Primer of a molecular marker of mep1b gene associated with average daily gain trait of pigs and application thereof

By detecting the SNP sites of the pig MEP1B gene and using PCR amplification and Sanger sequencing technology, the problem of assessing the average daily weight gain trait in pigs was solved, thus improving breeding efficiency and economic benefits.

CN120648820BActive Publication Date: 2026-03-27NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-15
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately assess the average daily weight gain trait in pigs, which affects breeding efficiency and economic benefits.

Method used

A molecular marker for the MEP1B gene associated with average daily weight gain in pigs and its primers are provided. The SNP genotypes of pigs are detected by PCR amplification and Sanger sequencing, and the significantly associated MEP1B gene molecular markers are screened for use in breeding selection.

Benefits of technology

It enables rapid and accurate identification of the average daily weight gain trait in pigs, improving breeding efficiency and uniformity, reducing breeding costs, and enhancing the growth performance and economic benefits of pig herds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648820B_ABST
    Figure CN120648820B_ABST
Patent Text Reader

Abstract

The application relates to a primer of a MEP1B gene molecular marker related to a pig average daily weight gain trait and application thereof, and belongs to the technical field of biology. The MEP1B gene molecular marker of the application is located at the 116042900th base of chromosome No. 6 of a pig reference genome Sscrofa11.1 version 6, and has C / T polymorphism; the average daily weight gain of a pig with a TT genotype at the site is significantly higher than that of a pig with a CC genotype. The application uses forward and reverse primers to amplify a segment containing the above-mentioned molecular marker site, and Sanger sequencing is performed on the amplification product, so that the genotype of an individual can be quickly and accurately identified; the molecular marker can be used as a genetic marker for pig breeding, and pigs of a proper weight can be selected and bred; the pig average daily weight gain trait can be efficiently and accurately detected, and the pig average daily weight gain trait has important value for pig breeding and production.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a primer of a MEP1B gene molecular marker related to the average daily gain trait of pigs and an application thereof, and belongs to the technical field of biotechnology. BACKGROUND

[0002] In modern pig farming, average daily gain (ADG) and age at 100 kg (AGE) are important indicators for evaluating pig growth performance and economic benefits. High ADG means that the pig population can reach the target weight in a shorter time, shorten the feeding cycle, reduce feed and labor costs, and thus improve the profitability of pig farms. In order to achieve this goal, pig farms need to optimize feed formulations, strengthen scientific management, and ensure the health status of the pig population. AGE as a measure of the growth cycle directly affects production efficiency, meat quality and carcass value. Reasonable AGE helps to maintain the ideal growth rate and high-quality meat of pigs. If AGE is too long, it may lead to a slowdown in growth rate and a decrease in meat quality, affecting carcass value; while too short may sacrifice meat quality. Therefore, fine feeding management and effective disease prevention and control are crucial to ensure the reasonableness of AGE.

[0003] By optimizing feeding management, improving feed utilization and breeding excellent varieties, pig farms can improve ADG and control AGE at the same time. This not only improves overall profitability, but also meets the market demand for high-quality pork. These measures lay a solid foundation for the transformation and sustainable development of the pig industry, and promote the industry towards high efficiency, environmental protection and sustainability.

[0004] Therefore, using molecular markers to accurately identify genotypes related to average daily gain and applying them to early breeding selection can speed up the breeding cycle, reduce time and feeding costs, and improve resource utilization. SUMMARY

[0005] The purpose of the present application is to overcome the defects in the prior art and provide a MEP1B gene molecular marker related to the average daily gain trait of pigs and an application thereof, which can quickly and accurately evaluate the average daily gain of pigs at different growth stages.

[0006] MEP1B gene is related to weight gain. Studies have shown that MEP1B plays an important regulatory role in increasing body weight and is related to pig growth and development, which indicates that MEP1B gene may be closely related to body weight.

[0007] The present application measures the average daily gain of pigs, uses second-generation sequencing technology for whole genome SNP genotyping, and screens for a MEP1B gene molecular marker significantly related to the average daily gain trait of pigs through whole genome association analysis, providing a new gene and molecular marker resource for the selection of the average daily gain trait of pigs.

[0008] The present application solves the technical problems by the following technical solutions: first, a MEP1B gene molecular marker related to the average daily weight gain of pigs is provided, the nucleotide sequences of the SNP primers corresponding to the molecular marker are shown in SEQ ID NO: 1 and SEQ ID NO: 2, the molecular marker site is located at the 116042900th base of chromosome 6 of the pig reference genome Sscrofa11.1 version 6, and the base mutation is C or T. The sequence is shown in SEQ ID NO: 3 or SEQ ID NO: 4 at the 250th base.

[0009] The present application further provides an application of a MEP1B gene molecular marker related to the average daily weight gain of pigs, and the SNP primers are used for detecting the average daily weight gain of pigs. Specifically, the method for detecting the SNP genotype related to the average daily weight gain of pigs by PCR amplification combined with Sanger sequencing detection is applied, which comprises the following steps:

[0010] First step, providing a DNA sample of a pig to be tested, and performing PCR amplification on the DNA sample with a DNA-specific primer pair designed for the MEP1B gene molecular marker to obtain an amplification product. The DNA sample of the pig to be tested contains the SNP molecular marker of the 116042900th base of chromosome 6 of the pig.

[0011] Second step, performing Sanger sequencing on the PCR product.

[0012] Third step, judging the genotype of the SNP molecular marker of the 116042900th base of chromosome 6 of the pig according to the sequencing result of the second step.

[0013] The deoxyribonucleotide sequence of the DNA-specific primer pair in the first step is:

[0014] Upstream primer: 5'- ATTTGCCAGGGACCAGATCA-3' (SEQ ID NO: 1)

[0015] Downstream primer: 5'- AAAAGCTTCTGTTCCCACTTTG -3' (SEQ ID NO: 2)

[0016] The length of the amplification product in the first step is 204 bp, and it contains the 116042900th base of chromosome 6 of the pig.

[0017] The final concentration of the reaction system (25 μl) is:

[0018] DNA of the pig to be tested 50 ng

[0019] 2 x Accurate Taq Master Mix 12.5 μl

[0020] Upstream primer 1 μl

[0021] Downstream primer 1 μl

[0022] Sterilized water Supplement to 25 μl.

[0023] The reaction conditions of the PCR amplification are as follows: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 60sec, a total of 30 cycles; 72℃ extension for 2min; 4℃ preservation.

[0024] In the third step, the judgment standard is that the average daily weight gain of the individual with T / T genotype at the SNP site is higher.

[0025] The present application finds that the average daily weight gain of pigs with a specific genotype at a specific site of the MEP1B gene is significantly higher than that of individuals with other genotypes. Specifically, the average daily weight gain of pigs with T / T genotype is higher than that of individuals with T / C and C / C genotypes, and the average daily weight gain of pigs with T / C genotype is higher than that of individuals with C / C genotype. This finding provides a new genetic marker and breeding method for pig breeding and production.

[0026] In order to realize rapid and accurate identification of the average daily weight gain of pigs, the present application uses the genomic DNA of the pig to be tested as a template and uses specific primers to perform PCR amplification. The specific primers are designed according to the SNP site in the MEP1B gene that is related to the target trait, and can accurately amplify a DNA fragment containing the SNP site. Subsequently, the PCR amplification product is subjected to Sanger sequencing, and the SNP molecular marker genotype of the pig MEP1B gene can be determined by the sequencing results.

[0027] In breeding practice, according to the breeding goal, the breeder can eliminate individuals with T / C and C / C genotypes and retain individuals with T / T genotype, thereby breeding a pig population with higher average daily weight gain. This method is not only efficient and fast, but also can significantly improve the average daily weight gain uniformity of the pig population, and provides a scientific basis for early breeding of pigs.

[0028] In addition, the detection method disclosed by the present application is simple and easy to operate, and can be widely carried out under laboratory conditions, providing great convenience for pig breeding and production practice. This finding not only has important value for pig breeding, but also provides a useful reference and reference for genetic improvement of other livestock. In addition, the detection method disclosed by the present application is simple and easy to operate, and can be carried out in the laboratory. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 is a longitudinal trait association analysis Manhattan plot of the average daily weight gain of pigs in four periods.

[0030] Figure 2 are the results of Sanger sequencing of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0031] The following examples are suitable for the selection of pigs.

[0032] EXAMPLE

[0033] This example measures the average daily weight gain of 500 Large White pigs, uses second-generation sequencing technology for whole genome SNP genotyping, and filters the MEP1B gene molecular marker significantly related to average daily weight gain through whole genome association analysis. The results are shown in Table 1. Figure 1

[0034] This example identifies and applies the MEP1B gene molecular marker related to the average daily weight gain of pigs through the following experiments.

[0035] 1. Phenotype determination and genotype detection

[0036] (1) Experimental materials and average daily weight gain phenotype determination

[0037] 500 Large White pigs were selected as experimental animals and raised under the same feeding conditions. Throughout the process, free diet and drinking water were used, and the average daily weight gain of the 500 pigs was recorded as the phenotype data of the average daily weight gain of pigs.

[0038] (2) Extraction of genomic DNA

[0039] ① Take 25 mg of ear tissue and add it to a 1.5 ml centrifuge tube. Add 400 μl Buffer Digestion and mix well. Incubate at 65°C for 1 h until the cells are completely lysed.

[0040] ② Add 20 μL Proteinase K solution and mix well. Incubate in a 56°C water bath overnight.

[0041] ③ Add 500 μl Buffer PA and mix well. Place in a -20°C refrigerator for 5 min.

[0042] ④ Centrifuge at 10,000 rpm for 5 min at room temperature. Transfer the supernatant (500-550 μl) to a new 1.5 ml centrifuge tube.

[0043] ⑤ Add an equal volume of isopropanol and mix well by inverting 5-8 times. Place at room temperature for 2-3 min. Centrifuge at 10,000 rpm for 5 min at room temperature and discard the supernatant.

[0044] ​(6) Add 1 ml of 75% ethanol, invert to rinse 1-3 min, centrifuge at 10,000 rpm for 2 min, discard the supernatant.

[0045] (7) Repeat step 6.

[0046] (8) Open the cap and invert at room temperature for 5-10 min until the residual ethanol is completely volatilized.

[0047] (9) The obtained DNA is dissolved with 50-100 μl of TE Buffer. The extracted DNA can be immediately subjected to the next step or stored at -20°C.

[0048] (10) Determine the concentration, and after detecting the mass and concentration by spectrophotometry, dilute the concentration to 50 ng / μl and store at -20°C for standby.

[0049] (3) PCR amplification

[0050] The fragment containing the base at position 116042899 of chromosome 6 is amplified using the above extracted genomic DNA as a template.

[0051] Upstream primer: 5'- ATTTGCCAGGGACCAGATCA-3' (SEQ ID NO: 1)

[0052] Downstream primer: 5'- AAAAGCTTCTGTTCCCACTTTG -3' (SEQ ID NO: 2)

[0053] The final concentration (25 μl) of the reaction system is:

[0054] DNA to be tested 50 ng

[0055] 2 x Accurate Taq Master Mix 12.5 μl

[0056] Upstream primer 1 μl

[0057] Downstream primer 1 μl

[0058] Sterile water supplemented to 25 μl.

[0059] The reaction conditions for PCR amplification are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; storage at 4°C; take 10 μl for agarose detection. The amplification product is a single band with a length of 450 bp, and contains the SNP molecular marker of the base at position 116042900 of pig chromosome 6.

[0060] the sequence of the amplification product is set forth in SEQ ID NO: 3

[0061] AGGAATCCTTTGGTACCTCTGCAATCACATTCCAAAATGTGGCCTTCCCTGGCAGGCAGCCTCAATTCCTTTAGGACAGTATAAATGAACAAGCTCCAGATTTGCCAGGGACCAGATCACAGCATCATTTAATTATTTTGAGCTCTGCCCTAATTGTGTTTCACGTTACCTGTGATTCCCTACCACCAGAAGCTATGATGATGTTAAACATAATCCATGAATATAACTTGCTTTTTCAGATGACGGAACCTATTTTTGGGACAGGCCTTCCAAAGTGGGAACAGAAGCTTTTTTCCCAAATGGAACTCAATTTAAAAGAAGTAGAGGCTATGGATCCAGTTCCTTTATAACCTATGAGAGGCTGAAGAGCAGGGATTTTATCAAAGGAAATGATGTTTACATCCTACTGACAGTGGAAGGTATGTCAATAAAAATAGTTTCATCTAAGCT,

[0062] AGGAATCCTTTGGTACCTCTGCAATCACATTCCAAAATGTGGCCTTCCCTGGCAGGCAGCCTCAATTCCTTTAGGACAGTATAAATGAACAAGCTCCAGATTTGCCAGGGACCAGATCACAGCATCATTTAATTATTTTGAGCTCTGCCCTAATTGTGTTTCACGTTACCTGTGATTCCCTACCACCAGAAGCTATGATGATGTTAAACATAATCCATGAATATAACTTGCTTTTTCAGATGACGGAACTTATTTTTGGGACAGGCCTTCCAAAGTGGGAACAGAAGCTTTTTTCCCAAATGGAACTCAATTTAAAAGAAGTAGAGGCTATGGATCCAGTTCCTTTATAACCTATGAGAGGCTGAAGAGCAGGGATTTTATCAAAGGAAATGATGTTTACATCCTACTGACAGTGGAAGGTATGTCAATAAAAATAGTTTCATCTAAGCT.

[0063] (4) Sanger sequencing and genotyping

[0064] The PCR products of each sample were respectively subjected to Sanger sequencing, and the sequencing peak graphs of different genotypes obtained are shown in Figure 2

[0065] (5) Genotype typing of pig genome 60K SNP chip and whole genome association analysis

[0066] The pig whole genome genotyping was performed according to the company standard process. The "Zhongxin No. 1" pig 50K SNP chip was used for SNP genotype detection of the pig individual with average daily gain measurement record. The detection results of all SNP markers were subjected to quality control. The whole genome association analysis detected that the significant SNPs on the genome level were concentrated on the pig chromosome 6.

[0067] 2. Correlation analysis

[0068] 500 Large White pig individuals with clear average daily gain phenotype record were selected, and the average daily gain was recorded. The ANOVA test function of R 4.2 statistical plotting software was used for statistical test, and the genotype and average daily gain trait of the test pig population were statistically tested by selecting the average value comparison mode between each other. P < 0.05 indicates significant difference. The results show that the average value of the average daily gain of the T / T genotype individual is 832 g, which is higher than 760 g of the T / C genotype and 753 g of the C / C genotype individual (P < 0.05). The pig MEP1B gene molecular marker is significantly correlated with the average daily gain trait, as shown in Table 1. According to the actual breeding goal, the T / T genotype individual can be selected to select the pig with larger average daily gain, improve the overall average daily gain and uniformity, and improve the breeding efficiency.

[0069] Table 1 Genotype frequency of MEP1B gene

[0070] In addition to the above implementations, the present application can also have other implementations. Any technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope required by the present application.​

Claims

1. An application of a primer for detecting a molecular marker of the MEP1B gene associated with the average daily weight gain trait in pigs, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO:1 and SEQ ID NO:

2. The molecular marker site is located at base 116042900 on chromosome 6 of the porcine reference genome Sscrofa 11.1 version, with a base mutation of C or T. The primers were used to detect the average daily weight gain trait in large white pigs. The detection method included the following steps. The first step is to perform PCR amplification on the DNA sample of the pig to be tested using the SNP primers shown in SEQ ID NO:1-2 to obtain an amplification product containing the base at position 116042900 of the pig chromosome 6. The second step is to perform Sanger sequencing on the PCR products. The third step is to determine the SNP molecular marker genotype at position 116042900 on chromosome 6 of the pig reference genome Sscrofa 11.1 based on the sequencing results of the second step. The criteria for determination are that pigs with the T / T genotype at the SNP site have a higher average daily weight gain than individuals with the T / C and C / C genotypes, and pigs with the T / C genotype have a higher average daily weight gain than individuals with the C / C genotype.

2. The application of the primers for detecting the MEP1B gene molecular marker associated with the average daily weight gain trait in pigs according to claim 1, characterized in that: In the first step, the PCR reaction system is calculated in 25 μl units, and the system is as follows: 50 ng of pig DNA to be tested 2 x Accurate Taq Master Mix 12.5μl upstream primer 1 μl 1 μl of downstream primer Add sterile water to a final volume of 25 μl.

3. The application of the primers for detecting the MEP1B gene molecular marker associated with the average daily weight gain trait in pigs according to claim 2, characterized in that: The PCR amplification reaction conditions in the first step are: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; and storage at 4℃.