figure 10-11 The results of qRT-PCR detection of OAS1 and P56 mRNA expression are presented. The results show that polyI:C significantly increased the expression of IFN-α and IL-6 in PBMC supernatant and activated the gene transcription of OAS1 and P56 in PBMC, while the candidate siRNA had no significant immunogenicity.
[0323] Table 27 Primer information of immunogenic genes
[0324]
[0325]
[0326] F. Research and Countermeasures on Off-Target Risks of Modified siRNA
[0327] The eight sequences in Table 21 were further evaluated for off-target potential by next-generation sequencing (RNAseq). Furthermore, the modified siRNAs were modified (renumbered) by adding glycol nucleic acid (GNA) modifications at positions 5-8 of the antisense strand seed region to reduce the downregulation of off-target genes by the modified siRNAs. The eight modified siRNAs used in the experiment and their corresponding GNA-modified products are shown in Table 28.
[0328] Table 28 siRNA and GNA modifications used for off-target risk studies
[0329]
[0330]
[0331]
[0332] Modification description: m = 2'-O-methyl; i2F = 2'-fluoro; gn = glycol nucleic acid; * / = phosphorothioate linkage; / = phosphodiester linkage.
[0333] The steps for the off-target risk study are detailed as follows: Using the in vitro siRNA evaluation method 1 described in Example 2, SJCRH30 cells were transfected with siRNA at final concentrations of 1 nM and 20 nM, and changes in target and off-target genes were assessed 48 hours later using next-generation sequencing (RNAseq). Off-targets were limited to mRNA. The criteria were: log2(target / blank) ≤ -1 at 20 nM; and padj < 10 at both concentrations. -520nM knockdown efficiency is better than 1nM; the sequence and target gene have certain similarity. Two batches of siRNA ID#253 from two different suppliers were used in the above experiment. The RNAseq results are as follows Figure 12 As shown, the genes that appeared repeatedly were selected to enter the next step of off-target verification. In the off-target verification, primers were designed for each off-target gene, and the qPCR verification results showed that COL4A1, RPL38 and HIGD2A were verified as off-target genes ( Figure 13 ), and its primer design is shown in Table 29.
[0334] Table 29 Primer information for off-target genes
[0335] Human COL4A1-F CAGGCACCCCATCTGTTGAT(Seq ID NO:635) Human COL4A1-R CATTGCCTTGCACGTAGAGC(Seq ID NO:636) Human RPL38-F CAAGGACTTCCTGCTCACAGC(Seq ID NO:637) Human RPL38-R ACCAGGGTGTAAAGGTATCTGC(Seq ID NO:638) Human HIGD2A-F AGAACCCGGTGGTACCCATA(Seq ID NO:639) human HIGD2A-R TGCGCATCATGAGCTGAGAG(Seq ID NO:640)
[0336] By adding glycol nucleic acid (GNA) modifications at positions 5-8 of the antisense seed region, siRNA ID#253 was transformed into siRNA ID#311-siRNA ID#314, where siRNA ID#311 was an siRNA with a GNA modification added at position 5 of the antisense seed region, siRNA ID#314 was an siRNA with a GNA modification added at position 8 of the antisense seed region, and so on (Table 28). The in vitro evaluation method 1 of siRNA in Example 2 above was repeated. The results showed that GNA modifications at four different positions could effectively reduce the knockdown efficiency of off-target genes COL4A1, RPL38, and HIGD2A, but had no significant effect on the knockdown efficiency of the target gene DMPK ( Figure 14-17 ).
[0337] Example 5 Expression and affinity verification of anti-TfR1 antibodies
[0338] Select and expand stable cell pools and inoculate them in shake flasks or cell bags using Serum-free Expression medium (GenScript) at 37°C and 5% CO2. On the day of transfection, heat the culture medium to 25-37°C. Add 50 μM Swaisonine (MedChemExpress) to the culture medium 1 hour before transfection. Add appropriate amounts of plasmids and reagents to the transfection mixture and mix thoroughly. Incubate the mixture at room temperature. Add appropriate feeds to the cell culture according to cell growth. Collect the culture supernatant on day 7 for purification. Load the supernatant into MabSelect at an appropriate flow rate. TMPrismA Crude. After washing and elution with an appropriate buffer, the eluted fraction was buffered with the final formulation buffer. The eluted protein was buffered with PBS (pH 7.2) and the purified protein was analyzed by SDS-PAGE and SEC-HPLC (column information: TSKgel G3000SWxl TOSHO) to determine molecular weight and purity. The final protein purity was >98%.
[0339] The anti-human TfR1 antibodies used in the experiment are shown in Table 30. The Fab end is derived from 13E4-Variant 2iii of U.S. Patent No. US10913800B2, and the Fc end is derived from a human IgG1 subclass monoclonal antibody. In some embodiments, the Fc end is modified, for example, using a LALA-LR mutation to reduce the immunogenicity of the Fc end, or using an S238C mutation to create a site suitable for site-specific nucleic acid coupling. The affinity of the anti-human TfR1 antibody and human TfR1 was confirmed by OctetBLI, and the results are shown in Table 31.
[0340] Table 30 Antibody sequences against human TfR1
[0341]
[0342]
[0343] Table 31 Affinity of anti-human TfR1 antibodies and human and cynomolgus monkey TfR1
[0344] Antibody antigen <![CDATA[Chi 2 (RU 2 )]]> ka(1 / Ms) kd(1 / s) KD(M) Rmax(RU) hIgG1TfR1-Var2iii HumanTfR1 5.88E-01 4.36E+05 7.42E-05 1.70E-10 96.3 hIgG1TfR1-Var2iii CynoTfR1 6.30E-01 3.31E+05 1.33E-03 4.02E-09 69.1
[0345] Where: Chi2 refers to the chi-square test, ka is the binding coefficient, kd is the dissociation dilution, KD is the affinity = kd / ka, and Rmax is the static maximum signal intensity.
[0346] The anti-mouse TfR1 antibodies used in the experiment are shown in Table 32. Its variable region is from the rat anti-mouse TfR1 antibody TIB-219 (light chain GenBank: ABV48920.1, heavy chain GenBank: ABV48917.1), and its Fc end is from a human IgG1 subclass monoclonal antibody. In some embodiments, the Fc end is modified, for example, using a LALA-LR mutation to reduce the immunogenicity of the Fc end, or using an S245C mutation to create a site suitable for site-specific coupling of nucleic acids. The affinity of the anti-human TfR1 antibody and human TfR1 was confirmed by OctetBLI, and the results are shown in Table 33.
[0347] Table 32 Antibody sequences against human TfR1
[0348]
[0349]
[0350] Table 33 Affinity of anti-human TfR1 antibodies and human and cynomolgus monkey TfR1
[0351] Antibody antigen <![CDATA[Chi 2 (RU 2 )]]> ka(1 / Ms) kd(1 / s) KD(M) Rmax(RU) TIB-219 MouseTfR1 3.73E-02 1.34E+05 1.06E-04 7.87E-10 67.2
[0352] Example 6 Coupling of modified siRNA and antibody
[0353] Conjugation of wild-type antibodies and siRNA
[0354] The coupling of wild-type antibodies and siRNA adopts a random coupling process. Specifically, the interchain disulfide bonds of the antibody are first reduced and conjugated to the linker-siRNA activated by the maleimide (SMCC) linker at the 5' end of the siRNA sense chain to finally form an antibody-siRNA conjugate. For the linker-siRNA used in this experiment, the single chain was fully assembled on the solid phase using standard phosphoramidite chemistry and purified using HPLC, using base, sugar and phosphate modifications well described in the field of RNAi to optimize the stability of the duplex. Among them, the 5' end of the siRNA sense chain contains a C6-NH2 conjugation handle, which is connected to the siRNA sense chain through a phosphodiester on the terminal base, see Figure 18 In some embodiments, the conjugation process is generally applicable to different antibodies and sequences, and differences in antibody targets or sequences and differences in nucleic acid sequences often do not result in significant changes in the conjugation process.
[0355] Step 1: Reduce the antibody with TCEP
[0356] The antibody was buffer exchanged with 25mM Tris buffer (pH 8) to a concentration of 10mg / mL. 0.8 equivalents of TCEP in the same buffer were added to this solution and incubated at room temperature for 2 hours. The reaction solution was then exchanged by ultrafiltration into 25mM Tris buffer (pH 8) containing 2mM EDTA, and SMCC-siRNA (3 equivalents) was added and combined, and reacted at 22°C for 3 hours. The reaction mixture was analyzed by analytical SAX column chromatography to analyze the antibody-siRNA conjugate and unreacted antibody and siRNA.
[0357] Step 2: Purification and analysis
[0358] The crude reaction mixture was purified by AKTA Pure FPLC using anion exchange chromatography (SAX) method-1 (Table 34). Fractions containing the antibody-siRNA conjugate were isolated, concentrated, and buffer exchanged with pH 7.4 PBS.
[0359] The purity of the conjugate was assessed by analytical HPLC using SAX Method-2 (Table 35).
[0360] Table 34 Anion exchange chromatography method (SAX)-1
[0361]
[0362] Table 35 Anion Exchange Chromatography Method (SAX)-2
[0363]
[0364] Conjugation of cysteine-mutant antibodies and siRNA
[0365] The coupling of cysteine mutant antibodies and siRNA adopts a site-specific coupling process. Specifically, the antibody cysteine site-specific coupling site (depending on the specific antibody sequence, for example, S239C, S238C, S245C, etc. can be used) and the interchain disulfide bond are first reduced, and then the interchain disulfide bond is oxidized and the reduced state of the cysteine site is retained, and finally conjugated with the linker-siRNA activated by the SMCC linker at the 5' end of the siRNA sense chain to form an antibody-siRNA conjugate. For the linker-siRNA used in this experiment, the single chain was fully assembled on the solid phase using standard phosphoramidite chemistry and purified using HPLC, using base, sugar and phosphate modifications that are well described in the RNAi field to optimize the stability of the duplex. Among them, the 5' end of the siRNA sense chain contains a C6-NH2 conjugation handle, which is connected to the siRNA sense chain through the phosphodiester on the terminal base. Figure 18 In some embodiments, the conjugation process is generally applicable to different antibodies and sequences, and differences in antibody targets or sequences, as well as differences in nucleic acid sequences, do not often result in significant changes in the conjugation process.
[0366] Step 1: Reduce the antibody with TCEP
[0367] The antibody was buffer exchanged with 25mM Tris buffer (pH 8) to a concentration of 10mg / mL. 100 equivalents of DTT in the same buffer were added to the solution and incubated at room temperature for 16 hours. The reaction solution was then exchanged by ultrafiltration into 25mM Tris buffer (pH 8) with 2mM EDTA, and 20 equivalents of DHAA were added and reacted at room temperature (RT) for 2 hours. The resulting reaction mixture was passed through a desalting column to remove excess DHAA and combined with SMCC-siRNA (0.8 equivalents) and reacted at 22°C for 2 hours. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugates as well as unreacted antibody and siRNA.
[0368] Step 2: Purification and analysis
[0369] The crude reaction mixture was purified by AKTAPure FPLC using anion exchange chromatography (SAX) method-1 (Table 34). Fractions containing the antibody-siRNA conjugate were isolated, concentrated, and buffer exchanged with pH 7.4 PBS.
[0370] The purity of the conjugate was assessed by analytical HPLC using SAX Method-2 (Table 35).
[0371] The analytical data of the conjugates synthesized in this example are shown in Table 36, with HPLC retention time (RT) in minutes and percent purity determined by chromatographic peak area. The molecular analytical data of the purified representative antibody-siRNA conjugates are shown in Table 36, with purity above 97%. Figure 19-26 As shown, the antibody selected was TIB-219-S245C. This example is a verification example, so the specific sequence content is omitted.
[0372] Table 36 Design and analysis results of antibody-siRNA conjugates
[0373] Conjugate DAR SAX retention time (min) % Purity (based on peak area) CGBC-1001 2 8.338 99 CGBC-1002 2 8.230 98 CGBC-1004-1 1 7.903 99 CGBC-1004-2 2 8.333 97 CGBC-1005-1 1 7.931 99 CGBC-1005-2 2 8.341 98 CGBC-1012-1 1 7.982 100 CGBC-1012-2 1 8.413 99
[0374] Example 7 Study on knockdown of HPRT in wild-type CD-1 mouse muscle by antibody-siRNA conjugate (validation)
[0375] The experimental design and dosage are shown in Table 37. The HPRT siRNA used to synthesize the antibody-siRNA conjugates in the experiment is shown in Table 38. CGBC-1001 was synthesized using the antibody TIB-219 in Example 5 and the wild-type antibody and siRNA coupling process in Example 6; CGBC-1002 was synthesized using the antibody TIB-219-S245C in Example 5 and the cysteine mutant antibody and siRNA coupling process in Example 19.
[0376] Mice were given PBS controls and antibody-siRNA conjugates by intravenous injection, and the animals were euthanized after 7 and 14 days, respectively. Tissue samples including myocardium, diaphragm, gastrocnemius, liver, kidney, and brain were harvested and stored in -80 ° C after overnight treatment with RNAlater. Comparative qPCR was used to determine mRNA knockdown in target tissues. Total RNA was extracted from the tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. GADPH was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, in which the difference (ΔCt) between the target gene Ct value and the GADPH Ct value was calculated, and then further normalized relative to the PBS control group by taking the secondary difference (ΔΔCt).
[0377] Table 37 Study on knockdown of HPRT by antibody-siRNA conjugates in wild-type CD-1 mouse muscle
[0378]
[0379]
[0380] Table 38 HPRT siRNA sequence design
[0381]
[0382] Modification description: m = 2'-O-methyl; i2F = 2'-fluoro; gn = glycol nucleic acid; * / = phosphorothioate linkage; / = phosphodiester linkage.
[0383] The experimental results showed that the antibody-siRNA conjugate showed dose-dependent knockdown of the target gene in the myocardium, diaphragm and gastrocnemius muscles, but no significant knockdown of the target gene was shown in the liver, kidney and brain tissues. At the same time, compared with the randomly coupled CGBC-1001, CGBC-1002 synthesized by the site-specific coupling process has certain advantages in onset time and maximum knockdown efficiency ( Figures 27-30 ).
[0384] Example 8 Study on knockdown of DMPK in wild-type CD-1 mouse muscle by antibody-siRNA conjugate
[0385] For experimental design and dosage, see Table 39. All antibody-siRNA conjugates were synthesized using the antibody TIB-219-S245C described in Example 5 and the cysteine-mutant antibody and siRNA coupling process described in Example 6. The DMPK siRNAs used in the synthesis of the antibody-siRNA conjugates are shown in Table 40. siRNA ID#0296 was used to synthesize CGBC-1004-1 and CGBC-1004-2, and siRNA ID#0297 was used to synthesize CGBC-1005-1 and CGBC-1005-2.
[0386] Mice were given PBS control and antibody-siRNA conjugates by intravenous injection, and the animals were euthanized after 7 and 14 days, respectively. Plasma and different tissue samples, including myocardium (heart), diaphragm (diaphragm) and gastrocnemius (gastro), were harvested and stored at -80°C after overnight treatment with RNAlater. Comparative qPCR assays were used to determine mRNA knockdown in target tissues. Total RNA was extracted from the tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. GADPH was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, in which the difference (ΔCt) between the target gene Ct value and the GADPH Ct value was calculated, and then further normalized to the PBS control group by taking the quadratic difference (ΔΔCt). Bioinformatics is the same as the in vitro evaluation method 5 of siRNA.
[0387] Table 39: Study on knockdown of DMPK by antibody-siRNA conjugates in wild-type CD-1 mouse muscle
[0388]
[0389] Table 40 DMPK siRNA sequence design
[0390]
[0391] Modification description: m = 2'-O-methyl; i2F = 2'-fluoro; gn = glycol nucleic acid; * / = phosphorothioate linkage; / = phosphodiester linkage; VP = 5-(E)-VP vinyl phosphate modified nucleic acid.
[0392] Pharmacokinetic experimental methods primarily use SL-PCR to analyze siRNA concentrations in plasma and tissues. Plasma and various tissue samples, including quadriceps and liver, are harvested and snap-frozen in liquid nitrogen. Tissues are homogenized and digested with proteinase K, and the supernatant is diluted and analyzed by SL-PCR. SL-PCR primarily consists of a first step of reverse transcription using stem-loop primer sequences, followed by a second step of quantification using quantitative PCR. The reaction system is shown in Tables 41-42, and the primer sequences are shown in Table 43.
[0393] Table 41 SL-PCR reverse transcription reaction system
[0394]
[0395]
[0396] Table 42 SL-PCR qPCR reaction system
[0397] PCR reaction mixture components Volume required for 1 reaction system (μL) Universal PCR Master Mix 2x 5 Forward primer (10 μM) 1.5 Reverse primer (10 μM) 0.7 Probe (10 μM) 0.2 cDNA 2 H2O 0.6 Total 10
[0398] Table 43 Primer sequences for SL-PCR in mouse experiments
[0399]
[0400] For both target tissue mRNA knockdown and pharmacokinetic assays, a standard curve of Ct versus log [concentration] is required. For target tissue mRNA knockdown, the standard curve is prepared using a serial dilution of freshly extracted cDNA from the tissue. For pharmacokinetic assays, the standard curve is prepared by diluting the antibody-siRNA conjugate compound and adding it to a blank mouse tissue homogenate. Aside from the above steps, the actual sample processing steps remain the same as those for the standard curve. Amplification efficiency for the standard curve must be maintained between 90% and 110%.
[0401] The experimental results showed that the antibody-siRNA conjugate showed target gene knockdown in myocardium, diaphragm and gastrocnemius muscles, but no significant target gene knockdown was shown in liver, kidney and brain tissues. Compared with the antibody-siRNA conjugate of DAR2, the DAR1 molecule showed a stronger target gene knockdown effect ( Figures 31-32 At the same time, the design of 5-(E)-VP significantly improved the knockdown efficiency of the antibody-siRNA conjugate in the myocardium, diaphragm and gastrocnemius muscles ( Figure 32 ).
[0402] The antibody-siRNA conjugate showed a plasma clearance rate and muscle-specific siRNA delivery efficiency far lower than that of traditional siRNA drugs. 14 days after administration, the siRNA in the plasma could still be detected by SL-PCR ( Figures 33-34 ), which is significantly different from the plasma half-life of traditional siRNA drugs of several hours, indicating that the antibody-siRNA conjugate prolongs the plasma half-life of siRNA. In terms of tissue distribution, the antibody-siRNA conjugate achieves more muscle siRNA distribution, and the muscle siRNA is higher than or close to the distribution of liver siRNA, proving the muscle targeting effect of TfR1 antibody. In terms of molecular design, the DAR1 molecule shows higher blood concentration and more muscle enrichment than the DAR2 molecule. The design of 5-(E)-VP also significantly improves the enrichment of the antibody-siRNA conjugate in muscle ( Figure 35 ).
[0403] Example 9 Pharmacokinetic Study of Antibody-siRNA Conjugates in Cynomolgus Monkeys
[0404] The experimental design and dosage are shown in Table 44. The DMPK siRNA used to synthesize the antibody-siRNA conjugates in the experiment is shown in Table 45. The antibodies were synthesized using the antibody Var2iii-S238C in Example 18 and the cysteine mutant antibody and siRNA coupling process in Example 19.
[0405] Antibody-siRNA conjugates were administered intravenously to cynomolgus monkeys. Plasma samples were collected before and 3, 6, and 12 hours after administration, and on days 1, 3, 7, 14, 28, and 42 after administration. Gastrocnemius muscle samples were collected by muscle puncture before and 3, 7, 14, 28, 56, and 84 after administration for pharmacokinetic studies. The standard curve was drawn using the same method as in Example 20 and is not described in detail here. The primer sequences are shown in Table 46.
[0406] Table 44 In vivo studies of antibody-siRNA conjugates in cynomolgus monkeys
[0407]
[0408] Table 45 DMPK siRNA sequence design
[0409]
[0410]
[0411] Modification description: m = 2'-O-methyl; i2FN = 2'-fluoro; gn = glycol nucleic acid; * / = phosphorothioate linkage; / = phosphodiester linkage; VpN = 5-(E)-VP vinyl phosphate modified nucleic acid.
[0412] Table 46 Primer sequences for SL-PCR in cynomolgus monkey experiments
[0413]
[0414] The experimental results showed that the antibody-siRNA conjugate exhibited a typical two-compartment model in cynomolgus monkey plasma and linear PK at two doses. The distribution half-life at the high dose was 27.6 hours and the elimination half-life was 279 hours. In the low-dose group, only the distribution phase curve was accurately recorded due to the detection limit of the method ( Figure 36 In terms of tissue distribution, the antibody-siRNA conjugate was enriched in the gastrocnemius muscle of cynomolgus monkeys and reached a Cmax of more than 300 pmol / g on the third day after administration. As a pharmaceutical active ingredient, the clinically effective dose is 0.1-20 mg / kg, more preferably 1-10 mg / kg. The elimination half-life of the antibody-siRNA conjugate in the gastrocnemius muscle of cynomolgus monkeys was 239 hours. During the 84 days before the end of the experiment, the siRNA concentration in the gastrocnemius muscle was always higher than 1 pmol / g ( Figure 37 ).
[0415] The above experiments fully demonstrated that the antibody-siRNA conjugate can work in mice.
[0416] Example 10 In vitro activity of antibody-siRNA conjugates
[0417] The antibody-siRNA conjugate used in the experiment was the same as that in Example 23. The purpose of the experiment was to demonstrate that the antibody-siRNA conjugate could be internalized by human muscle cells in vitro without the aid of lipofectamine and produce significant target gene knockdown. The specific experimental methods are as follows: RD human rhabdomyosarcoma cell line (4201HUM-CCTCC00295) was cultured in DMEM (Gibco) containing 10% fetal bovine serum (Gibco). The antibody-siRNA conjugate was diluted to a maximum dose of 10 mM. The conjugate was transfected at final siRNA concentrations of 200, 100, 10, 1, and 0.1 nM. 24 hours before administration, cells were seeded into 48-well culture plates at 10,000 cells per well. The conjugate was added to the wells of the 48-well plate. PBS was added to some wells as an additional negative control. The cells were incubated at 37°C and 5% CO2 for 72 hours. The culture medium was removed from the wells and 150 mL of Trizol (Life) was added. The plate was frozen at -80°C overnight or longer before analysis. RNA was isolated using the Direct-zol-96 RNA kit (Zymo Research) according to the instructions of the manufacturer. RNA was reverse transcribed into cDNA using ReverTra Ace™ qPCR RT Master Mix (TOYOBO) according to the instructions of the manufacturer, and the cDNA samples were evaluated by qPCR using TaqMan human gene expression probes (ThermoFisher). % mRNA was calculated using a standard 2 -ΔΔCT For calculations, PBS-treated cells were set as 100% expression. All experiments were performed in triplicate. Primer information is the same as for siRNA in vitro evaluation method 1.
[0418] The experimental results showed that CGBC-1012 can enter the RD cell line under in vitro co-incubation conditions without the assistance of lipofectamine and exert a dose-dependent knockdown effect on the target gene. The knockdown effect of the antibody-siRNA conjugate reached saturation at a concentration of 1nM. The maximum knockdown efficiency of the antibody-siRNA conjugate for DAR2 was approximately 40%, while the maximum knockdown efficiency of the molecule for DAR1 was approximately 50% ( Figure 38 ).
[0419] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A polynucleotide molecule that binds to the mRNA of the DMPK gene, characterized in that: The polynucleotide molecule includes at least 12 consecutive nucleotides of any one nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 200, and SEQ ID NO: 281 to SEQ ID NO: 490, or a nucleotide sequence complementary thereto, or a sequence that differs from the at least 12 consecutive nucleotides by no more than 3 nucleotides, or a sequence complementary thereto, and the nucleotides are in a modified or unmodified state.
2. The polynucleotide molecule according to claim 1, characterized in that The polynucleotide molecule is complementary to at least 8 consecutive nucleotides of the target sequence of DMPK.
3. The polynucleotide molecule according to claim 1, characterized in that The polynucleotide molecule mediates RNA interference against the DMPK, thereby modulating muscular dystrophy or myotonic dystrophy in the subject.
4. The polynucleotide molecule according to claim 1, characterized in that The length of the polynucleotide molecule is 8 to 50 nucleotides, preferably 10 to 30 nucleotides, and more preferably 15 to 25 nucleotides.
5. The polynucleotide molecule according to claim 1, wherein The polynucleotide molecule is a single-stranded oligonucleotide or a double-stranded oligonucleotide.
6. The polynucleotide molecule according to claim 1, wherein The polynucleotide molecule comprises one or more modified nucleotides, one or more modified internucleotide linkages, or one or more inverted abasic portions.
7. The polynucleotide molecule according to claim 6, characterized in that The modified nucleotides are 2' modified nucleotides.
8. The polynucleotide molecule according to claim 7, characterized in that The 2'-modified nucleotides include 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-O-dimethylaminoethoxyethyl (2'-O-DMAEOE) or 2'-O-N-methylacetamido (2'-O-NMA) modified nucleotides.
9. The polynucleotide molecule according to claim 7, characterized in that The 2' modified nucleotides include locked nucleic acid (LNA) or ethylene nucleic acid (ENA) or glycol nucleic acid (GNA).
10. The polynucleotide molecule according to claim 6, characterized in that The modified internucleotide linkages include phosphorothioate linkages, phosphorodithioate linkages, methylphosphonate linkages, phosphotriester linkages, or amide linkages.
11. The polynucleotide molecule according to claim 10, characterized in that The modified internucleotide linkages include phosphorothioate linkages or phosphorodithioate linkages.
12. The polynucleotide molecule according to claim 6, characterized in that The inverted abasic portion is at at least one end.
13. The polynucleotide molecule according to claim 6, characterized in that The polynucleotide molecule includes at least 12 consecutive nucleotides of any one of the nucleotide sequences of SEQ ID NO:201 to SEQ ID NO:280, SEQ ID NO:491 to SEQ ID NO:580, and SEQ ID NO:589 to SEQ ID NO:620, or a sequence that differs from the at least 12 consecutive nucleotides by no more than 3 nucleotides, or a sequence complementary thereto.
14. The polynucleotide molecule according to claim 6, characterized in that The polynucleotide molecule includes a double-stranded structure of an antisense strand and a sense strand.
15. The polynucleotide molecule according to any one of claims 1 to 14, characterized in that The antisense strand includes any one of SEQ ID NOs: 101-200, SEQ ID NOs: 221-240, SEQ ID NOs: 261-280, SEQ ID NOs: 386-490, SEQ ID NOs: 536-580, or SEQ ID NOs: 589-620, or a sequence that differs therefrom by no more than 3 nucleotides.
16. The polynucleotide molecule according to claim 1, characterized in that The positive strand includes any one of SEQ ID NO: 1-100, SEQ ID NO: 201-220, SEQ ID NO: 241-260, SEQ ID NO: 281-385 or SEQ ID NO: 491-535, or a sequence that differs therefrom by no more than 3 nucleotides.
17. A conjugate comprising the polynucleotide molecule of any one of claims 1 to 16, and further comprising an antibody, an antibody fragment, or an antigen-binding sequence.
18. The conjugate according to claim 17, characterized in that The polynucleotide molecule and the antibody or antigen binding sequence are coupled to each other by random coupling or site-specific coupling.
19. The conjugate according to claim 18, characterized in that The antibody, antibody fragment or antigen binding sequence is used to bind to the anti-transferrin receptor.
20. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the polynucleotide molecule according to any one of claims 1 to 16 or the conjugate according to any one of claims 17 to 19, and is used for treating muscular dystrophy or myotonic dystrophy.
21. The pharmaceutical composition according to claim 20, characterized in that The pharmaceutical compositions are formulated for intravenous, subcutaneous, parenteral, oral, intranasal, buccal, rectal or transdermal administration.
22. The pharmaceutical composition according to claim 20, characterized in that The pharmaceutical composition further includes a pharmaceutically acceptable excipient.
23. The pharmaceutical composition according to claim 20, characterized in that The pharmaceutical composition also includes a therapeutic agent, which includes a small molecule drug, an antibody, an antibody fragment and / or a vaccine.
24. The pharmaceutical composition according to claim 23, characterized in that The antibodies include anti-transferrin receptor antibodies.
25. Use of the polynucleotide molecule according to any one of claims 1 to 16 or the conjugate according to any one of claims 17 to 19 for preparing a medicament, characterized in that: The medicament is used for reducing the expression of DMPK mRNA, or for preventing and / or treating muscular atrophy or myotonic dystrophy.
26. The use according to claim 25, characterized in that The muscle atrophy includes muscle atrophy associated with insulin deficiency, chronic renal failure, congestive heart failure, chronic respiratory disease, chronic infection, fasting, denervation, sarcopenia or glucocorticoid treatment.
27. The use according to claim 26, characterized in that The muscular dystrophy includes muscular dystrophy associated with myotonic dystrophy type 1 or myotonic dystrophy.
Citation Information
Patent Citations
Anti-transferrin receptor antibodies and uses thereof
US10913800B2
Improvement in forge-bonnets
US114115A
Compositions and methods of treating muscle dystrophy
US20210299266A1