Anti-c5 antibod / c5 irna coformulations and

Abstract

The present disclosure provides a co-formulation comprising an antibody that specifically binds to C5 and a C5 iRNA, the C5 iRNA being a glycoconjugate comprising a ligand having a terminal N-acetylgalactosamine (GalNAc) residue and / or an N-acetylglucosamine (GlcNAc) residue. The present disclosure provides a co-formulation comprising an antibody that specifically binds to C5 and a C5 iRNA, the C5 iRNA being a glycoconjugate comprising a ligand having a terminal N-acetylgalactosamine (GalNAc) residue and / or an N-acetylglucosamine (GlcNAc) residue. Also provided are methods for reducing the degradation of a glycoconjugate RNA by a beta-hexosaminidase. The disclosure also includes methods for treating or preventing a C5-related disease or disorder by administering one or more doses of an anti-C5 antibody or antigen-binding fragment thereof in combination with one or more doses of C5iRNA; preferably, wherein the anti-C5 antibody or fragment and the C5 iRNA are in a co-formulation. The disclosure also includes dosing regimens for treating a C5 related disease or disorder with a combination of an anti-C5 antibody and a C5iRNA in a subject that is not treated with a C5 inhibitor or is transitioning from previous C5 inhibitor treatment.

Description

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 381,450 filed on October 28, 2022, U.S. Provisional Patent Application No. 63 / 382,087 filed on November 2, 2022, U.S. Provisional Patent Application No. 63 / 382,264 filed on November 3, 2022, U.S. Provisional Patent Application No. 63 / 383,442 filed on November 11, 2022, U.S. Provisional Patent Application No. 63 / 385,909 filed on December 2, 2022, and U.S. Provisional Patent Application No. 63 / 386,909 filed on December 2, 2022. The present application claims the benefit of U.S. Provisional Patent Application No. 63 / 386,787, filed on December 9, 2023, U.S. Provisional Patent Application No. 63 / 495,767, filed on April 12, 2023, U.S. Provisional Patent Application No. 63 / 498,112, filed on April 25, 2023, U.S. Provisional Patent Application No. 63 / 505,011, filed on May 30, 2023, and Taiwan Patent Application No. 112141079, filed on October 26, 2023, each of which is incorporated herein by reference in its entirety.

[0002] The sequence listing of the present application is submitted electronically as an ASCII format sequence listing, with the file name "11282seqlist", the creation date being October 28, 2022, and the size being 112Kb. The submitted sequence listing is part of the present specification and is incorporated herein by reference in its entirety. Technical Field

[0003] The field of the present disclosure relates to co-formulations and combination therapies comprising RNA and antibodies or antigen-binding fragments thereof, and methods for stabilizing RNA in compositions comprising β-hexosaminidase. Background Art

[0004] Complement component C5 is a target of several rare diseases, including paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome, neuromyelitis optica, and generalized myasthenia gravis. For example, uncontrolled complement activation in PNH patients leads to the primary clinical manifestation of chronic hemolysis and an increased risk of thromboembolism, resulting in target organ damage and death.

[0005] Complement 5 is a valid target for the treatment of complement-mediated diseases such as generalized myasthenia gravis (gMG), as established by the approval of eculizumab (Eculizumab) for the treatment of patients with gMG. Monotherapy with the anti-C5 antibody pozelimab has been shown to be effective in blocking C5 activity in another disease that is highly sensitive to complement-mediated effects, paroxysmal nocturnal hemoglobinuria (PNH).

[0006] A substantial degree of complement inhibition is required to provide rapid and significant disease suppression and achieve complete and uninterrupted inhibition of C5 throughout the C5-inhibitor dosing interval. Current C5 inhibitor monotherapy does not achieve adequate levels of inhibition.

[0007] Treatments targeting C5 for PNH, such as eculizumab and ravulizumab (Soliris and Ultomiris, Alexion Pharmaceuticals), have shown efficacy. However, in rare cases, eculizumab and ravulizumab are ineffective because polymorphic variations in the gene encoding C5 prevent the C5 protein from being bound by eculizumab or ravulizumab (Nishimura et al., Genetic variants in C5 and poor response to eculizumab. N Engl J Med 2014; 370(7): 632-639). In addition, treatment is burdensome because the drugs are usually administered long-term by IV infusion every 2 weeks or every 8 weeks to maintain efficacy. Furthermore, it has been reported that up to 20% of patients with PNH treated with eculizumab at the labeled maintenance dose (900 mg Q2W IV) require significant increases in dose or dose frequency due to breakthrough hemolysis secondary to incomplete inhibition of C5 (Peffault deLatour et al., Assessing complement blockade in patients with paroxysmal nocturnal hemoglobinuria receiving Eculizumab. Blood 2015; 125(5): 775-783) (Hillmen et al., Long-term safety and efficacy of sustained Eculizumab treatment in patients with paroxysmal nocturnal hemoglobinuria. Br J Haematol 2013; 162(1): 62-73). Although regulatory approval of ravulizumab provides for IV dosing with a frequency of Q8W, patients still experience some hemolytic breakthrough (Lee et al., Ravulizumab (ALXN1210) vs Eculizumab in adult patients with PNH naive to complement inhibitors: the 301 study. Blood 2019; 133(6): 530-539).

[0008] In a phase 2 study (R3918-PNH-1852) in patients with PNH who had not undergone complement therapy, a 30 mg / kg IV loading dose followed by 800 mg SC weekly was effective in reducing serum LDH to <1.5×ULN in all patients and to <1.0 ULN in most patients. However, this regimen represents a relatively high dose of the biologic agent.

[0009] The need for such high anti-C5 mAb doses is driven by the requirement for 100% inhibition, which is achieved through complete target engagement, and high C5 levels (Peffault de Latour, 2015); and to achieve 100% inhibition on a population basis, one must account for inter- and intra-patient variability in C5 concentrations and the presence of enhanced complement activation, which can occur with concurrent disease.

[0010] Cemdisiran is a synthetic small interfering ribonucleic acid (siRNA) targeting C5 messenger ribonucleic acid (mRNA) that is covalently linked to a triantennary N-acetylgalactosamine (GalNAc) ligand. Cemdisiran is designed to inhibit hepatic production of C5 protein when administered by SC injection. C5 is encoded by a single gene and is primarily expressed and secreted by hepatocytes. Through the ribonucleic acid (RNA) interference pathway, cemdisiran leads to degradation of C5 mRNA by RNases, thereby reducing the production of C5 protein and resulting in reduced circulating C5 protein levels. Cemdisiran monotherapy has been found to be insufficiently effective as a single treatment for PNH. Badri et al., Clin Pharmacokinet. 2021; 60(3): 365–78 - Epub 2020 / 10 / 14.

[0011] Combining cemdisiran with recombinant antibodies in a co-formulation that can be conveniently administered by ordinary injection increases the risk of contamination from the antibodies that degrade the cemdisiran molecule.

[0012] Furthermore, treating patients with conditions such as PNH raises the likelihood that a large proportion of such patients will currently be receiving additional anti-C5 antibodies or have recently received such antibodies and therefore have detectable blood concentrations thereof. Experiments have shown that antibodies having a combination of the sequences of eculizumab and pazelizumab are able to form high molecular weight heteromeric complexes with C5, thus posing a risk of forming such complexes in vivo when both antibodies are present in the circulation.

[0013] Results from previous clinical studies have reported adverse reactions (e.g., serum sickness-like reactions, rash) after switching from one C5 mAb to another, particularly after switching from eculizumab to crovalimab (SKY59 / RO7112689 / RG6107), a therapeutic C5 antibody that binds to a different epitope than eculizumab. These reactions have been attributed to the formation of a DTD immune complex containing C5 and two C5 antibodies ( et al.,Thecomplement C5 inhibitor crovalimab in paroxysmal nocturnalhemoglobinuria.Blood 2020;135(12):912-920; et al., The SMART Anti-hC5 Antibody (SKY59 / RO7112689) Shows Good Safety and Efficacy in Patients with Paroxysmal Nocturnal Hemoglobinuria (PNH). Blood 2018a; 132(Suppl 1): 535; U.S. Patent Application US2009 / 0220508). The size of such immune complexes is associated with the occurrence of adverse events. For example, in a study in which anti-drug-antibody (ADA)-positive patients were injected with infliximab, an antibody specific for a target unrelated to the complement system, severe infusion reactions were observed when immune complexes larger than 1000 kDa (>6 antibodies) were detected for one patient, but no severe infusion reactions were observed when only smaller immune complexes (<1000 kDa) were detected in two patients (van der Laken et al., Imaging and serum analysis of immune complex formation of radiolabelled infliximab and anti-infliximab in responders and non-responders to therapy for rheumatoid arthritis. Ann Rheum Dis 2007; 66(2):253-256), suggesting that large DTD immune complexes are more likely to be associated with adverse events. Furthermore, small DTD immune complexes are not expected to be clinically significant based on extrapolation from other autoimmune disease states (e.g., systemic lupus erythematosus), whereby small immune complexes are inefficient in complement activation and interaction with Fcγ receptors and are not deposited in tissues (Wener et al., Immune Complexes in Systemic Lupus Erythematosus (Chapter 19). Systemic Lupus Erythematosus. Academic Press; 2010).

[0014] It is difficult to reduce the possibility of such adverse events. In the COMMODORE-1 clinical trial, there are two groups in which patients are treated with the anti-C5 antibody kovalizumab or eculizumab during the main treatment period of 24 weeks. After the main treatment period, patients in the eculizumab group have the option of switching to kovalizumab treatment. Sixteen percent of the patients who switched from eculizumab to kovalizumab experienced type 3 hypersensitivity (T3H) reactions. T3H reactions and injection-related reactions are not applicable to the eculizumab group because they are respectively related to large DTD complex formation and subcutaneous administration, which are unique to the kovalizumab group. Scheinberg et al., Phase III Randomized, Multicenter, Open-Label Commodore 1Trial: Comparison of Crovalimab vs Eculizumab in Complement Inhibitor-Experienced Patients With ParoxysmalNocturnal Hemoglobinuria, European Hematology Association, Frankfurt, Germany; Virtual (Hybrid) 09 June 2023. Summary of the Invention

[0015] The present invention includes co-formulations comprising: a C5 iRNA conjugated to a ligand comprising one or more terminal amino sugars, such as N-acetylgalactosamine (GalNAc) and / or N-acetylglucosamine (GlcNAc) residues; an antibody or antigen-binding fragment thereof that specifically binds to C5 (anti-C5) isolated from a mammalian host cell; a pH greater than or less than about 6 (e.g., about 6.5); and a pharmaceutically acceptable carrier. For example, in one embodiment of the present invention, the co-formulation comprises: C5iRNA; an antibody or antigen-binding fragment thereof that specifically binds to C5; a buffer (e.g., a histidine-based buffer, a citrate-based buffer, a phosphate-based buffer, and / or an acetate-based buffer, e.g., at a concentration of about 10 to 35, 35 to 45, 20 to 50, 20, 25, 30, 35, 40, 45, or 50 mM); a stabilizer (e.g., a polyol, a sugar, trehalose, sorbitol, mannitol, taurine, propanesulfonic acid, L-proline, sucrose, glycerol, threitol, maltitol, polyethylene glycol, glycol (PEG) and / or PEG3350; for example, at a concentration of about 0.8 to 3.6, 0.8, 0.9, 1.0, 1.25, 1.50, 2.0, 2.25, 2.50, 2.75, 3.00, 3.1, 3.2, 3.3, 3.4, 3.5 or 3.6% (w / v)); viscosity reducers, and nonionic surfactants (e.g., polyoxyethylene glycol alkyl ether; glucoside alkyl ether; polyoxyethylene glycol octylphenol ether; polyoxyethylene glycol alkylphenol ether; glycerol alkyl ester; polyoxyethylene glycol sorbitan alkyl ester; sorbitan alkyl ester; block copolymers of polypropylene glycol; block copolymers of polyethylene glycol; polysorbate, octaethylene glycol monododecyl ether; pentaethylene glycol monododecyl ether; polyoxypropylene glycol alkyl ether; ether); decyl glucoside, lauryl glucoside, octyl glucoside; triton X-100; nonoxynol-9; glyceryl laurate; cocamide MEA, cocamide DEA, lauryl dimethylamine oxide; poloxamer; polyethoxylated tallow amine (POEA); polysorbate 20 (PS20) and / or polysorbate 80 (PS80); for example, at a concentration of about 0.025, 0.05, 0.075, 0.1, 0.125, 0.15, 0.175% (w / v)), and a pH greater than or less than about 6 (e.g., within not less than 0.5 of 6.0) (e.g., about 6.5).

[0016] In one embodiment of the present invention, viscosity reducing agents (e.g., dicarboxylic acids, inorganic salts, esters of citric acid, xanthine, adipic acid, NaCl, caffeine, triethyl citrate, amino acids, (D- or L-) arginine, L-arginine HCl, (D- or L-) alanine, (D- or L-) histidine, proline, (D- or L-) valine, glycine, (D- or L-) serine, (D- or L-) phenylalanine, (D- or L-) lysine, and (D- or L-) glutamine) are used. Acids and salts thereof; pyridoxamine; L-ornithine; thiamine chloride phosphate dihydrate, benzenesulfonic acid and / or pyridoxine; for example, at a concentration of about 20 to 140, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135 or 140 mM) are each at a concentration of about 5 mM to about 100 mM (e.g., 50 to 75 mM). If the viscosity reducer is an amino acid, the amino acid can be its L-enantiomer or its D-enantiomer. The viscosity reducer can be the conjugate base of an acid specified herein or a salt thereof. In one embodiment of the invention, the co-formulation is characterized by an anti-C5 antibody or antigen-binding fragment purity of about 96% or greater, as assessed by size exclusion chromatography at 2°C to 8°C after about 1 month; and / or a C5 iRNA purity of about 94% or greater, as assessed by ion exchange chromatography at 2°C to 8°C after about 1 month. In one embodiment of the invention, the co-formulation has: a 1:1 ratio of mg / mL concentrations of C5 iRNA and anti-C5 antibody or antigen-binding fragment; and optionally a viscosity-lowering agent, which is arginine, adipate, NaCl, lysine, aspartate, proline, histidine, caffeine, phenylalanine and / or triethyl citrate, for example, at a concentration of about 75 mM arginine, 75 mM adipate, 75 mM NaCl, 75 mM lysine, 75 mM aspartate, 75 mM proline, 50 mM histidine (wherein, if the buffer is histidine-based, the total histidine concentration in the co-formulation is 50 mM), 50 mM caffeine, 50 mM phenylalanine and / or 75 mM triethyl citrate. In one embodiment of the invention, the co-formulation has: C5 iRNA and anti-C5 antibody or antigen-binding fragment at a mg / mL concentration in a 1:2 ratio; and optionally a viscosity-reducing agent, such as arginine, adipate, NaCl, lysine and / or aspartate, for example, at a concentration of about 75 mM arginine, 75 mM adipate, 75 mM NaCl, 75 mM lysine and / or 75 mM aspartate.

[0017] In one embodiment of the present invention, a co-formulation comprises an antibody or antigen-binding fragment thereof that specifically binds to C5 (anti-C5), wherein the antibody or antigen-binding fragment thereof that specifically binds to C5 (anti-C5) comprises: a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 2, and the light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 10; and a light chain variable region (LCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 18, and the light chain variable region (LCVR) comprising NO:26; a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO:34, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO:42; a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO:50, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO:58; a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: NO:66, the light chain variable region (LCVR) comprising the HCDR1, HCDR2, and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO:74; a heavy chain variable region (HCVR) comprising the HCDR1, HCDR2, and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO:82, and a light chain variable region (LCVR) comprising the LCDR1, LCDR2, and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO:90;a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 98, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 106; a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 98, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 114; and a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: NO: 122, the light chain variable region (LCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 106; a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 98, the light chain variable region (LCVR) comprising the LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 130; a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 138, the light chain variable region (LCVR) comprising the amino acid sequence of SEQ ID NO: NO: 106; a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 146; and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 106;a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 122, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 130; a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 146, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 114; and a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 146, the light chain variable region (LCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 146, the light chain variable region (LCVR) comprising the LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 130; a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 138, the light chain variable region (LCVR) comprising the LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 130; a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 154, the light chain variable region (LCVR) comprising the amino acid sequence of SEQ ID NO: NO: 162; a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 170; and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 178;a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 186, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 194; a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 202, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 210; and a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: : the HCDR1, HCDR2 and HCDR3 of the HCVR having the amino acid sequence set forth in SEQ ID NO: 218, the light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of the LCVR having the amino acid sequence set forth in SEQ ID NO: 226; a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of the HCVR having the amino acid sequence set forth in SEQ ID NO: 234, the light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of the LCVR having the amino acid sequence set forth in SEQ ID NO: 242; a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of the HCVR having the amino acid sequence set forth in SEQ ID NO: 250, the light chain variable region (LCVR) comprising NO: 258; a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 266; and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 258;a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 274, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 282; a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 290, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 298; and a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 306, the light chain variable region (LCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 306, the light chain variable region (LCVR) comprising the LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 314; a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 322, the light chain variable region (LCVR) comprising the LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 330; and / or a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 338, the light chain variable region (LCVR) comprising the amino acid sequence of SEQ ID NO: For example, in one embodiment of the present invention, an antibody or antigen-binding fragment thereof that specifically binds to C5 (anti-C5) comprises a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 4, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 8, and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 12, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 14, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 16;A heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 20, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 22, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 24, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 28, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 30, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 32; a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 36, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 38, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 40, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 44, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 46, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 48; a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 36, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 38, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: NO: 52, a HCDR1 comprising the amino acid sequence of SEQ ID NO: 54, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 56, the light chain variable region comprising LCDR1 comprising the amino acid sequence of SEQ ID NO: 60, LCDR2 comprising the amino acid sequence of SEQ ID NO: 62, and LCDR3 comprising the amino acid sequence of SEQ ID NO: 64; a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising HCDR1 comprising the amino acid sequence of SEQ ID NO: 68, HCDR2 comprising the amino acid sequence of SEQ ID NO: 70, and HCDR3 comprising the amino acid sequence of SEQ ID NO: 72, the light chain variable region comprising LCDR1 comprising the amino acid sequence of SEQ ID NO: 76, LCDR2 comprising the amino acid sequence of SEQ ID NO: 78, and LCDR3 comprising the amino acid sequence of SEQ ID NO: 80;A heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 84, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 86, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 88, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 92, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 94, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 100, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 102, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 104, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 108, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 110, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: NO: 112; a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 100, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 102, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 104, the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 116, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 118, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 124, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 126, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 128, the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 108, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 110, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: LCDR3 having the amino acid sequence shown in NO:112;a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 100, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 102, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 104, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 132, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 134, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 136; and a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 140, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 142, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 144, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 108, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 110, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: NO: 112; a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 148, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 150, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 152, and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 108, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 110, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 112; and a light chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 124, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 126, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 128, and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 132, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 134, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: LCDR3 having the amino acid sequence shown in NO:136;A heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 148, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 150, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 152, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 116, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 118, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 148, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 150, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 152, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 132, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 134, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: NO: 136; a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 140, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 142, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 144, and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 132, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 134, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 136; and a light chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 156, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 158, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 160, and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 164, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 166, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: LCDR3 having the amino acid sequence shown in NO:168;a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 172, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 174, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 176, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 180, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 182, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 184; and a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 188, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 190, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 192, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 196, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 198, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: NO: 200; a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 204, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 206, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 208, the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 212, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 214, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 216; a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 220, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 222, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 224, the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 228, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 230, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: LCDR3 having the amino acid sequence shown in NO:232;a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 236, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 238, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 240, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 244, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 246, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 248; and a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 252, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 254, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 256, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 260, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 262, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: NO: 264; a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 268, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 270, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 272, and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 260, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 262, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 264; and a light chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 276, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 278, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 280, and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 284, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 286, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: LCDR3 having the amino acid sequence shown in NO:288;a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 292, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 294, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 296, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 300, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 302, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 304; and a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 308, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 310, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 312, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 316, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 318, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: NO: 320; a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 324, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 326, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 328, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 332, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 334, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 336; or a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 340, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 342, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 344, and the light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 348, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 350, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: LCDR3 having the amino acid sequence shown in SEQ ID NO: 352. In one embodiment of the present invention, an antibody or antigen-binding fragment thereof that specifically binds to C5 (anti-C5) comprises: a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 2, a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 10; a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 18, a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 26;a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 34, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 42; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 50, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 58; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 66, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 74; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 82, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 90; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 98, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 106; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 98, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 114; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 122, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 106; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 98, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 130; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 138, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 106; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 146, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 106; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 122, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 130; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 146, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 114; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 146, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 130; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 138, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 130; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 138, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 130; a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 154, comprising a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 162; a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 170, comprising a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 178;a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 186, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 194; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 202, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 210; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 218, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 226; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 234, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 242; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 250, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 258; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 266, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 258; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 274, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 282; NO: 290, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 298; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 306, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 314; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 322, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 330; or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 338, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 346. For example, in one embodiment of the present invention, the co-formulation comprises about 90 to about 275 mg / ml;or about 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 1 27, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162 、163、164、165、166、167、168、169、170、171、172、173、174、175、176、177、178、179、180、181、182、183、184、185、186、187、188、189、190、191、192、193、194、195、196、197、1 98, 199, 200, 211, 220, 242, or 274 mg / ml; or at least about 150 mg / ml, at least about 175 mg / ml, at least about 200 mg / ml, at least about 211 mg / ml, at least about 220 mg / ml, at least about 242 mg / ml, or at least about 274 mg / ml of an antibody or antigen-binding fragment that specifically binds to C5 (anti-C5).

[0018] In one embodiment of the invention, the co-formulation comprises a C5 iRNA, which is a double-stranded ribonucleic acid (dsRNA) agent comprising a sense strand and an antisense strand, wherein the antisense strand comprises a complementary region comprising at least 17 contiguous nucleotides that differ from the nucleotide sequence of 5′-UAUUAUAAAAAUAUCUUGCUUUU-3′ (SEQ ID NO: 364) by no more than 3 nucleotides, and wherein the dsRNA agent comprises at least one modified nucleotide. In one embodiment of the invention, a co-formulation comprises a C5 iRNA, which is a double-stranded ribonucleic acid (dsRNA) agent comprising a sense strand and an antisense strand, wherein the sense strand comprises 5'-asasGfcAfaGfaUfAfUfuUfuuAfuAfaua-3' (SEQ ID NO: 406) and the antisense strand comprises 5'-usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudTdT-3' (SEQ ID NO: 369), wherein a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dT is a deoxythymidine nucleotide; s is a phosphorothioate linkage; and wherein the sense strand is conjugated at the 3' terminus to the following ligand (e.g., wherein the C5 iRNA is Cemdisiran): In one embodiment of the invention, the co-formulation comprises a C5 iRNA that is Cemdisiran and one or more of Cemdisiran Impurity 1, Cemdisiran Impurity 2, and Cemdisiran Impurity 3 as discussed herein. In one embodiment of the invention, the concentration of the C5 iRNA is about 20 to 100, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 115, 120, 130, 140, 150, 155, 160, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 0, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395 or 400 mg / ml.

[0019] In one embodiment of the invention, the co-formulation is characterized by a viscosity <30 cP at 20°C and / or an osmolarity of 240 to 450 mOsm / kg; for example, a viscosity ≤20 cP at 20°C.

[0020] The present invention includes co-formulations comprising any of the following: double-stranded C5 iRNA; and an anti-C5 antibody or an antigen-binding fragment thereof, pH above or below 6.0 (at least 0.5) (e.g., about 6.5); C5 iRNA, an anti-C5 antibody or an antigen-binding fragment thereof, buffer, Viscosity reducers, stabilizers, and Nonionic surfactants; C5 iRNA, an anti-C5 antibody or an antigen-binding fragment thereof, Histidine-based buffers, L-arginine, stabilizers, and Nonionic surfactants; C5 iRNA, an anti-C5 antibody or an antigen-binding fragment thereof, Histidine-based buffers, L-arginine, sugars or polyols, and Nonionic surfactants; Cemdisiran, Pazelimab, Histidine-based buffers, L-arginine, stabilizers, and nonionic surfactants, pH about 6.5; Cemdisiran, Pazelimab, Histidine-based buffers, L-arginine, sucrose, and Polysorbate 80, pH about 6.5; 100 (±10) mg / mL C5 iRNA, 100 (±10) mg / mL anti-C5 antibody or its antigen-binding fragment, 50(±5)mM viscosity reducer, 10(±1)mM buffer, 1.0 (± 0.1)% stabilizer, 0.075 (± 0.0075)% nonionic surfactant, pH about 6.5; 75 (±7.5) mg / mL C5 iRNA, 150 (±15) mg / mL anti-C5 antibody or its antigen-binding fragment, 75 (± 7.5) mM viscosity reducer, 15 (± 1.5) mM buffer, 1.5 (± 0.15)% stabilizer, 0.1125 (± 0.01125)% nonionic surfactant, pH about 6.5; 50 (±5) mg / mL C5 iRNA, 100 (±10) mg / mL anti-C5 antibody or its antigen-binding fragment, 75mM (±7.5) viscosity reducer, 15 (± 1.5) mM buffer, 1.5 (± 0.15)% stabilizer, 0.1125 (± 0.01125)% nonionic surfactant; pH about 6.5; 50 (±5) mg / mL C5 iRNA, 100 (±10) mg / mL anti-C5 antibody or its antigen-binding fragment, 75 (± 7.5) mM viscosity reducer, 35 (± 3.5) mM buffer, 1.5 (± 0.15)% stabilizer, 0.1125 (± 0.01125)% nonionic surfactant, pH about 6.5; 100 (±10) mg / mL C5 iRNA, 100 (±10) mg / mL anti-C5 antibody or its antigen-binding fragment, 50(±5)mM viscosity reducer, 30 (± 3) mM buffer, 1(±0.1)% stabilizer, 0.075 (± 0.0075)% nonionic surfactant, pH about 6.5; 50 (±5) mg / mL C5 iRNA, 100 (±10) mg / mL anti-C5 antibody or its antigen-binding fragment, 90(±9)mM viscosity reducer, 30 (± 3) mM buffer, 1(±0.1)% stabilizer, 0.075 (± 0.0075)% nonionic surfactant, pH about 6.5; About 100mg / mL Cemdisiran, About 100 mg / mL pazelizumab, About 50mM L-arginine, About 30 mM histidine-based buffer, About 1% (w / v) sucrose, About 0.075% (w / v) PS80, pH about 6.5; About 50mg / mL Cemdisiran, About 100 mg / mL pazelizumab, About 90mM L-arginine, About 30 mM histidine-based buffer, About 1% (w / v) sucrose, About 0.075% (w / v) PS80, pH about 6.5; About 100mg / mL Cemdisiran, About 100 mg / mL pazelizumab, About 50mM L-arginine, About 10 mM histidine-based buffer, About 1.0% sucrose, About 0.075% PS80, pH about 6.5; About 75mg / mL Cemdisiran, About 150mg / mL pazelizumab, About 75mM L-arginine, About 15 mM histidine-based buffer, About 1.5% sucrose, About 0.1125% PS80, pH about 6.5; About 50mg / mL Cemdisiran, About 100 mg / mL pazelizumab, About 75mM L-arginine, About 15 mM histidine-based buffer, About 1.5% sucrose, About 0.1125% PS80; pH about 6.5; About 50mg / mL Cemdisiran, About 100 mg / mL pazelizumab, About 75mM L-arginine, About 35 mM histidine-based buffer, About 1.5% sucrose, About 0.1125% PS80, pH about 6.5; About 100mg / mL Cemdisiran, About 100 mg / mL pazelizumab, About 50mM L-arginine, About 30 mM histidine-based buffer, About 1% sucrose, About 0.075% PS80, pH about 6.5; About 50mg / mL Cemdisiran, About 100 mg / mL pazelizumab, About 90mM L-arginine, About 30 mM histidine-based buffer, About 1% sucrose, About 0.075% PS80, pH about 6.5; Optionally, further comprising GalNAc and / or GlcNAc; About 120mg / mL C5 iRNA, About 120 mg / mL anti-C5 antibody or antigen-binding fragment, viscosity reducers; About 15mM histidine, pH about 6.2; About 75mg / mL C5 iRNA, About 150 mg / mL anti-C5 antibody or antigen-binding fragment, viscosity reducers; About 15mM histidine, pH about 6.2; About 120mg / mL C5 iRNA, About 120 mg / mL anti-C5 antibody or antigen-binding fragment, About 15mM histidine, pH about 6.2; About 75mg / mL C5 iRNA, About 150 mg / mL anti-C5 antibody or antigen-binding fragment, About 15mM histidine, pH about 6.2; About 120mg / mL Cemdisiran, About 120mg / mL pazelizumab, About 15mM histidine, pH about 6.2; About 120mg / mL Cemdisiran, About 120mg / mL pazelizumab, About 75mM arginine, About 15mM histidine, pH about 6.2; About 120mg / mL Cemdisiran, About 120mg / mL pazelizumab, About 75 mM adipate, About 15mM histidine, pH about 6.2; About 120mg / mL Cemdisiran, About 120mg / mL pazelizumab, About 75mM NaCl, About 15mM histidine, pH about 6.2; About 120mg / mL Cemdisiran, About 120mg / mL pazelizumab, About 75mM lysine, About 15mM histidine, pH about 6.2; About 120mg / mL Cemdisiran, About 120mg / mL pazelizumab, About 75mM aspartate, About 15mM histidine, pH about 6.2; About 120mg / mL Cemdisiran, About 120mg / mL pazelizumab, About 75mM proline, About 15mM histidine, pH about 6.2; About 120mg / mL Cemdisiran, About 120mg / mL pazelizumab, About 50mM histidine, pH about 6.2; About 120mg / mL Cemdisiran, About 120mg / mL pazelizumab, About 50mM caffeine, About 15mM histidine, pH about 6.2; About 120mg / mL Cemdisiran, About 120mg / mL pazelizumab, About 50 mM phenylalanine, About 15mM histidine, pH about 6.2; About 120mg / mL Cemdisiran, About 120mg / mL pazelizumab, About 50mM triethyl citrate, About 15mM histidine, pH about 6.2; About 75mg / mL Cemdisiran, About 150mg / mL pazelizumab, About 15mM histidine, pH about 6.2; About 75mg / mL Cemdisiran, About 150mg / mL pazelizumab, About 75mM arginine, About 15mM histidine, pH about 6.2; About 75mg / mL Cemdisiran, About 150mg / mL pazelizumab, About 75 mM adipate, About 15mM histidine, pH about 6.2; About 75mg / mL Cemdisiran, About 150mg / mL pazelizumab, About 75mM NaCl, About 15mM histidine, pH about 6.2; About 75mg / mL Cemdisiran, About 150mg / mL pazelizumab, About 75mM lysine, About 15mM histidine, pH about 6.2; or About 75mg / mL Cemdisiran, About 150mg / mL pazelizumab, About 75mM aspartate, About 15mM histidine, pH is about 6.2.

[0021] The present invention includes a co-formulation comprising: a C5 iRNA which is cemdisiran; an antibody or antigen-binding fragment which is pazelizumab; a viscosity-reducing agent which is L-arginine; a buffer which is a histidine-based buffer; a stabilizer which is sucrose; a nonionic surfactant which is polysorbate 80; and a pH of about 6.5.

[0022] In one embodiment of the invention, the co-formulation comprises a C5 iRNA conjugated to a ligand comprising one or more terminal N-acetylgalactosamine (GalNAc) or N-acetylglucosamine (GlcNAc) residues; the pH is within no less than about 0.5 of about 6; and / or the pH is about 6.5.

[0023] In one embodiment of the invention, the co-formulation is characterized by one or more of the following: comprising β-hexosaminidase; comprising an antibody or an antigen-binding fragment thereof, said antibody or antigen-binding fragment being expressed and isolated from a mammalian host cell comprising β-hexosaminidase; comprising an antibody or an antigen-binding fragment thereof, said antibody or antigen-binding fragment being expressed and isolated from Chinese hamster ovary cells; comprising no more than about 1% of the cemdisiran impurity 1 relative to the total cemdisiran; comprising no less than about 80% of cemdisiran relative to the total cemdisiran after storage at 2°C to 8°C for 2 years; having about 91% cemdisiran before storage (at t=0); storing 1, 1 at 2°C to 8°C. 1 / 2, 2, 2 1having not less than about 80% cemdisiran after 2 or 3 years; having about 80% to about 91% cemdisiran; exhibiting a cemdisiran purity (%) by dIPRP of about 90.5% at t=0, 91.1% after 1 month at 2°C to 8°C, 90.8% after 3 months at 2°C to 8°C, 90% after 6 months at 2°C to 8°C, 88.8% after 9 months at 2°C to 8°C, 88.7% after 12 months at 2°C to 8°C, 89% after 18 months at 2°C to 8°C, and / or 89.4% after 24 months at 2°C to 8°C; The purity (%) of cemdisiran by dIPRP was shown to be approximately 90.8% at t=0, 90.6% after 1 month storage at 2°C to 8°C, 90.5% after 3 months storage at 2°C to 8°C, 89.4% after 6 months storage at 2°C to 8°C, 88.3% after 9 months storage at 2°C to 8°C, 87.8% after 12 months storage at 2°C to 8°C, 87.8% after 18 months storage at 2°C to 8°C, and / or 89.4% after 24 months storage at 2°C to 8°C; the single-chain purity (%) of cemdisiran by dIPRP was shown to be approximately 90.5% at t=0, 90.6% after 1 month storage at 2°C to 8°C, 90.5% after 3 months storage at 2°C to 8°C, 89.4% after 6 months storage at 2°C to 8°C, 88.3% after 9 months storage at 2°C to 8°C, 87.8% after 18 months storage at 2°C to 8°C, and / or 89.4% after 24 months storage at 2°C to 8°C. The purity (%) of Cemdisiran by dIPRP was about 90.8% at t=0, 88.8% after storage at 25°C and 60% RH for 1 month, 85.9% after storage at 25°C and 60% RH for 3 months, 82.3% after storage at 25°C and 60% RH for 6 months, 88.9% after storage at 40°C and 75% RH for 0.5 month, and 85.8% after storage at 40°C and 75% RH for 3 months. The purity (%) of Cemdisiran by dIPRP was about 90.9% at t=0, about 90.1% after storage at 25°C, 60% RH for 1 month, about 90.9% after storage at 25°C, 60% RH for 3 months, about 90.4% after storage at 25°C, 60% RH for 6 months, and about 89.6% after storage at 40°C, 75% RH for 0.5 month.9% at t=0, about 89.7% after 1 month at 40°C, 75% RH, and / or about 89.5% after 3 months at 40°C, 75% RH; the purity (%) of Cemdisiran as shown by dIPRP was about 90.8% at t=0, about 90.2% after 1 month at 25°C, 60% RH, about 90.8% after 3 months at 25°C, 60% RH, about 90.3% after 6 months at 25°C, 60% RH, about 89.5% after 0.5 month at 40°C, 75% RH, about 89.6% after 1 month at 40°C, 75% RH, and / or about 89.5% after 3 months at 40°C, 75% RH; the purity (%) of Cemdisiran as shown by dIPRP was about 90.8% at t=0, about 90.2% after 1 month at 25°C, 60% RH, about 90.8% after 3 months at 25°C, 60% RH, about 90.3% after 6 months at 25°C, 60% RH, about 89.5% after 0.5 month at 40°C, 75% RH, and / or about 89.6% after 1 month at 40°C, 75% RH. % after storage at 40°C, 75% RH for 0.5 months; about 89.1% after storage at 25°C, 60% RH for 3 months; about 89.1% after storage at 25°C, 60% RH for 3 months; about 90.5% after storage at 25°C, 60% RH for 1 month; about 90.8% after storage at 25°C, 60% RH for 3 months; about 90.4% after storage at 25°C, 60% RH for 6 months; about 90.1% after storage at 40°C, 75% RH for 0.5 months; about 89.6% after storage at 40°C, 75% RH for 1 month; and / or about 89.9% after storage at 40°C, 75% RH for 3 months; and / or about 91.1% after storage at 25°C, 60% RH for 3 months; The humidity of the present invention is about 90% after storage for 1 month at 25°C, 60% RH, about 91% after storage for 3 months at 25°C, 60% RH, about 90.7% after storage for 6 months at 25°C, 60% RH, about 90% after storage for 0.5 month at 40°C, 75% RH, about 89.7% after storage for 1 month at 40°C, 75% RH, and / or about 89.9% after storage for 3 months at 40°C, 75% RH. In one embodiment of the invention, the co-formulation is characterized by one or more of the following: no more than about 2.1 parts per million (ppm) molar ratio of β-hexosaminidase to antibody or antigen-binding fragment; contains no more than about 0.170 micrograms / ml β-hexosaminidase, contains no more than about 0.04 micrograms / ml β-hexosaminidase; and / or, about 0.04, 0.05, 0.06, 0.06, 0.0605, 0.0605, 0.0605, 0.063, 0.07, 0.07, 0.0765, 0.078, 0.08, 0.14, 0.141, 0.15, 0.1525, 0.166, or 0.17 micrograms / ml β-hexosaminidase; or no more than any of these concentrations.

[0024] The present invention also includes methods for administering a co-formulation as described herein to a subject, comprising introducing the co-formulation into the body of the subject, e.g., by injecting the co-formulation into the body of the subject; e.g., by intramuscular, subcutaneous, intravenous, intraocular and / or intravitreal injection.

[0025] The present invention also includes methods for treating or preventing a C5-related disease or disorder (e.g., a disorder of inappropriate or undesirable complement activation; a complication of hemodialysis; a pulmonary disease or disorder; a neurological disorder; a parasitic disease; a post-ischemia-reperfusion condition; a proteinuric nephropathy; a renal disorder; adult respiratory distress syndrome; adult respiratory distress syndrome (ARDS); age-related macular degeneration (AMD); an allergy; Alport's syndrome; Alzheimer's disease; an autoimmune disease or; an immune complex disorder; an inflammatory disorder; an eye disease; an organic dust disease; an vasculo-thrombotic and protein-losing enteropathy); asthma; asthma; atherosclerosis; bronchoconstriction; bullous pemphigoid; C3 glomerulopathy; capillary leak syndrome; CHAPLE disease (CD55 deficiency with complement hyperactivation; chemical injury from irritating gases and / or chemicals; chronic obstructive pulmonary disease) in a subject in need thereof. obstructive pulmonary disease (COPD); complement activation due to burns; complement activation due to frostbite; complement activation due to obesity; complement activation due to sepsis; Crohn's disease; diabetes mellitus; diabetic macular edema (DME); diabetic nephropathy; diabetic retinopathy; dry AMD; dyspnea; emphysema; epilepsy; fibrotic dust disease; geographic atrophy (GA); glomerulopathy; Goodpasture's Guillain-Barré syndrome; hemolytic anemia; hemoptysis; hereditary angioedema; hyperacute allograft rejection; hypersensitivity pneumonitis; immune complex-associated inflammation; infectious diseases; inflammation in autoimmune diseases; hereditary CD59 deficiency; injury from inert dusts and / or minerals; interleukin-2-induced toxicity during IL-2 therapy; lupus nephritis; membranoproliferative glomerulonephritis; membranoproliferative nephritis Mesenteric artery reperfusion after aortic reconstruction; multiple sclerosis; myasthenia gravis; myocardial infarction; neuromyelitis optica; ocular angiogenesis; Parkinson's disease; pneumonia; progressive renal failure; psoriasis; pulmonary embolism and infarction; pulmonary fibrosis; pulmonary vasculitis; renal ischemia; renal ischemia-reperfusion injury; rheumatoid arthritis; schizophrenia; systemic lupus erythematosus nephritis; moyamoya injury; stroke; systemic inflammatory response in post-pump syndrome caused by cardiopulmonary bypass or renal bypass;A method of treating systemic lupus erythematosus (SLE); thermal injury; traumatic brain injury; uveitis; vasculitis; wet AMD; paroxysmal nocturnal hemoglobinuria (PNH); and / or xenograft rejection) comprising administering to the subject a therapeutically effective amount of a co-formulation as described herein. In one embodiment of the invention, the subject is administered one or more additional therapeutic agents, such as, for example, androgens, anticoagulants, anti-inflammatory agents, antihypertensive agents, immunosuppressants, fibrinolytic agents, lipid-lowering agents, anti-CD20 agents, anti-TNFα agents, C3 inhibitors, antithrombotic agents, corticosteroids, nonsteroidal anti-inflammatory drugs, angiotensin-converting enzyme inhibitors, hydroxymethylglutaryl CoA reductase inhibitors, antiepileptics, warfarin, aspirin, heparin, phenindione, fondaparinux, idraparinux, and thrombin inhibitors such as argatroban, lepirudin, bivalirudin, dabigatran, vincristine, cyclosporine A, and dapoxetine. A), methotrexate, ancrod, ε-aminocaproic acid, plasmin inhibitor-a1, prostacyclin, defibrotide, rituximab, infliximab, and / or magnesium sulfate.

[0026] The present invention provides a method for increasing the stability of RNA or reducing the activity of β-hexosaminidase in a composition, the composition comprising RNA conjugated to a ligand containing one or more terminal N-acetylgalactosamine (GalNAc) residues and / or N-acetylglucosamine (GlcNAc) residues, and β-hexosaminidase, the method comprising (i) adding GalNAc and / or GlcNAc to the composition and / or (ii) increasing or decreasing the pH of the composition from about 6; for example, wherein the composition comprises: RNA that is C5 iRNA; an antibody or antigen-binding fragment thereof, the antibody or antigen-binding fragment thereof expressed and isolated from a mammalian host cell (e.g., Chinese hamster ovary (CHO) cell) containing β-hexosaminidase; and, optionally, a buffer, a viscosity reducing agent, a stabilizer, and a non-ionic surfactant. In one embodiment of the invention, the RNA is double-stranded RNA, optionally comprising an overhang of 1 or 2 nucleotides at one or both ends, for example, wherein the RNA is chemically synthesized.

[0027] The invention includes methods for preparing a co-formulation comprising combining an RNAi with an antibody or antigen-binding fragment, and (i) adding GalNAc to the co-formulation and / or (ii) adjusting the pH of the co-formulation to about 6 or below about 6. Co-formulations, which are the products of the methods that form part of the invention.

[0028] The present invention provides a method for administering an antibody or antigen-binding fragment thereof that specifically binds to C5 (anti-C5) in combination with a C5 iRNA to a subject, comprising introducing the antibody or fragment and the iRNA into the subject's body. In one embodiment of the invention, the antibody or fragment and the iRNA are introduced by subcutaneous injection or intravenous infusion of a co-formulation comprising both the antibody or fragment and the iRNA; or by subcutaneous injection or intravenous infusion of separate formulations each comprising the antibody or fragment or the iRNA.

[0029] The present invention provides methods for treating or preventing a C5-related disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an antibody or antigen-binding fragment thereof that specifically binds to C5 in a single co-formulation or in separate formulations in combination with a C5 iRNA. In one embodiment of the invention, the method further comprises administering to the subject one or more initial intravenous or subcutaneous loading doses of the antibody or antigen-binding fragment and / or the iRNA. For example, in one embodiment of the invention, the method comprises administering one or more doses of: (1) about 400 mg of the anti-C5 antibody or antigen-binding fragment; and (2) about 200 mg of the C5 iRNA; for example, administering about 400 mg of the anti-C5 antibody or antigen-binding fragment approximately every 2, 3, or 4 weeks (±3 days); and administering about 200 mg of the C5 iRNA approximately every 4 weeks (±3 days). In one embodiment of the invention, the method comprises administering (i) about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously about every 2 weeks (±3, 4, 5, 6, or 7 days); and about 200 mg of the C5 iRNA subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days); (ii) about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days); and about 200 mg of the C5 iRNA subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days); (iii) an intravenous loading dose of the anti-C5 antibody or antigen-binding fragment, about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of the C5 iRNA subcutaneously; and then about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of the C5 iRNA subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days) thereafter. (iv) an intravenous loading dose of about 30 or 60 mg / kg of an anti-C5 antibody or antigen-binding fragment, about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of the C5 iRNA subcutaneously; and then about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of the C5 iRNA subcutaneously about every 4 weeks (±3, 4, 5, 6 or 7 days) thereafter. iRNA; (v) an intravenous loading dose of about 30 or 60 mg / kg anti-C5 antibody or antigen-binding fragment, followed by one or more weekly subcutaneous doses of about 800 mg anti-C5 antibody or antigen-binding fragment, and then, optionally after a one-week period, about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of the C5 iRNA subcutaneously; and then about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of the C5 iRNA subcutaneously about every four weeks (±3, 4, 5, 6, or 7 days) thereafter; (vi)(a) an intravenous dose of eculizumab and about 200 mg of C5 iRNA subcutaneously;(b) up to about 14 days (±3, 4, 5, 6, or 7 days) later, the dose of eculizumab; and (c) after about an additional 14 or 15 days (±3, 4, 5, 6, or 7 days), a dose of 30 or 60 mg / kg body weight of anti-C5 antibody or antigen-binding fragment intravenously, about 400 mg of anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of C5 iRNA subcutaneously, and (d) about every 4 weeks (±3, 4, 5, 6, or 7 days) thereafter, a dose of about 400 mg of anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of C5 iRNA subcutaneously; or (vii) (a) about 200 mg SC dose of C5 iRNA; (b) after about 28 days (±3, 4, 5, 6, or 7 days), a 30 or 60 mg / kg IV loading dose of anti-C5 antibody or antigen-binding fragment, 400 mg an SC dose of an anti-C5 antibody or antigen-binding fragment and a 200 mg SC dose of a C5 iRNA; and (c) approximately 29 additional days (±3, 4, 5, 6, or 7 days) later and approximately every 4 weeks (±3, 4, 5, 6, or 7 days) thereafter, an approximately 400 mg SC dose of an anti-C5 antibody or antigen-binding fragment and an approximately 200 mg SC dose of a C5 iRNA; or (viii) (a) approximately 4 weeks (±3, 4, 5, 6, or 7 days) after administration of ravlizumab, a 200 mg SC dose of a C5 iRNA; (b) approximately 28 additional days (±3, 4, 5, 6, or 7 days) later, a 30 or 60 mg / kg IV loading dose of an anti-C5 antibody or antigen-binding fragment, a 400 mg SC dose of an anti-C5 antibody or antigen-binding fragment, and a 200 mg SC dose of a C5 iRNA iRNA; and (c) approximately an additional 29 days (±3, 4, 5, 6, or 7 days) thereafter and approximately every 4 weeks (±3, 4, 5, 6, or 7 days) thereafter, a 400 mg SC dose of an anti-C5 antibody or antigen-binding fragment and a 200 mg SC dose of C5 iRNA. In one embodiment of the invention, the anti-C5 antibody or antigen-binding fragment and the C5 iRNA are administered subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days) as a single injection of a co-formulation comprising the anti-C5 antibody or antigen-binding fragment and the C5 iRNA, and an additional injection of the anti-C5 antibody or antigen-binding fragment is administered subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days); the anti-C5 antibody or antigen-binding fragment and the C5 iRNA are administered subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days) as separate injections of separate formulations, one of which comprises the anti-C5 antibody or antigen-binding fragment and the other comprises the C5 iRNA, and an additional injection of the anti-C5 antibody or antigen-binding fragment is administered subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days);The anti-C5 antibody or antigen-binding fragment and C5 iRNA are administered subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days) as a single injection of a co-formulation comprising the anti-C5 antibody or antigen-binding fragment and C5 iRNA, and additional injections of the anti-C5 antibody or antigen-binding fragment are administered subcutaneously about every 2 weeks (±3, 4, 5, 6, or 7 days); and / or the anti-C5 antibody or antigen-binding fragment and C5 iRNA are administered subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days) as separate injections of separate formulations, one of which comprises the anti-C5 antibody or antigen-binding fragment and the other comprises the C5 iRNA, and additional injections of the anti-C5 antibody or antigen-binding fragment are administered subcutaneously about every 2 weeks (±3, 4, 5, 6, or 7 days).

[0030] In one embodiment of the invention, the subject has previously received treatment with ravlizumab (e.g., administered intravenously or subcutaneously) and / or eculizumab (e.g., administered intravenously, e.g., 900 mg intravenously); and / or pazelizumab monotherapy. In one embodiment of the invention, the subject has not received a complement inhibitor.

[0031] The present invention includes methods for treating or preventing a C5-related disease or disorder in a subject in need thereof, the methods comprising administering to the subject a therapeutically effective amount of an anti-C5 antibody, or an antigen-binding fragment thereof, and a C5 iRNA, wherein the subject has previously received eculizumab, wherein the subject is administered: (i) an intravenous dose of eculizumab and 200 mg subcutaneously of the C5 iRNA; (ii) up to about 14 days (±3, 4, 5, 6, or 7 days) later (about day 15), the dose of eculizumab; and (iii) about 14 or 15 days (±3, 4, 5, 6, or 7 days) later (about day 29), a dose of about 60 mg / kg body weight of the anti-C5 antibody or antigen-binding fragment intravenously, about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously, and about 200 mg of the C5 iRNA subcutaneously. iRNA; and (iv) starting about 28 days (±3, 4, 5, 6, or 7 days) later (about day 57) and about every about 28 days (±3, 4, 5, 6, or 7 days) thereafter, about 400 mg of the anti-C5 antibody or antigen-binding fragment and about 200 mg of the C5 iRNA subcutaneously.

[0032] The present invention provides a method for treating or preventing a C5-related disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an anti-C5 antibody, or antigen-binding fragment thereof, and a C5 iRNA, wherein the subject has previously received ranvlizumab, wherein the subject is administered: (i) about 28 days (±3, 4, 5, 6, or 7 days) after the last administration of ranvlizumab, a SC dose of about 200 mg of the C5 iRNA; (ii) about 28 days (±3, 4, 5, 6, or 7 days) later (about day 29), an IV dose of about 60 mg / kg of the anti-C5 antibody or antigen-binding fragment, a SC dose of about 400 mg of the anti-C5 antibody or antigen-binding fragment, and a SC dose of about 200 mg of the C5 iRNA; and (iii) starting about 28 days (±3, 4, 5, 6, or 7 days) later (about day 57) and about every about 28 days (±3, 4, 5, 6, or 7 days) thereafter, about 400 mg of the C5 iRNA. A SC dose of anti-C5 antibody or antigen-binding fragment and approximately 200 mg of a SC dose of C5 iRNA.

[0033] The present invention provides methods for treating or preventing a C5-related disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an anti-C5 antibody or antigen-binding fragment thereof and a C5 iRNA, wherein the subject has not previously received or has not recently received treatment with a complement inhibitor, wherein the subject is administered: (i) on about day 1, an intravenous dose of about 30 mg / kg of the anti-C5 antibody or antigen-binding fragment, an subcutaneous (SC) dose of about 400 mg of the antibody or fragment, and an SC dose of about 200 mg of the C5 iRNA; and (ii) starting about 28 days later (±3, 4, 5, 6, or 7 days) and about every 4 weeks (±3, 4, 5, 6, or 7 days) thereafter, about 400 mg SC of the anti-C5 antibody or antigen-binding fragment and about 200 mg SC of the C5 iRNA.

[0034] The present invention provides methods for treating or preventing a C5-related disease or disorder in a subject in need thereof, the methods comprising administering to the subject a therapeutically effective amount of an anti-C5 antibody, or an antigen-binding fragment thereof, and a C5 iRNA, wherein the subject has previously received anti-C5 antibody or antigen-binding fragment monotherapy: (i) about 400 mg SC dose of the anti-C5 antibody or antigen-binding fragment and about 200 mg SC dose of the C5 iRNA starting about 7 to 8 days (±3 days) after the last dose of the anti-C5 antibody or antigen-binding fragment monotherapy or when the next dose of the monotherapy is due and about every 4 weeks (±3, 4, 5, 6, or 7 days) thereafter; or (ii) about 400 mg SC dose of the anti-C5 antibody or antigen-binding fragment and about every 2 weeks (±3, 4, 5, 6, or 7 days) thereafter starting about 7 to 8 days (±3 days) after the last dose of the anti-C5 antibody or antigen-binding fragment monotherapy or when the next dose of the monotherapy is due; and about 200 mg SC dose of the C5 iRNA. A SC dose of the C5 iRNA and additional doses approximately every 4 weeks (± 3, 4, 5, 6, or 7 days) thereafter.

[0035] The present invention also provides a method for treating or preventing a C5-related disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an anti-C5 antibody or antigen-binding fragment thereof in combination with a C5 iRNA, wherein the subject has received one or more doses of a non-competing anti-C5 antibody or antigen-binding fragment (N / C Ab) (e.g., wherein the subject has detectable blood levels of the N / C Ab when treatment is initiated): (1) a dose of the C5 iRNA and non-competing antibody or fragment on the day the N / C Ab dose is due; (2) the next dose of the non-competing anti-C5 antibody or antigen-binding fragment on the day such dose is due; (3) after about 1 to 2 half-lives of the N / C Ab, a loading dose of 60 mg / kg IV of pazelimumab, 400 mg SC of pazelimumab, and 200 mg SC of cemdisiran; and (4) starting 4 weeks thereafter, 400 mg SC of pazelimumab Q4W and 200 mg SC of cemdisiran Q4W; or (1) after about 1 to 2 half-lives of the non-competing anti-C5 antibody or antigen-binding fragment from its last dose, a dose of C5 iRNA; (2) after about an additional 1 to 2 half-lives of the N / CAb, a 60 mg / kg IV loading dose of pazelimumab, 400 mg SC pazelimumab, and 200 mg SC cemdisiran; and (3) starting 4 weeks thereafter, 400 mg SC pazelimumab and 200 mg SC cemdisiran Q4W. In one embodiment of the invention, the C5 iRNA is Cemdisiran; the anti-C5 antibody or antigen-binding fragment thereof is Pazlimab; the non-competitive anti-C5 antibody or antigen-binding fragment is Eculizumab; the non-competitive anti-C5 antibody or antigen-binding fragment is Ravelizumab; the half-life of the non-competitive antibody is about 11 days; and / or the half-life of the non-competitive antibody is about 32 days.

[0036] In one embodiment of the invention, during the treatment period, the subject achieves or achieves and maintains any one or more of the following: stable hemoglobin; no red blood cell transfusions; no decrease in hemoglobin by ≥2 g / dL; no breakthrough hemolysis; complete suppression of CH50 levels in the blood relative to baseline before treatment (at 0 kIU / L) and / or during any breakthrough hemolysis event; no treatment-emergent adverse events; improvement in fatigue relative to before treatment; improvement in FACIT-Fatigue score by >5 points relative to before treatment; improvement in physical function score in the European Organization for Research and Treatment of Cancer: Quality-of-Life Questionnaire, core 30 items (EORTC QLQ-C30) relative to before treatment; improvement in GHS / QoL (Global Health Status / QOL Scale (GHS)) relative to before treatment; and improvement in lactate dehydrogenase relative to before treatment. the achievement and maintenance of LDH ≤ 1.0 × ULN; a decrease in blood bilirubin levels relative to before treatment; a decrease in reticulocyte count relative to before treatment; a decrease in the alternative pathway hemolytic activity assay (AH50) relative to before treatment; a decrease in PNH red blood cells and / or granulocytes relative to before treatment; an improvement in fatigue, shortness of breath, muscle weakness, headache, abdominal pain, back / leg pain, chest pain, difficulty sleeping, difficulty thinking clearly, and / or difficulty swallowing relative to before treatment; an improvement in renal function as measured by estimated glomerular filtration rate (eGFR) relative to before treatment; a decrease in blood free hemoglobin relative to before treatment; a decrease in total C5 blood levels relative to before treatment; a decrease in PNH clone size relative to before treatment; and / or an increase in haptoglobin levels relative to before treatment.

[0037] In one embodiment of the invention, the C5-related disease or disorder is: a disorder of inappropriate or undesirable complement activation; a complication of hemodialysis; a pulmonary disease or disorder; a neurological disorder; a parasitic disease; a post-ischemia-reperfusion condition; a proteinuric nephropathy; a renal disorder; adult respiratory distress syndrome; adult respiratory distress syndrome (ARDS); age-related macular degeneration (AMD); an allergy; Alport syndrome; Alzheimer's disease; an autoimmune disease or; an immune complex disorder; an inflammatory disorder; an eye disease; an organic dust disease; an vascular thrombosis and protein loss disorder. bowel disease); asthma; asthma; atherosclerosis; bronchoconstriction; bullous pemphigoid; C3 glomerulopathy; capillary leak syndrome; CHAPLE disease (CD55 deficiency with complement hyperactivation; chemical injury from irritants and / or chemicals; chronic obstructive pulmonary disease (COPD); complement activation from burns; complement activation from frostbite; complement activation from obesity; complement activation from sepsis; Crohn's disease; diabetes mellitus; diabetic macular edema (DME); diabetic nephropathy; diabetic retinopathy; dry AMD; dyspnea; pneumothorax epilepsy; fibrogenic dust disease; geographic atrophy (GA); glomerulopathy; Goodpasture's syndrome; Guillain-Barré syndrome; hemolytic anemia; hemoptysis; hereditary angioedema; hyperacute allograft rejection; hypersensitivity pneumonitis; immune complex-associated inflammation; infectious diseases; inflammatory conditions in autoimmune diseases; hereditary CD59 deficiency; injury from inert dust and / or minerals; interleukin-2-induced toxicity during IL-2 therapy; lupus nephritis; membranoproliferative glomerulonephritis; mesenteric artery reperfusion after aortic remodeling; multiple sclerosis myasthenia gravis; myocardial infarction; neuromyelitis optica; ocular angiogenesis; Parkinson's disease; pneumonia; progressive renal failure; psoriasis; pulmonary embolism and infarction; pulmonary fibrosis; pulmonary vasculitis; renal ischemia; renal ischemia-reperfusion injury; rheumatoid arthritis; schizophrenia; systemic lupus erythematosus nephritis; moyamoya injury; stroke; systemic inflammatory response in post-pump syndrome with cardiopulmonary bypass or renal bypass; systemic lupus erythematosus (SLE); thermal injury; traumatic brain injury; uveitis; vasculitis; wet AMD; paroxysmal nocturnal hemoglobinuria (PNH); and / or xenograft rejection.

[0038] In one embodiment of the invention, the C5 iRNA and the anti-C5 antibody or antigen-binding fragment are co-formulated into a co-formulation, and both the antibody or fragment and the C5 iRNA are administered by a single injection of the co-formulation.

[0039] In one embodiment of the invention, the pH of the co-formulation is about 6.5. In one embodiment of the invention, the C5 iRNA and the anti-C5 antibody or antigen-binding fragment are co-formulated into a co-formulation comprising 100 mg / ml Cemdisiran and 100 mg / ml Pazylimab, or 50 mg / ml Cemdisiran and 100 mg / ml Pazylimab.

[0040] In one embodiment of the invention, the co-formulation comprises: cemdisiran; pazelimab expressed and isolated from a mammalian host cell containing β-hexosaminidase; a buffer; a viscosity reducing agent; a stabilizer; a nonionic surfactant; and optionally a viscosity reducing agent; at a pH of about 6.5.

[0041] In one embodiment of the invention, the subcutaneous injection is performed with a pre-filled syringe or an autoinjector.

[0042] In one embodiment of the invention, the subject suffers from aplastic anemia and / or myelodysplastic syndrome.

[0043] In one embodiment of the invention, the subject has previously received, or it further comprises, before (optionally, any of the preceding 1, 2, 3, 4, 5, 6, 7, 8, 910, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 days), after or during the administration of 400 mg subcutaneous pazyrumab and 200 mg subcutaneous cemdisiran. The subject is administered the following: one or more subcutaneous or intravenous doses of pazelimab; one or more 400 mg subcutaneous doses of pazelimab; one or more subcutaneous or intravenous doses of an anti-C5 antibody or antigen-binding fragment; one or more subcutaneous or intravenous doses of eculizumab; one or more subcutaneous or intravenous doses of ravulizumab; one or more subcutaneous or intravenous doses of cemdisiran; one or more subcutaneous or intravenous doses of C5 iRNA; one or more subcutaneous doses of 800 mg of pazelimumab; one or more subcutaneous doses of 800 mg of an anti-C5 antibody or antigen-binding fragment; one or more intravenous doses of 30 mg / kg body weight of pazelimumab; one or more intravenous doses of 30 mg / kg body weight of an anti-C5 antibody or antigen-binding fragment; one or more intravenous doses of approximately 60 mg / kg body weight of pazelimumab; one or more intravenous doses of approximately 60 mg / kg body weight of an anti-C5 antibody or antigen-binding fragment; one or more subcutaneous doses of approximately 800 mg of pazelimumab; one or more subcutaneous doses of approximately 800 mg an anti-C5 antibody or antigen-binding fragment; one intravenous dose of about 60 mg / kg body weight of pazelizumab followed by one or more subcutaneous doses of about 800 mg of pazelizumab; one intravenous dose of about 60 mg / kg body weight of an anti-C5 antibody or antigen-binding fragment followed by one or more subcutaneous doses of about 800 mg of an anti-C5 antibody or antigen-binding fragment; one or more intravenous doses of ≥300, ≥600, ≥900, or ≥1200 mg of eculizumab; one or more subcutaneous doses of 200 mg of cemdisiran; and / or, one or more subcutaneous doses of 200 mg of a C5 iRNA.

[0044] In one embodiment of the invention, intravenous administration of the anti-C5 antibody or antigen-binding fragment is separated from subcutaneous administration of the anti-C5 antibody or antigen-binding fragment or C5 iRNA by about 30 minutes; subcutaneous administration of the anti-C5 antibody or antigen-binding fragment and C5 iRNA is followed by an observation period of about 30 minutes, 1 hour, or 2 hours; and / or subcutaneous administration of the C5 iRNA is followed by an observation period of about 30 minutes, 1 hour, or 2 hours.

[0045] In one embodiment of the invention, if the subject exhibits one or more of the following criteria: breakthrough hemolysis not due to a complement activation disorder, and / or, an increase in LDH ≥ 2×ULN due to a complement activation disorder, the subject receives booster therapy further comprising one or more 30 mg / kg IV doses of an anti-C5 antibody or antigen-binding fragment.

[0046] In one embodiment of the invention, the subject exhibits one or more of the following criteria: breakthrough hemolysis not due to a complement activation disorder, and / or an increase in LDH ≥ 2×ULN due to a complement activation disorder, and the subject receives booster therapy, wherein: (1) if the subject has received a treatment regimen comprising about 400 mg of the anti-C5 antibody or antigen-binding fragment administered subcutaneously about every 4 weeks (± 3, 4, 5, 6, or 7 days) and about 200 mg of the C5 iRNA administered subcutaneously about every 4 weeks (± 3, 4, 5, 6, or 7 days); a single 30 mg / kg IV dose of the anti-C5 antibody or antigen-binding fragment is administered on the day of the booster, and administration of about 400 mg of the anti-C5 antibody or antigen-binding fragment administered subcutaneously about every 2 weeks (± 3, 4, 5, 6, or 7 days) and about 200 mg of the C5 iRNA administered subcutaneously about every 4 weeks (± 3, 4, 5, 6, or 7 days) is initiated on the day of the booster; or (2) if the subject has received a treatment regimen comprising about 400 mg of the anti-C5 antibody or antigen-binding fragment administered subcutaneously about every 2 weeks (±3, 4, 5, 6, or 7 days) and about 200 mg of the C5 iRNA administered subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days); administer a single 30 mg / kg IV dose of the anti-C5 antibody or antigen-binding fragment on the day of the boost, and restart the treatment regimen comprising about 400 mg of the anti-C5 antibody or antigen-binding fragment administered subcutaneously about every 2 weeks (±3, 4, 5, 6, or 7 days) and about 200 mg of the C5 iRNA administered subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days) starting on the day of the boost.

[0047] In one embodiment of the invention, the anti-C5 antibody or antigen-binding fragment or Pazyrumab is expressed in a mammalian host cell (eg, Chinese hamster ovary cell) and the iRNA or Cemdisiran is chemically synthesized.

[0048] In one embodiment of the invention, the anti-C5 antibody or antigen-binding fragment and C5 iRNA are co-formulated into a co-formulation comprising: no more than about 2.1 parts per million (ppm) molar ratio of β-hexosaminidase to antibody or antigen-binding fragment; no more than about 0.170 micrograms / ml β-hexosaminidase; no more than about 0.04 micrograms / ml β-hexosaminidase; and / or, about 0.04, 0.05, 0.06, 0.0605, 0.063, 0.07, 0.0765, 0.078, 0.08, 0.14, 0.141, 0.15, 0.1525, 0.166 or 0.17 micrograms / ml β-hexosaminidase; or no more than any of these concentrations.

[0049] In one embodiment of the present invention, the anti-C5 antibody or antigen-binding fragment thereof is: (1) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 2, and a light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 10; (2) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 18, and a light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 26; (3) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 19, and a light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 27. NO:34, the light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO:42; (4) a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO:50, the light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO:58; (5) a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO:66, the light chain variable region (LCVR) comprising (6) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR having the amino acid sequence of SEQ ID NO: 82, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR having the amino acid sequence of SEQ ID NO: 90;(7) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 98, and a light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 106; (8) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 98, and a light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 114; (9) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: NO:122, the light chain variable region (LCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO:106; (10) a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO:98, the light chain variable region (LCVR) comprising the LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO:130; (11) a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO:138, the light chain variable region (LCVR) comprising the amino acid sequence of SEQ ID NO: (12) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 146, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 106;(13) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 122, and a light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 130; (14) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 146, and a light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 114; (15) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: NO:146, the light chain variable region (LCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO:130; (16) a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO:138, the light chain variable region (LCVR) comprising the LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO:130; (17) a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising the HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO:154, the light chain variable region (LCVR) comprising the amino acid sequence of SEQ ID NO:155 (18) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR having the amino acid sequence of SEQ ID NO: 170, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR having the amino acid sequence of SEQ ID NO: 178;(19) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 186, and a light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 194; (20) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 202, and a light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 210; (21) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 220, and a light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 221. NO: 218, the light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 226; (22) a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 234, the light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 242; (23) a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 250, the light chain variable region (LCVR) comprising (24) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 266, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 258;(25) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 274, and a light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 282; (26) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: 290, and a light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of a LCVR comprising the amino acid sequence of SEQ ID NO: 298; (27) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of a HCVR comprising the amino acid sequence of SEQ ID NO: NO: 306, the light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 314; (28) a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 322, the light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 330; and / or (29) a heavy chain variable region (HCVR) and a light chain variable region (LCVR), the heavy chain variable region (HCVR) comprising HCDR1, HCDR2 and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 338, the light chain variable region (LCVR) comprising LCDR1, LCDR2 and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: LCDR1, LCDR2 and LCDR3 of the LCVR having the amino acid sequence shown in NO: 346;

[0050] In one embodiment of the invention, the C5 iRNA comprises an RNA strand complementary to an mRNA transcribed from the sense strand DNA sequence of the C5 gene AAGCAAGATATTTTTATAATA (nucleotides 782 to 802 of SEQ ID NO: 360). In one embodiment of the invention, the C5 iRNA is a double-stranded ribonucleic acid (dsRNA) agent comprising a sense strand and an antisense strand, wherein the antisense strand comprises a complementary region comprising at least 17 consecutive nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of 5′-UAUUAUAAAAAUAUCUUGCUUUU-3′ (SEQ ID NO: 364), and wherein the dsRNA agent comprises at least one modified nucleotide. In one embodiment of the invention, the C5 iRNA is a double-stranded ribonucleic acid (dsRNA) agent comprising a sense strand and an antisense strand, wherein the sense strand comprises 5′-asasGfCAfaGfaUfAfUfuUfuuAfuAfaua-; 3′ (SEQ ID NO: 406) and the antisense strand comprises 5′-usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudTdT-3′ (SEQ ID NO: 369), wherein a, g, c, and u are 2′-O-methyl (2′-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2′-fluoro A, G, C, and U, respectively; dT is a deoxythymidine nucleotide; s is a phosphorothioate linkage; and wherein the sense strand is conjugated at the 3′ terminus to the following ligand:

[0051] In one embodiment of the present invention, the C5 iRNA and the antibody or antigen-binding fragment thereof that specifically binds to C5 are in a co-formulation as specifically set forth herein.

[0052] In one embodiment of the present invention, wherein the C5 iRNA and the anti-C5 antibody or antigen-binding fragment thereof are in a single co-formulation, when administered subcutaneously, the administration is performed in one or two or more (eg, two) injections of the co-formulation.

[0053] Preferably, the C5 iRNA is Cemdisiran and / or the anti-C5 antibody or antigen-binding fragment thereof is Pazyrumab.

[0054] Summary: Not receiving complement inhibitors: On Day 1: 30 mg / kg intravenous (IV) single loading dose and 400 mg subcutaneous (SC) pazelimumab, and cemdisiran 200 mg SC (combined maintenance dose); Starting on Day 29: pazelimumab 400 mg SC and cemdisiran 200 mg SC q4W every 4 weeks (q4W) (e.g., as a cemdisiran / pazelimumab co-formulation). Switching from Pazelimab Monotherapy to Pazelimab + Cemdisiran Combination Therapy: On the last dose of Pazelimab monotherapy) or when the next dose of Pazelimab monotherapy is due, subjects begin receiving Pazelimab 400 mg SC and Cemdisiran 200 mg SC every 4 weeks (q4W); Switching from Eculizumab Therapy to Pazelimab + Cemdisiran Combination Therapy: On Day 1 (the day of the subject's scheduled eculizumab administration): Cemdisiran 200 mg SC and eculizumab ≥900 mg IV (subject's usual dose); on Day 15, for subjects receiving eculizumab every 14 days (labeled dose schedule): labeled eculizumab dose [for subjects receiving eculizumab more frequently than q14 days: dose within 2 days of the patient's regularly scheduled dose; on Day 29 (or when the next eculizumab dose is due (if receiving eculizumab dose more frequently than q14 weeks) or 2 weeks later): pazelizumab 60 mg / kg IV loading dose, and pazelizumab 400 mg SC and cemdisiran 200 mg SC; and starting on Day 57 (or 4 weeks later): pazelizumab 400 mg SC and cemdisiran 200 mg SC every 4 weeks; Switching from ravelizumab treatment to pazelizumab + cemdisiran combination therapy: on Day 1 (4 weeks after the last dose of ravelizumab): cemdisiran 200 mg SC; on Day 29 or 4 weeks later: a single IV loading dose of pazelimumab 60 mg / kg, and pazelimumab 400 mg SC and cemdisiran 200 mg SC; and starting on Day 57 or 4 weeks later: start pazelimumab 400 mg SC every 4 weeks and cemdisiran 200 mg SC every 4 weeks. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 : Cemdisiran structure. Duplex RNA sense and antisense strands having modified nucleotides, with the sense strand linked to a ligand (L96).

[0056] Figure 2: Stability of Cemdisiran (Total Impurities #1 and #2) in 75:100 and 100:100 co-formulations (Cemdisiran:Pazyrumab concentration (mg / ml)) over time at 5°C.

[0057] Figure 3 : Stability of Cemdisiran (Total Impurities #1 and #2) in 75:100 and 100:100 Co-formulations (Cemdisiran:Pazyromab Concentrations (mg / ml)) and Cemdisiran Only Control over Time at 40°C.

[0058] Figure 4 : Chromatograms from dIPRP analysis of 100:100, 75:100 (Cemdisiran:Pazelimab concentration (mg / ml)) and Cemdisiran only samples stored at 40°C for 3 months.

[0059] Figure 5 : Represents the structure of Cemdisiran impurity 1 lacking one GalNAc (the wavy line represents double-stranded RNA).

[0060] Figure 6 : Cemdisiran purity (by dIPRP) of 75:100 and 100:100 (Cemdisiran:Pazylimab concentration (mg / ml)) co-formulations prepared from Pazylimab Process 1 and 2 materials and stored at 40°C.

[0061] Figure 7 : Chromatograms from dIPRP analysis of two Cemdisiran-only formulations (±10 micrograms / ml β-hexosaminidase) after 0.5 month at 40°C.

[0062] Figure 8 : Total impurities (Cemdisiran impurities #1, #2, and #3) over time when stored at all three temperatures (from left to right: 40°C, 25°C, and 5°C) between two 50:100 co-formulations (Cemdisiran:Pazyrumab concentrations (mg / ml)) at either pH 5.9 or pH 6.6.

[0063] Figure 9 Total impurities (Cemdisiran impurities #1, #2, and #3) over time when stored at 40°C between two 100:100 and two 50:100 co-formulations (Cemdisiran:Pazylimab concentration (mg / ml)) at pH 6.0 prepared from Pazylimab batch 3 or 4. The degradation process was fit to the curve with the equation shown.

[0064] Figure 10 : Characteristics (pH, sucrose, arginine, pazelimumab (REGN3918), cemdisiran, histidine, and desirability) varied in a 50:100 co-formulation evaluated in a DOE (design of experiments) experiment.

[0065] Figure 11 : Characteristics (pH, sucrose, arginine, pazelimumab (REGN3918), cemdisiran, histidine, and desirability) varied in a 100:100 co-formulation evaluated in a DOE (design of experiments) experiment.

[0066] Figure 12 : Change in percentage of high molecular weight species of Pazyrumab after stirring with two co-formulations (100:100 and 50:100) at different concentrations of polysorbate 80 (Cemdisiran:Pazyrumab concentrations (mg / ml)).

[0067] Figure 13 Figure 3: Total impurities (Cemdisiran impurities #1, #2, and #3) over time when stored at 40°C for two co-formulations (50:100 and 100:100) at pH 6.0 and two co-formulations (50:100 and 100:100) at pH 6.5 (Cemdisiran:Pazyrumab concentration (mg / ml)).

[0068] Figure 14 : Quantification of β-Hex in different batches of pazelizumab (ng / ml).

[0069] Figure 15 : Determination of calibration curve.

[0070] Figure 16 : Dilution curve.

[0071] Figure 17 : Schematic diagram showing the dosing regimen of Pazylimab + Cemdisiran for patients previously receiving Pazylimab monotherapy as described in Example 4.

[0072] Figure 18 : A graph showing individual LDH (×ULN) values ​​over time for patients in Cohort 1 (Pazyrumab Q4W + Cemdisiran) of the study described in Example 4.

[0073] Figure 19 : Graph showing individual LDH (×ULN) values ​​over time for patients in Cohort 2 (Pazylimab Q2W + Cemdisiran) of the study described in Example 4.

[0074] Figure 20: Graph showing individual hemoglobin values ​​over time for patients in Cohort 1 (Pazyrumab Q4W + Cemdisiran) and Cohort 2 (Pazyrumab Q2W + Cemdisiran) of the study described in Example 4. Each line represents an individual patient.

[0075] FIG21 : Graph showing patient-reported outcomes over time for patients in the study described in Example 4. Figure 21A is a graph showing FACIT-Fatigue score, Figure 21B is a graph showing EORTC-QLQ-C30 physical function scores, and Figure 21C is a graph showing EORTC-QLQ-C30 GHS / QoL scores.

[0076] Figure 22 : Graph showing individual LDH (xULN) values ​​by visit for patients in the study described in Example 5. Each line represents an individual patient.

[0077] Figure 23 : Individual patient LDH values ​​by visit for patients in the study described in Example 5.

[0078] Figure 24 : Individual patient hemoglobin values ​​by visit for patients in the study described in Example 5.

[0079] Figure 25 : Study flow chart for the study described in Example 5.

[0080] Figure 26 : Study flow chart for the study described in Example 6.

[0081] Figure 27 : Study flow chart for the study described in Example 7.

[0082] Figure 28 : Spaghetti Plot: LDH to ULN ratio (LDH / ULN) results by visit (full analysis set) for Pazylimab q2w + Cemdisiran q4w and Pazylimab q4w + Cemdisiran q4w.

[0083] Figure 29 : Spaghetti plot: CH50 results by visit (full analysis set) for Pazelimab q2w + Cemdisiran q4w and Pazelimab q4w + Cemdisiran q4w.

[0084] Figure 30: Spaghetti plot: LDH (×ULN) results by visit (full analysis set) from Baseline Visit 2 (Day 1) to Day 225, showing 1.5×ULN and 1×ULN.

[0085] Figure 31 : Individual LDH values ​​by visit (5 patients who completed OLTP). Each line represents an individual patient. LDH, lactate dehydrogenase; ULN, upper limit of normal.

[0086] Figure 32 : Individual hemoglobin values ​​by visit (5 patients who completed OLTP). Each line represents an individual patient.

[0087] Figure 33 =Percentage of patients with LDH ≤ 1.5 × ULN over time (At data cutoff, all 24 randomly assigned patients completed the OLTP, and 23 entered the optional OLEP). Group 1: Pazelimumab 400 mg SC every 4 weeks + cemdisiran 200 mg SC every 4 weeks. Group 2: Pazelimumab 400 mg SC every 2 weeks + cemdisiran 200 mg SC every 4 weeks. LDH, lactate dehydrogenase; Q2W, every 2 weeks; Q4W, every 4 weeks; SC, subcutaneous; ULN, upper limit of normal.

[0088] Figure 34 =Hb over time (At data cutoff, all 24 randomized patients completed the OLTP, and 23 entered the optional OLEP). Group 1: Pazelimumab 400 mg SC every 4 weeks + cemdisiran 200 mg SC every 4 weeks. Group 2: Pazelimumab 400 mg SC every 2 weeks + cemdisiran 200 mg SC every 4 weeks. SC, subcutaneous; SE, standard error; Q2W, every 2 weeks; Q4W, every 4 weeks.

[0089] Figure 35 : Mean percentage change from baseline in lactate dehydrogenase excretion rate (U / L) over time (by visit (week)) in patients (pazelimab 400 mg SC Q4W + cemdisiran 200 mg SC Q4W and ravulizumab patients).

[0090] Figure 36 : Spaghetti plot of LDH / ULN results by visit in patients (Pazelizumab 400 mg SC Q4W + Cemdisiran 200 mg SC Q4W and Ravelizumab patients) - 1.5 and 1×ULN are shown. The dose of the combination or Ravelizumab is shown.

[0091] Figure 37 : Spaghetti plot of LDH / ULN results by visit - 1.5 and 1×ULN levels are shown for the five patients (Pazelizumab 400 mg SC Q4W + Cemdisiran 200 mg SC Q4W and Ravelizumab patients) who did not achieve adequate control of LDH by Week 8. The dose of the combination or Ravelizumab is shown.

[0092] Figure 38 : Spaghetti plot of CH50 (U / ml) by visit over time in patients (Pazelizumab 400 mg SC Q4W + Cemdisiran 200 mg SC Q4W and Ravelizumab patients). The dose of the combination or Ravelizumab and CH50 measurements are shown.

[0093] Figure 39 : Spaghetti plot of CH50 (U / ml) by visit over time in patients with inadequate response (Pazelimab 400 mg SC Q4W + Cemdisiran 200 mg SC Q4W and Ravelizumab patients). Patients who switched to trial R3918-PNH-2050 are shown.

[0094] Figure 40 : LDH over time in inadequate responders in the ravulizumab group before and after switching to the combination.

[0095] Figure 41 : A study with per-protocol blood transfusions between groups. Each group had one patient who met the protocol requirements for blood transfusion but did not receive a transfusion.

[0096] Figure 42 : Spaghetti plot of red blood cell hemoglobin (g / L) by visit in patients completing Week 26. Hb = hemoglobin; reference range (g / L): 110 to 155 in women and 125 to 170 in men.

[0097] Figure 43 : Spaghetti plot of LDH (×ULN) by visit for patients with aplastic anemia (AA) or myelodysplastic syndrome (MDS) reported in their medical history. The solid line represents AA patients and the dashed line represents MDS patients.

[0098] Figure 44Chemical structures of the viscosity-lowering agents tested. The effects on viscosity in the 1:1 base formulation (120 mg / mL cemdisiran, 120 mg / mL pazelimumab, 15 mM histidine, pH 6.2) and the 1:2 base formulation (75 mg / mL cemdisiran, 150 mg / mL pazelimumab, 15 mM histidine, pH 6.2) relative to the control formulation lacking the viscosity-lowering agent are shown in parentheses.

[0099] Figure 45 : Percentage of patients with ≤1.5×ULN by visit (Cohort A).

[0100] Figure 46 : Percentage of patients with ≤1.0×ULN by visit (Cohort A).

[0101] Figure 47 : Summary of the cohorts in the study presented in Example 7.

[0102] Figure 48 : Spaghetti plot of corpuscular hemoglobin (g / l) results by visit for subjects who completed the open-label treatment period (OLTP, Week 26 visit) - Analysis of Cohort A.

[0103] Figure 49 : Correspondence of LDH and CH50 in inadequate LDH responders in the combination and ravulizumab groups. Combination patient ID: 158-007-102; ravulizumab patient IDs: 124-001-103, 158-001-101, 410-001-102, and 410-001-104.

[0104] Figure 50 =Complement inhibitor-naive, eculizumab switch, ravulizumab switch, and pazelizumab monotherapy switch regimens. Cem = Cemdisiran; Ecu = eculizumab; Pz = pazelizumab; SC = subcutaneous; IV = intravenous. In one embodiment of the invention, each regimen is characterized by the timeline shown. DETAILED DESCRIPTION

[0105] While combining two C5 inhibitor treatments with complementary mechanisms of action (pazelimab and cemdisiran) offers the advantage of complete inhibition of the C5 pathway at (relatively) low levels of C5 expression, several technical challenges must be overcome to obtain suitable dosing regimens and delivery vehicles for the agents.

[0106] The superior C5 inhibition provided by the compositions and methods of the present disclosure results in the need for less pazyrumab, which in turn results in reduced SC antibody injection volume, reduced dosing frequency, a wider drug administration window for the combination than for pazyrumab monotherapy, and the potential for reduced injection site reactions. In patients requiring chronic and long-term administration, the combination offers the potential to improve compliance and quality of life compared to pazyrumab monotherapy, while still providing maximal inhibition of C5 activity in a greater percentage of patients compared to eculizumab treatment. In addition, as discussed herein, the dosing regimens of the present disclosure avoid the risk of adverse events caused by the formation of large drug-target-drug complexes (e.g., eculizumab-C5-pazyrumab). Co-formulation of the two agents also provides the convenience of only a single subcutaneous injection to administer the two agents together.

[0107] The present disclosure provides stable co-formulations comprising an antibody or its antigen-binding fragment (e.g., Pazerimab) and a C5 iRNA (e.g., Cemdisiran). Co-formulation of antibodies expressed from mammalian host cells and iRNA molecules conjugated to ligands having terminal N-acetylgalactosamine (GalNAc) and / or N-acetylglucosamine (GlcNAc) presents technical challenges. Small amounts of the enzyme β-hexosaminidase, which often contaminates antibody formulations from such host cells, have been shown to catalyze the removal of terminal GalNAc residues from such iRNA ligands. The present disclosure provides stable co-formulations comprising such antibodies and iRNA molecules that overcome this problem, for example, by adjusting the pH from 6 (e.g., 6.5), adding GalNAc and / or GlcNAc; and / or adding arginine (e.g., L-arginine, such as L-arginine HCl).

[0108] In the methods of the present disclosure, the administration of anti-C5 antibodies and C5 iRNA has been designed to rapidly and continuously suppress the concentration of C5 to a pharmacologically inactive level. Generally speaking, anti-C5 monotherapy requires relatively high doses in patients with PNH. The demand for such high anti-C5 mAb doses is driven by two factors. First, C5 levels are high and 100% inhibition is required, which can only be achieved with complete target engagement (Peffault de Latour R et al., Assessing complement blockade in patients with paroxysmal nocturnal hemoglobinuria receiving eculizumab. Blood 2015; 125(5): 775-83); second, in order to achieve 100% inhibition on a population basis, the inter- and intra-patient variability of C5 concentrations and the example of enhanced complement activation (which can occur with concurrent diseases) can be used. The combination of pazelizumab and cemdisiran achieves high complement inhibition with a relatively low dose of antibody. Combining pazelimab and cemdisiran also offers the advantage of achieving low complement levels while administering less pazelimab (relative to pazelimab monotherapy), resulting in reduced SC injection volume, less frequent dosing, a wider window of drug administration than that of pazelimab monotherapy, and the potential for reduced injection site reactions.

[0109] The present disclosure includes dosing regimens for switching from a previous anti-C5 antibody therapy (e.g., eculizumab or ravelizumab) to a C5 iRNA + anti-C5 antibody or antigen-binding fragment thereof therapy of the present disclosure (e.g., pazelizumab + cemdisiran). Pazelizumab has been shown to bind non-competitively to C5 with an antibody having the amino acid sequence of eculizumab (eculizumab*) and therefore has the potential to form heteromeric complexes, including large DTD immune complexes, such as in patients switching from eculizumab to pazelizumab therapy. Large DTD immune complexes are known to cause adverse events, such as serum sickness-like reactions and rash. The dosing regimens of the present disclosure have been designed to reduce the risk of large DTD complex formation and the occurrence of such adverse events. Antigen binding proteins

[0110] As used herein, the term "antibody" refers to an immunoglobulin molecule comprising four polypeptide chains: two heavy chains (HC) and two light chains (LC) interconnected by disulfide bonds (e.g., IgG), e.g., H2M11683N; H2M11686N; H4H12159P; H4H12161P; H4H12163P; H4H12164P; H4H1 2166P; H4H12166P2; H4H12166P3; H4H12166P4; H4H12166P5; H4H12166P6; H4H1 2166P7; H4H12166P8; H4H12166P9; H4H12166P10; H4H12167P; H4H12168P; H4H 12169P; H4H12170P; H4H12171P; H4H12175P; H4H12176P2; H4H12177P2; H4H121 83P2; H2M 11682N; H2M11684N; H2M11694N; H2M11695N; In one embodiment of the present disclosure, each antibody heavy chain (HC) comprises a heavy chain variable region ("HCVR" or "V H ”) (e.g., SEQ ID NO: 2; 18; 34; 50; 66; 82; 98; 98; 122; 98; 138; 146; 122; 146; 146; 138; 154; 170; 186; 202; 218; 234; 250; 266; 274; 290; 306; 322; or 338; or a variant thereof) and a heavy chain constant region; and each antibody light chain (LC) comprises a light chain variable region (“LCVR” or “V L ”) (e.g., SEQ ID NO: 10; 26; 42; 58; 74; 90; 106; 114; 106; 130; 106; 106; 130; 114; 130; 130; 162; 178; 194; 210; 226; 242; 258; 258; 282; 298; 314; 330; or 346; or a variant thereof) and a light chain constant region (CL). V H and V L The V region can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). H and V L Contains three CDRs and four FRs. Preferably, the antibodies or antigen-binding fragments thereof in the co-formulations of the present disclosure are expressed and isolated from mammalian host cells, such as Chinese Hamster Ovary (CHO) cells.

[0111] For example, antibodies as set forth herein include monoclonal, recombinant, chimeric, human and / or humanized antibodies.

[0112] In one embodiment of the present disclosure, the assignment of amino acids to each framework or CDR domain is performed according to the following definitions: Sequences of Proteins of Immunological Interest, Kabat, et al.; National Institutes of Health, Bethesda, Md.; 5th ed.; NIH Publ. No. 91-3242 (1991); Kabat (1978) Adv. Prot. Chem. 32: 1-75; Kabat, et al., (1977) J. Biol. Chem. 252: 6609-6616; Chothia, et al., (1987) J Mol. Biol. 196: 901-917 or Chothia, et al., (1989) Nature 342: 878-883. Thus, the present disclosure includes V H CDR and V L CDRs of antibodies and antigen-binding fragments, wherein V H and V L comprising an amino acid sequence as set forth herein (or a variant thereof), wherein the CDRs are defined according to Kabat and / or Chothia.

[0113] In one embodiment of the present disclosure, an anti-C5 antigen binding protein (e.g., an antibody or antigen binding fragment) comprises a heavy chain constant domain, such as a heavy chain constant domain of the IgA (e.g., IgA1 or IgA2), IgD, IgE, IgG (e.g., IgG1, IgG2, IgG3, and IgG4 (e.g., comprising S228P and / or S108P mutations)), or IgM type. In one embodiment of the present disclosure, an antigen binding protein (e.g., an antibody or antigen binding fragment) comprises a light chain constant domain, such as a light chain constant domain of the kappa or lambda type. The present disclosure includes antigen binding proteins (e.g., H2M 11683N; H2M 11686N; H4H12159P; H4H12161P; H4H12163P; H4H121 64P; H4H12166P; H4H12166P2; H4H12166P3; H4H12166P4; H4H12166P5; H4H 12166P6; H4H12166P7; H4H12166P8; H4H12166P9; H4H12166P10; H4H12167P ;H4H12168P; H4H12169P; H4H12170P; H4H12171P; H4H12175P; H4H12176P2; H4H12177P2; H4H12183P2; H2M11682N; H2M11684N; H2M11694N; H2M11695N; kovalizumab; eculizumab, tertulumab, mubodina or ravlizumab; preferably pazelizumab), which are linked to the heavy and / or light chain constant domains, e.g., as described above.

[0114] "Isolated" antigen-binding proteins (e.g., antibodies or antigen-binding fragments thereof), polypeptides, polynucleotides, and vectors are at least partially free of other biomolecules from the cells or cell cultures in which they are produced. Such biomolecules include nucleic acids, proteins, other antibodies or antigen-binding fragments, lipids, carbohydrates, or other substances, such as cell debris and growth medium. Isolated antigen-binding proteins may also be at least partially free of expression system components, such as biomolecules from host cells or their growth medium. Generally, the term "isolated" is not intended to refer to: the complete absence of such biomolecules (e.g., small or insignificant amounts of impurities may remain); or the absence of water, buffers, or salts; or components of a pharmaceutical formulation comprising an antigen-binding protein (e.g., an antibody or antigen-binding fragment).

[0115] In one embodiment of the present disclosure, an antibody or antigen-binding fragment thereof that specifically binds to a complement factor 5 (C5) protein interacts with one or more amino acids (or at least 1, 2, 3, 4, or 5 amino acids thereof) contained in NMATGMDSw (SEQ ID NO: 353) or one or more amino acids (or at least 1, 2, 3, 4, or 5 amino acids thereof) contained in WEVHLVPRRKQLQFALPDSL (SEQ ID NO: 354), as determined by hydrogen / deuterium exchange. In one embodiment of the present disclosure, an antibody or antigen-binding fragment thereof that specifically binds to a complement factor 5 (C5) protein interacts with one or more amino acids contained in the α chain and / or β chain of C5, as determined by hydrogen / deuterium exchange. For example, in one embodiment of the present disclosure, the antibody or antigen-binding fragment thereof does not interact with amino acids in the C5a anaphylatoxin region of C5, as determined by hydrogen / deuterium exchange. In one embodiment of the present disclosure, an antibody or antigen-binding fragment thereof that specifically binds to a complement factor 5 (C5) protein interacts with an amino acid sequence selected from the group consisting of: (a) NMATGMDSW (SEQ ID NO: 353); (b) ATGMDSW (SEQ ID NO: 355); (c) WEVHLVPRRKQLQ (SEQ ID NO: 356); (d) WEVHLVPRRKQLQFALPDSL (SEQ ID NO:354); and (e) LVPRRKQLQ (SEQ ID NO:357).

[0116] The sequences of anti-C5 antibodies and antigen-binding fragments thereof (eg, LCVR and HCVR or LCDR and HCDR thereof) that can be included in the co-formulations or used in the methods are shown below. Table A. Anti-C5 Antibody Chain Amino Acid Sequences* *Antibodies and fragments may comprise one or more variants of sequence. See WO2017 / 218515

[0117] The polynucleotides encoding the chains shown in Table A are shown in Table B below. Table B. Anti-C5 Antibody Chain Nucleotide Sequences* *Antibodies and fragments may comprise one or more variants of sequence. See WO2017 / 218515 H2M11683N HCVR (SEQ ID NO: 2) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Ser Ser Tyr Gly; Ile Trp Asp Asp Gly Asn Asn Ile; and Ala Arg Asp Ala Pro Ile Ala Pro Val Pro Asp Tyr LCVR (SEQ ID NO: 10) LCDR1, LCDR2 and LCDR3 are shown below: Gln Ser Ile Ser Ser Trp; Lys Ala Ser; and Gln Gln Tyr Asn Thr Tyr Ser Tyr Thr H2M11686N HCVR (SEQ ID NO: 18) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Ser Asp Tyr Tyr; Ile Ser Ser Ser Gly Asn Thr Ile; and Ala Arg Tyr Lys Ser Ser Ser Asp Tyr Phe Asp His LCVR (SEQ ID NO:26) LCDR1, LCDR2 and LCDR3 are shown below: Gln Ser Val Arg Ser Tyr; Asp Ala Ser; and Gln Gln Ser Gly Asn Trp Pro Leu Thr H4H12159P HCVR (SEQ ID NO:34) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Ser Thr Tyr Gly; Ile Trp Asp Asp Gly Asn Asn Lys; and Ala Arg Asp Ser Glu Val Ala Pro Val Gly Asp Tyr LCVR (SEQ ID NO:42) LCDR1, LCDR2 and LCDR3 are shown below: Gln Ser Ile Asn Arg Trp; Lys Ala Ser; and Gln Gln Tyr Asn Asp Tyr Ser Tyr Thr H4H12161P HCVR (SEQ ID NO:50) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Ser Asp His Tyr; Ile Arg Asn Lys Ala Asn Ala Tyr Asn Thr; and Val Arg Val Trp Asn Tyr Ala Tyr Phe Ala Met Asp Val LCVR (SEQ ID NO:58) LCDR1, LCDR2 and LCDR3 are shown below: Gln Asn Ile Gly Ile Phe; Ala Ala Ser; and Gln Gln Thr Tyr Asn Thr Ile Phe Thr H4H12163P HCVR (SEQ ID NO:66) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Ser Ser Tyr Ala; Ile Ser Gly Arg Gly Asp Ser Thr; and Val Lys Glu Gly Glu Gln Leu Val Tyr Trp Tyr Phe Asp Leu LCVR (SEQ ID NO:74) LCDR1, LCDR2 and LCDR3 are shown below: Gln Thr Ile Ser Asn Phe; Ala Ala Ser; and Gln Gln Ser Tyr Thr Thr Pro Leu ThrH4H12164P HCVR (SEQ ID NO:82) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Asn Arg Tyr Ala; Ile Ser Gly Ser Gly Ser Ser Thr; and Ala Arg Gly Thr Thr Val Thr Thr Gly Tyr Gly Met Asp Val LCVR (SEQ ID NO:90) LCDR1, LCDR2 and LCDR3 are shown below: Gln Asp Ile Thr Asn Ser; Asp Ala Ser; and Gln Gln Tyr Asp Asp Leu Pro Tyr Thr H4H12166P HCVR (SEQ ID NO:98) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Asp Ser Val Ser Ser Ser Tyr; Ile Tyr Tyr Ser Gly Ser Ser; and Ala Arg Glu Gly Asn Val Asp Thr Thr Met Ile Phe Asp Tyr LCVR (SEQ ID NO: 106) LCDR1, LCDR2 and LCDR3 are shown below: Gln Gly Ile Arg Asn Asp; Ala Ala Ser; and Leu Gln Asp Phe Asn Tyr Pro Trp Thr H4H12166P2 HCVR (SEQ ID NO:98) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Asp Ser Val Ser Ser Ser Tyr; Ile Tyr Tyr Ser Gly Ser Ser; and Ala Arg Glu Gly Asn Val Asp Thr Thr Met Ile Phe Asp Tyr LCVR (SEQ ID NO: 114) LCDR1, LCDR2 and LCDR3 are shown below: Gln Gly Ile Arg Asn Asp; Ala Ala Ser; and His Gln Asp Phe Asn Tyr Pro Trp Thr H4H12166P3 HCVR (SEQ ID NO: 122) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Asp Ser Val Ser Ser Ser Tyr; Ile Tyr Tyr Ser Gly Ser Ser; and Ala Arg Glu His Asn Val Asp Thr Thr Met Ile Phe Asp Tyr LCVR (SEQ ID NO: 106) LCDR1, LCDR2 and LCDR3 are shown below: Gln Gly Ile Arg Asn Asp; Ala Ala Ser; and Leu Gln Asp Phe Asn Tyr Pro Trp Thr H4H12166P4 HCVR (SEQ ID NO:98) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Asp Ser Val Ser Ser Ser Tyr; Ile Tyr Tyr Ser Gly Ser Ser; and Ala Arg Glu Gly Asn Val Asp Thr Thr Met Ile Phe Asp Tyr LCVR (SEQ ID NO: 130) LCDR1, LCDR2 and LCDR3 are shown below: Gln Gly Ile Arg Asn Asp; Ala Ala Ser; and Leu Gln Asp Phe Asn Tyr Pro Trp His H4H12166P5 HCVR (SEQ ID NO: 138) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Asp Ser Val Ser Ser Ser Tyr; Ile Tyr Tyr Ser Gly Ser Ser; and Ala Arg Glu Gly Asn Val Asp Thr Thr Met Ile His Asp Tyr LCVR (SEQ ID NO: 106) LCDR1, LCDR2 and LCDR3 are shown below: Gln Gly Ile Arg Asn Asp; Ala Ala Ser; and Leu Gln Asp Phe Asn Tyr Pro Trp Thr H4H12166P6 HCVR (SEQ ID NO: 146) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Asp Ser Val Ser Ser Ser Tyr; Ile Tyr Tyr Ser Gly Ser Ser; and Ala Arg Glu Gly Asn Val Asp His Thr Met Ile Phe Asp Tyr LCVR (SEQ ID NO: 106) LCDR1, LCDR2 and LCDR3 are shown below: Gln Gly Ile Arg Asn Asp; Ala Ala Ser; and Leu Gln Asp Phe Asn Tyr Pro Trp Thr H4H12166P7 HCVR (SEQ ID NO: 122) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Asp Ser Val Ser Ser Ser Tyr; Ile Tyr Tyr Ser Gly Ser Ser; and Ala Arg Glu His Asn Val Asp Thr Thr Met Ile Phe Asp Tyr LCVR (SEQ ID NO: 130) LCDR1, LCDR2 and LCDR3 are shown below: Gln Gly Ile Arg Asn Asp; Ala Ala Ser; and Leu Gln Asp Phe Asn Tyr Pro Trp His H4H12166P8 HCVR (SEQ ID NO: 146) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Asp Ser Val Ser Ser Ser Tyr; Ile Tyr Tyr Ser Gly Ser Ser; and Ala Arg Glu Gly Asn Val Asp His Thr Met Ile Phe Asp Tyr LCVR (SEQ ID NO: 114) LCDR1, LCDR2 and LCDR3 are shown below: Gln Gly Ile Arg Asn Asp; Ala Ala Ser; and His Gln Asp Phe Asn Tyr Pro Trp Thr H4H12166P9 HCVR (SEQ ID NO: 146) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Asp Ser Val Ser Ser Ser Tyr; Ile Tyr Tyr Ser Gly Ser Ser; and Ala Arg Glu Gly Asn Val Asp His Thr Met Ile Phe Asp Tyr LCVR (SEQ ID NO: 130) LCDR1, LCDR2 and LCDR3 are shown below: Gln Gly Ile Arg Asn Asp; Ala Ala Ser; and Leu Gln Asp Phe Asn Tyr Pro Trp His H4H12166P10 HCVR (SEQ ID NO: 138) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Asp Ser Val Ser Ser Ser Tyr; Ile Tyr Tyr Ser Gly Ser Ser; and Ala Arg Glu Gly Asn Val Asp Thr Thr Met Ile His Asp Tyr LCVR (SEQ ID NO: 130) LCDR1, LCDR2 and LCDR3 are shown below: Gln Gly Ile Arg Asn Asp; Ala Ala Ser; and Leu Gln Asp Phe Asn Tyr Pro Trp His H4H12167P HCVR (SEQ ID NO: 154) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Ser Asp Ser Tyr; Ile Gly Ser Ser Gly Asn Thr Phe; and Ala Arg Glu Glu Gly Asp Phe Trp Ser Ala Val Asp Ser LCVR (SEQ ID NO: 162) LCDR1, LCDR2 and LCDR3 are shown below: Gln Gly Ile Ser Ser Tyr; Thr Ala Ser; and Gln Gln Leu Asn Ser Tyr Pro Phe Thr H4H12168P HCVR (SEQ ID NO: 170) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Gly Gly His Ala; Ile Ser Ser Asp Gly Ser Asn Lys; and Ala Lys Glu Val Ala Pro Arg Tyr Tyr Tyr Tyr Tyr Gly Leu Asp Val LCVR (SEQ ID NO: 178) LCDR1, LCDR2 and LCDR3 are shown below: Gln Asp Ile Ser Asn Phe; Thr Ala Ser; and Gln Lys Tyr Ala Gly Ala Leu Thr H4H12169P HCVR (SEQ ID NO: 186) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Arg Ser Tyr Ala; Ile Gly Gly Asn Gly Val Thr Thr; and Val Gln Gly Gly Leu Gly Gly Tyr Phe Thr Gly Tyr LCVR (SEQ ID NO: 194) LCDR1, LCDR2 and LCDR3 are shown below: Gln Ser Ile Ser Thr Tyr; Asp Ala Ser; and Gln Gln Ser Tyr Ser Ala Pro Leu Thr H4H12170P HCVR (SEQ ID NO: 202) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Ser Gly Tyr Gly; Ile Trp Leu Asp Gly Ser Asn Asp; and Ala Arg Asp Gly Pro Val Ala Ala Ile Pro Asp Tyr LCVR (SEQ ID NO:210) LCDR1, LCDR2 and LCDR3 are shown below: Gln Ser Ile Ser Arg Trp; Lys Ala Ser; and Gln Gln Tyr Asn Thr Tyr Ser Tyr Thr H4H12171P HCVR (SEQ ID NO: 218) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Asp Glu Tyr Gly; Ile Thr Trp Asn Gly Gly Phe Thr; and Ala Arg Asp Gly Tyr Ser Ser Ser Trp Gly Ala Tyr Asp Ile LCVR (SEQ ID NO:226) LCDR1, LCDR2 and LCDR3 are shown below: Gln Ser Ile Ser Thr Tyr; Ala Ala Ser; and Gln Gln Ser Tyr Ser Thr Pro Tyr Thr H4H12175P HCVR (SEQ ID NO:234) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Asn Asp Tyr Ala; Ile Ser Gly Asp Gly Gly Asn Thr; and Ala Lys Asp Lys Gly Trp Asn Phe Gly Tyr Phe Asp Leu LCVR (SEQ ID NO:242) LCDR1, LCDR2 and LCDR3 are shown below: Gln Asn Ile Asp Thr Tyr; Asp Ala Ser; and Gln Gln Asn Asp Asn Ile Leu His Pro Leu Thr H4H12176P2 HCVR (SEQ ID NO: 250) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe His Ser Asn Arg Tyr Trp; Ile Lys Gln Asp Gly Ser Glu Glu; and Ala Arg Asp Arg Ser Thr Ser Trp Val Pro Tyr Trp Phe Phe Asp Leu LCVR (SEQ ID NO: 258) LCDR1, LCDR2 and LCDR3 are shown below: Gln Ser Ile Ser Ser Tyr; Ala Ala Ser; and Gln Gln Ser Tyr Ser Thr Pro Pro Ile Thr H4H12177P2 HCVR (SEQ ID NO: 266) HCDR1, HCDR2 and HCDR3 are shown below respectively: Asp Phe Ile Phe Lys Asp Tyr Ala; Ile Ser Gly Asp Gly Asp Thr Thr; and Ala Arg Asp Met Gly Trp Asn Phe Phe Gln Leu Gln Tyr LCVR (SEQ ID NO: 258) LCDR1, LCDR2 and LCDR3 are shown below: Gln Ser Ile Ser Ser Tyr; Ala Ala Ser; and Gln Gln Ser Tyr Ser Thr Pro Pro Ile Thr H4H12183P2 HCVR (SEQ ID NO: 274) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Gly Ser Ile Ile Arg Gly Ser Thr Tyr; Ser Tyr Tyr Ser Gly Thr Ala; and Thr Arg Glu Ile Gly Val Ala Gly Leu Phe Asp Ile LCVR (SEQ ID NO:282) LCDR1, LCDR2 and LCDR3 are shown below: Arg Ala Ser Gln Ser Val Ser Ser Ser Tyr Leu Ala; Gly Ala Ser Ser Arg Ala Thr; and Gln Gln Tyr Gly Ser Ser Pro Trp Thr H2M11682N HCVR (SEQ ID NO: 290) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Tyr Thr Phe Thr Gly Tyr Tyr; Ile Asn Pro Asn Ser Gly Gly Thr; and Ala Arg Asp Ala Pro Pro His Asp Val Phe Asp Ile LCVR (SEQ ID NO: 298) LCDR1, LCDR2 and LCDR3 are shown below: Gln Gly Ile Arg Asn Asp; Ala Ala Ser; and Leu Gln His Asn Ser Tyr Pro Leu Thr H2M11684N HCVR (SEQ ID NO:306) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Gly Ser Ile Ser Ser Gly Ala Tyr His; Ile Tyr Tyr Asn Gly Asp Thr; and Ala Gly Glu Lys Gln Leu Thr Ala Phe Asp Ile LCVR (SEQ ID NO:314) LCDR1, LCDR2 and LCDR3 are shown below: Gln Asp Ile Asn Asn Phe; Asp Ala Ser; and Gln Gln Tyr Asp His Phe Pro Tyr Thr H2M11694N HCVR (SEQ ID NO:322) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Phe Thr Phe Asp Asp Tyr Gly; Ile Asn Trp Asn Gly Asp Ser Thr; and Ala Arg Glu Asn Asn Trp Asn Phe Tyr Phe Asp Tyr LCVR (SEQ ID NO:330) LCDR1, LCDR2 and LCDR3 are shown below: Gln Ser Val Ser Ser Asn; Gly Ala Ser; and Gln Gln Tyr Asn Asn Trp Pro Trp Thr H2M11695N HCVR (SEQ ID NO:338) HCDR1, HCDR2 and HCDR3 are shown below respectively: Gly Asn Thr Leu Thr Glu Leu Ser; Phe Asp Pro Glu Asp Gly Asp Thr; and Ser Thr Val Gly Gly Pro Thr Ser Asp Cys LCVR (SEQ ID NO:346) LCDR1, LCDR2 and LCDR3 are shown below: Gln Asp Ile Ser Asn Tyr; Asp Ala Ser; and Gln Gln Tyr Asp Asn Leu Pro Ile Thr CDRs are underlined

[0118] In one embodiment of the present disclosure, the antibody or antigen-binding fragment thereof that specifically binds to C5 in the co-formulation of the present disclosure comprises: (1) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 2 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 10 (or a variant thereof); (2) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 18 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 26 (or a variant thereof); (3) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 34 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 42 (or a variant thereof); (4) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 50 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 58 (or a variant thereof); (5) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 66 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 74 (or a variant thereof); (6) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 82 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 90 (or a variant thereof); (7) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 98 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 106 (or a variant thereof); (8) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 98 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 114 (or a variant thereof); (9) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 122 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 106 (or a variant thereof); (10) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 98 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 130 (or a variant thereof); (11) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 138 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 106 (or a variant thereof); (12) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 146 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 106 (or a variant thereof); (13) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 122 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 130 (or a variant thereof); (14) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 146 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 114 (or a variant thereof); (15) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 146 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 130 (or a variant thereof); (16) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 138, as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 130 (or a variant thereof); (17) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 154 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 162 (or a variant thereof); (18) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 170 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 178 (or a variant thereof); (19) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 186 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 194 (or a variant thereof); (20) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 202 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 210 (or a variant thereof); (twenty one) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 218 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 226 (or a variant thereof); (twenty two) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 234 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 242 (or a variant thereof); (twenty three) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 250 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 258 (or a variant thereof); (twenty four) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 266 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 258 (or a variant thereof); (25) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 274 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 282 (or a variant thereof); (26) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 290 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 298 (or a variant thereof); (27) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 306 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 314 (or a variant thereof); (28) A HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 322 (or a variant thereof), as well as an LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 330 (or a variant thereof); and / or (29) a HCVR comprising HCDR1, HCDR2, and HCDR3 of a HCVR comprising the amino acid sequence shown in SEQ ID NO: 338 (or a variant thereof), as well as An LCVR comprising LCDR1, LCDR2, and LCDR3 of a LCVR comprising the amino acid sequence set forth in SEQ ID NO: 346 (or a variant thereof).

[0119] In one embodiment of the present disclosure, the antibody or antigen-binding fragment thereof that specifically binds to C5 in the co-formulation of the present disclosure comprises: (a) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 4 (or its variant), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 6 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 8 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 12 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 14 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 16 (or a variant thereof); (b) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 20 (or its variant), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 22 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 24 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 28 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 30 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 32 (or a variant thereof); (c) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 36 (or its variant), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 38 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 40 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 44 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 46 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 48 (or a variant thereof); (d) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 52 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 54 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 56 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 60 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 62 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 64 (or a variant thereof); (e) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 68 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 70 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 72 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 76 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 78 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 80 (or a variant thereof); (f) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 84 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 86 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 88 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 92 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 94 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 96 (or a variant thereof); (h) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 100 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 102 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 104 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 108 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 110 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 112 (or a variant thereof); (j) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 100 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 102 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 104 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 116 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 118 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 120 (or a variant thereof); (k) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 124 (or its variant), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 126 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 128 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 108 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 110 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 112 (or a variant thereof); (m) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 100 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 102 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 104 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 132 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 134 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 136 (or a variant thereof); (n) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 140 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 142 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 144 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 108 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 110 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 112 (or a variant thereof); (p) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 148 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 150 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 152 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 108 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 110 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 112 (or a variant thereof); (q) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 124 (or its variant), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 126 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 128 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 132 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 134 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 136 (or a variant thereof); (r) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 148 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 150 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 152 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 116 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 118 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 120 (or a variant thereof); (s) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 148 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 150 (or its variant), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 152 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 132 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 134 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 136 (or a variant thereof); (t) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 140 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 142 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 144 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 132 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 134 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 136 (or a variant thereof); (u) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 156 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 158 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 160 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 164 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 166 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 168 (or a variant thereof); (v) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 172 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 174 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 176 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 180 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 182 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 184 (or a variant thereof); (w) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 188 (or its variant), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 190 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 192 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 196 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 198 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 200 (or a variant thereof); (x) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 204 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 206 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 208 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 212 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 214 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 216 (or a variant thereof); (y) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 220 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 222 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 224 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 228 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 230 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 232 (or a variant thereof); (z) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 236 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 238 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 240 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 244 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 246 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 248 (or a variant thereof); (aa) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 252 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 254 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 256 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 260 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 262 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 264 (or its variant); (ab) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 268 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 270 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 272 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 260 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 262 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 264 (or a variant thereof); (ac) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 276 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 278 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 280 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 284 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 286 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 288 (or a variant thereof); (ad) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 292 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 294 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 296 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 300 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 302 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 304 (or a variant thereof); (ae) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 308 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 310 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 312 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 316 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 318 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 320 (or a variant thereof); (af) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 324 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 326 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 328 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 332 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 334 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 336 (or a variant thereof); and / or (ag) The heavy chain variable region comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 340 (or a variant thereof), HCDR2 comprising the amino acid sequence shown in SEQ ID NO: 342 (or a variant thereof), a HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 344 (or a variant thereof), and a light chain variable region comprising LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 348 (or its variant), LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 350 (or its variant), LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 352 (or a variant thereof).

[0120] In one embodiment of the present disclosure, the antibody or antigen-binding fragment thereof that specifically binds to C5 in the co-formulation of the present disclosure comprises: (i) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 2 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 10 (or a variant thereof); (ii) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 18 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 26 (or a variant thereof); (iii) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 34 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 42 (or a variant thereof); (iv) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 50 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 58 (or a variant thereof); (v) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 66 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 74 (or a variant thereof); (vi) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 82 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 90 (or a variant thereof); (vii) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 98 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 106 (or a variant thereof); (viii) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 98 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 114 (or a variant thereof); (ix) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 122 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 106 (or a variant thereof); (x) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 98 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 130 (or a variant thereof); (xi) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 138 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 106 (or a variant thereof); (xii) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 146 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 106 (or a variant thereof); (xiii) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 122 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 130 (or a variant thereof); (xiv) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 146 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 114 (or a variant thereof); (xv) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 146 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 130 (or a variant thereof); (xvi) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 138 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 130 (or a variant thereof); (xvii) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 154 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 162 (or a variant thereof); (xviii) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 170 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 178 (or a variant thereof); (xix) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 186 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 194 (or a variant thereof); (xx) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 202 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 210 (or a variant thereof); (xxi) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 218 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 226 (or a variant thereof); (xxii) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 234 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 242 (or a variant thereof); (xxiii) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 250 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 258 (or a variant thereof); (xxiv) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 266 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 258 (or a variant thereof); (xxv) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274 (or a variant thereof), and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282 (or a variant thereof); (xxvi) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290 (or a variant thereof), and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298 (or a variant thereof); (xxvii) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 306 (or a variant thereof), and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 314 (or a variant thereof); (xxviii) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 322 (or a variant thereof), and A light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 330 (or a variant thereof); and / or (xxix) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 338 (or a variant thereof), and A light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 346 (or a variant thereof).

[0121] In one embodiment of the present disclosure, the antibody or antigen-binding fragment thereof that specifically binds to C5 in the co-formulation of the present disclosure comprises a heavy chain comprising the following amino acid sequence: (SEQ ID NO:358) A light chain with the following amino acid sequence: (SEQ ID NO: 359); such an antibody may be referred to herein as pazelimab or REGN3918 (variable regions and CDRs are underlined).

[0122] Unless otherwise stated, "H2M11683N"; "H2M11686N"; "H4H12159P"; "H4H12161P"; "H4H12163P"; "H4H12164P"; "H4H12166P"; "H4H12 166P2"; "H4H12166P3"; "H4H12166P4"; "H4H12166P5"; "H4H12166P6"; "H4H12166P7"; "H4H12166P8"; "H4H1 2166P9";"H4H12166P10";"H4H12167P";"H4H12168P";"H4H12169P";"H4H12170P";"H4H12171P";"H4H12175P";"H4H12176P2";"H4H12177P2";"H4H12183P2";"H2M11682N";"H2M11684N";"H2M11694N" or"H2M11695N", refers to an anti-C5 antigen binding protein that specifically binds to C5, such as an antibody and an antigen-binding fragment thereof (including a multispecific antigen-binding protein), the anti-C5 antigen binding protein comprising: containing the sequences corresponding to the sequences specifically shown in Table A herein or Table 1 of WO2017 / 218515 (and the sequences shown therein) H2M11683N; H2M11686N; H4H12159P; H4H12161P; H4H12163P; H4H12164P; H4H12166P; H4H12 166P2; H4H12166P3; H4H12166P4; H4H12166P5; H4H12166P6; H4H12166P7; H4H12166P8; H4H1 2166P9;H4H12166P10;H4H12167P;H4H12168P;H4H12169P;H4H12170P;H4H12171P;H4H12175P;H4H12176P2;H4H12177P2;H4H12183P2;H2M11682N;H2M11684N;H2M11694N or H2M11695N The amino acid sequence of an immunoglobulin heavy chain or its variable region (V M)(e.g., SEQ ID NO: 2; 18; 34; 50; 66; 82; 98; 98; 122; 98; 138; 146; 122; 146; 146; 138; 154; 170; 186; 202; 218; 234; 250; 266; 274; 290; 306; 322 or 338) (or variants thereof), and / or containing the sequences corresponding to the sequences specifically shown herein in Table A herein or in Table 1 of WO2017 / 218515 (and the sequences shown therein); H2M11683N; H2M11686N; H4H12159P; H4H12161P; H4H12163P; H4H12164P; H4H12166P; H4H12166P2 ;H4H12166P3; H4H12166P4; H4H12166P5; H4H12166P6; H4H12166P7; H4H12166P8; H4H12166P9; H4H An immunoglobulin light chain or variable region thereof (V 12166P10; H4H12167P; H4H12168P; H4H12169P; H4H12170P; H4H12171P; H4H12175P; H4H12176P2; H4H12177P2; H4H12183P2; H2M11682N; H2M11684N; H2M11694N or H2M11695N) L )(for example, SEQ ID NO: 10; 26; 42; 58; 74; 90; 106; 114; 106; 130; 106; 106; 130; 114; 130; 130; 162; 178; 194; 210; 226; 242; 258; 258; 282; 298; 314; 330 or 346)(or variants thereof); and / or the anti-C5 antigen binding protein comprises: a heavy chain or V chain comprising its CDRs (CDR-H1 (or variants thereof), CDR-H2 (or variants thereof) and CDR-H3 (or variants thereof)) H , and / or a light chain or V chain containing its CDRs (CDR-L1 (or its variants), CDR-L2 (or its variants) and CDR-L3 (or its variants)) L In one embodiment of the present disclosure, V H is linked to an IgG constant heavy chain domain (e.g., IgG1 or IgG4 (e.g., IgG4(S228P mutation))) and / or V L Linked to a lambda or kappa constant light chain domain.

[0123] An "anti-C5" antibody or antigen-binding fragment, or an antibody or antigen-binding fragment that "specifically binds" to C5, has a K of at least 1 nM. D(i.e., an affinity of 1 nM or greater) (e.g., a K of about 0.1 or 0.2 nM) D ) binds to human C5.

[0124] In one embodiment of the invention, the anti-C5 antibody or antigen-binding fragment is missing the C-terminal lysine from the heavy chain. Interfering RNA (iRNA)

[0125] The present disclosure provides co-formulations comprising: an anti-C5 antibody or antigen-binding fragment thereof (e.g., H2M11683N; H2M11686N; H4H12159P; H4H12161P; H4H12163P; H4H12164P; H4H12166P; H4H12166P2; H4H12166P3; H4H12166P4; H4H12166P5; H4H12166P6 ; H4H12166P7; H4H12166P8; H4H12166P9; H4H12166P10; H4H12167P; H4H12168P; H4H12169P; H4H 12170P; H4H12171P; H4H12175P; H4H12176P2; H4H12177P2; H4H12183P2; H2M11682N; H2M11684N; H2M11694N; H2M11695N; kovalizumab, eculizumab, tertulumab, mubodina or ravulizumab; preferably, pazelizumab); and an iRNA (C5 iRNA) that affects RNA-induced silencing complex (RISC)-mediated cleavage of C5 gene RNA transcripts, such as Cemdisiran (e.g., Cemdisiran / pazelizumab). The C5 gene can be intracellular, such as intracellular in a subject (e.g., a human). The present disclosure provides an iRNA agent contained in a co-formulation of the present disclosure that affects RNA-induced silencing complex (RISC)-mediated cleavage of complement component C5 gene RNA transcripts.

[0126] Cemdisiran is a chemically synthesized double-stranded oligonucleotide sugar conjugate covalently linked to a ligand containing three GalNAc residues to facilitate targeted delivery to the liver. Figure 1 All nucleosides are modified with 2'-deoxy, 2'-methoxy, or 2'-fluoro groups and are linked by 3' to 5' phosphodiester linkages to form the sugar-phosphate backbone of the oligonucleotide.

[0127] The sense strand (A-125167) contains 21 nucleotides, and the antisense strand (A-125647) contains 25 nucleotides. The 3' end of the sense strand is conjugated to a triantennary GalNAc moiety (designated L96) via a phosphodiester linkage.

[0128] The antisense strand (A-125647) contains four phosphorothioate linkages, two consecutive phosphorothioate linkages at the 3' end and two at the 5' end. The sense strand (A-125167) contains two phosphorothioate linkages at the 5' end. The 21 nucleotides of the sense strand hybridize with the complementary 21 nucleotides of the antisense strand, thereby forming a duplex of 21 nucleotide base pairs with a 4-base overhang at the 3' end of the antisense strand. The bases involved in base pair formation are attached to the central point. Cemdisiran is preferably in the form of a salt, such as Na + salt forms, but the present disclosure includes free acid forms as well as other salt forms (e.g., Ca 2+ salts).

[0129] When the concentration of RNAi in a composition (e.g., a co-formulation of the present disclosure) is expressed herein as mass per volume (e.g., mg / ml), the RNAi is in salt form or free acid form. Preferably, when Cemdisiran is so referred to, Cemdisiran is in salt form, preferably Na + Salt form. + The presence of counterions is due to the net negative charge of the ribonucleotide phosphate backbone. The amount of free acid form of cemdisiran can be determined by adding Cemdisiran Na + The concentration of the salt form is obtained by multiplying by 0.9443.

[0130] The structure of cemdisiran sodium (ALN-62643) is shown below, with A-125167 at the top (5'-3') and A-125647 at the bottom (3'-5'): Af, Gf, and Uf = 2'-F ribonucleosides Am, Cm, and Um-2'-OMe ribonucleosides dT = thymidine S = phosphorothioate L96 is

[0131] A C5 iRNA that can be included in a co-formulation of the present disclosure comprises an RNA strand (e.g., an antisense strand) having a region that is about 30 nucleotides in length or less, e.g., at least 15, 15 to 30, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 23 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides, which region is substantially complementary to at least a portion of an mRNA transcript of a C5 gene.

[0132] In one embodiment of the present disclosure, the C5 iRNA is a glycoconjugate comprising a double-stranded RNA complementary to the C5 region, which is conjugated (e.g., via a linker) to a terminal monoantennary, or biantennary, or triantennary N-acetylgalactosamine (GalNAc) group, preferably triantennary N-acetylgalactosamine.

[0133] In one embodiment of the present disclosure, the iRNA agent that may be included in the co-formulation of the present disclosure comprises a single-stranded RNA that interacts with a target RNA sequence (e.g., a C5 target mRNA sequence) to guide the cutting of the target RNA. Without wishing to be bound by theory, it is believed that the long double-stranded RNA introduced into the cell is broken down into siRNA by a type III nuclease called Dicer (Sharp et al. (2001) Genes Dev. 15:485). The ribonuclease III-like enzyme Dicer processes dsRNA into short interfering RNAs of 19 to 23 base pairs with characteristic two-base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNA is then incorporated into an RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). After binding to the appropriate target mRNA, one or more endonucleases within RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Therefore, in one aspect, the present disclosure relates to single-stranded RNA (siRNA) that is produced within the cell and promotes the formation of the RISC complex to achieve silencing of the target gene, i.e., the C5 gene. Therefore, the term "siRNA" is also used herein to refer to iRNA as described above.

[0134] In another embodiment, the iRNA agent that may be included in the co-formulation of the present disclosure may be a single-stranded siRNA introduced into a cell or organism to inhibit a target mRNA. The single-stranded iRNA agent binds to the RISC endonuclease Argonaute 2, which then cuts the target mRNA. Single-stranded siRNA is typically 15 to 30 nucleotides and is chemically modified. The design and testing of single-stranded siRNA is described in U.S. Patent No. 8,101,348 and Lima et al., (2012) Cell 150: 883-894, each of which is incorporated herein by reference in its entirety. Any antisense nucleotide sequence described herein may be used as a single-stranded siRNA chemically modified as described herein or as described by Lima et al., (2012) Cell 150: 883-894.

[0135] In another embodiment, the iRNA used in the compositions, uses and methods of the present disclosure is a double-stranded RNA and is referred to herein as a "double-stranded iRNA agent," "double-stranded RNA (dsRNA) molecule," "dsRNA agent," or "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations relative to the target RNA (i.e., the C5 gene). In some embodiments of the present disclosure, the double-stranded RNA (dsRNA) triggers the degradation of the target RNA (e.g., mRNA) through a post-transcriptional gene silencing mechanism referred to herein as RNA interference or iRNA.

[0136] In one embodiment of the present disclosure, the iRNA is a double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises a sense strand and an antisense strand, wherein the sense strand comprises nucleotides that differ by no more than 3 nucleotides (e.g., at least 15 contiguous nucleotides) from the following nucleotide sequence of C5 (open reading frame underlined): (SEQ ID NO: 360), and the antisense strand comprises nucleotides that differ by no more than 3 nucleotides (e.g., at least 15 consecutive nucleotides) from the following nucleotide sequence: (SEQ ID NO:361).

[0137] In one embodiment of the present disclosure, the C5 iRNA (e.g., dsRNA) is characterized by the following structure: in, X 2'-deoxy-2'-fluoro X is 2'-O-methyl Z is thymidine -yes =Yes R1-Yes R-Yes See International Nonproprietary Names for Pharmaceutical Substance (INN) (Suggested INN: List 114), WHO Drug Information, Vol. 29, No. 4, 2015.

[0138] The present disclosure includes an iRNA that can be included in a co-formulation of the present disclosure, the iRNA being a double-stranded ribonucleic acid (dsRNA) agent for inhibiting complement component C5 expression (e.g., having a complementary region of 19 to 23 nucleotides in length and / or having a chain length of no more than 30 nucleotides), wherein the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand comprising a complementary region comprising at least 17 consecutive nucleotides that differ from the nucleotide sequence of 5′-UAUUAUAAAAAUAUCUUGCUUUU-3′ (SEQ ID NO: 364) by no more than 3 nucleotides, wherein one or more of the dsRNA nucleotides is modified. The dsRNA agent can comprise at least one modified nucleotide, e.g., modified with a 2′-deoxy, 2′-methoxy, and / or 2′-fluoro group; e.g., wherein substantially all nucleotides of the sense strand and the antisense strand are modified nucleotides. In addition, the sense strand can be conjugated to a ligand attached at the 3′ terminus, e.g., terminally modified with a triantennary GalNAc moiety.

[0139] Modified nucleotides that can be included in the dsRNA include 3' terminal deoxythymidine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides containing non-natural bases, nucleotides containing 5'-phosphorothioate groups, and terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups. The dsRNA can contain phosphorothioate and / or methylphosphonate internucleotide linkages.

[0140] dsRNA is double-stranded, but may comprise one or more overhangs, such as at the 3' end of one or more strands (eg, an overhang of 2 or more nucleotides).

[0141] The double-stranded RNA of the present disclosure may comprise a ligand (e.g., an N-acetylgalactosamine (GalNAc) derivative, In one embodiment of the present disclosure, the ligand is conjugated to the 3' end of the sense strand of the dsRNA.

[0142] In one aspect, the present disclosure provides double-stranded ribonucleic acid (dsRNA) agents for inhibiting complement component C5 expression that can be included in a co-formulation of the present disclosure, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence 5'-AAGCAAGAUAUUUUUAUAAUA-3' (SEQ ID NO: 365), and wherein the antisense strand comprises the nucleotide sequence 5'-UAUUAUAAAAAUAUCUUGCUUUU-3' (SEQ ID NO: 364), e.g., wherein one or more dsRNA nucleotides are modified; e.g., modified with 2'-deoxy, 2'-methoxy, and / or 2'-fluoro groups and / or terminally modified with a triantennary GalNAc moiety. In one embodiment, the dsRNA agent comprises at least one modified nucleotide, as described herein.

[0143] In one aspect, the present disclosure provides a double-stranded iRNA agent for inhibiting complement component C5 expression that can be included in a co-formulation of the present disclosure, wherein the double-stranded iRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 365, and the antisense strand comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 364, wherein substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at its 3' terminus. In one embodiment, the dsRNA agent comprises at least one modified nucleotide, as described herein.

[0144] In one embodiment, substantially all nucleotides of the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modified, 2'-fluoro modified, and 3' terminal deoxythymine (dT) nucleotides. In another embodiment, substantially all nucleotides of the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modified, 2'-fluoro modified, and 3' terminal deoxythymine (dT) nucleotides. In another embodiment, the modified nucleotides are short sequences of deoxythymine (dT) nucleotides. In another embodiment, the sense strand comprises two phosphorothioate internucleotide linkages at the 5' end. In one embodiment, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5' end and two phosphorothioate internucleotide linkages at the 3' end. In yet another embodiment, the sense strand is conjugated to one or more GalNAc derivatives connected at the 3' end by a branched, divalent, or trivalent linker.

[0145] In one embodiment, at least one of the modified nucleotides is selected from a 3'-terminal deoxythymidine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, a base nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, a phosphoramidate, a nucleotide containing a non-natural base, a nucleotide containing a 5'-thiophosphate group, and a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group.

[0146] In another embodiment, the modified nucleotide comprises a short sequence of 3' terminal deoxythymidine (dT) nucleotides.

[0147] In one embodiment, the length of the complementary region is at least 17 nucleotides. In another embodiment, the length of the complementary region is 19 to 21 nucleotides. In one embodiment, the length of the complementary region is 19 nucleotides. In one embodiment, the length of each chain is no more than 30 nucleotides. In one embodiment, at least one chain comprises a 3' overhang of at least 1 nucleotide. In another embodiment, at least one chain comprises a 3' overhang of at least 2 nucleotides. In one embodiment, the dsRNA agent further comprises a ligand. In one embodiment, the ligand is conjugated to the 3' end of the sense strand of the dsRNA agent. In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative. In one embodiment, the ligand is:

[0148] In one embodiment, the dsRNA agent is conjugated to a ligand as shown in the following scheme: And, wherein X is O or S. In one embodiment, X is O.

[0149] In one embodiment of the present disclosure, the C5 iRNA comprises an RNA strand complementary to an mRNA transcribed from the C5 gene sense strand DNA sequence AAGCAAGATATTTTTATAATA, e.g., wherein the iRNA is a dsRNA comprising another hybridized RNA strand.

[0150] In another aspect, the present disclosure provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence 5'-AAGCAAGAUAUUUUUAUAAUA-3' (SEQ ID NO: 366), and wherein the antisense strand comprises the nucleotide sequence 5'-UAUUAUAAAAAUAUCUUGCUUUUdTdT-3' (SEQ ID NO: 367).

[0151] In another aspect, the present disclosure provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence asasGfcAfaGfaUfAfUfuUfuuAfuAfauaL96 (SEQ ID NO: 368), and wherein the antisense strand comprises the nucleotide sequence usAfsUfuAfuaAfaAfauaUfCUfuGfCuUsUsudTdT (SEQ ID NO: 369).

[0152] In one embodiment of the present disclosure, the sense strand or antisense strand of a dsRNA that may be included in a formulation of the present disclosure comprises a sequence selected from the group consisting of: A-118320, A-118321, A-118316, A-118317, A-118332, A-118333, A-118396, A-118397, A-118386, A-118387, A-118312, A-118313, A-118324, A-118325, A-119324, A-119325, A-119332, A-119333, A-119328, A-119329, A-119322, A-119323, A-119324, A-119325, A-119334, A-119335, A-119330, A-119331, A-119326, A-119327, A-125167, A-125173, A-125647, A-125157, A-125173, and A-125127. In one embodiment, the dsRNA agent comprises at least one modified nucleotide. Table C. Sense and antisense RNA strands of C5 dsRNA (unmodified and modified strands shown) in, A = adenosine 3'-phosphate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate As = adenosine 3'-phosphorothioate C = cytidine-3'-phosphate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Cs = cytidine-3'-phosphorothioate G = guanosine 3'-phosphate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Gs = guanosine-3'-phosphorothioate T = 5'-methyluridine-3'-phosphate Tf = 2'-fluoro-5-methyluridine-3'-phosphate Tfs = 2'-fluoro-5-methyluridine-3'-phosphorothioate Ts = 5-methyluridine-3'-phosphorothioate U = uridine-3'-phosphate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate Us = uridine-3'-phosphorothioate N = any nucleotide (G, A, C, T or U) a=2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-0-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate t=2'-0-methyl-5-methyluridine-3'-phosphate ts = 2'-0-methyl-5-methyluridine-3'-phosphorothioate u=2'-0-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate s = phosphorothioate linkage L96 = N-[tris(GalNAc-alkyl)-aminodecanoyl)]-4-hydroxyprolinol Hyp-(GalNAc-alkyl)3 (dt) = deoxythymidine

[0153] In one embodiment of the present disclosure, the dsRNA comprises a pair of two of the following strands: A-118320&A-118321 A-118316&A-118317 A-118332&A-118333 A-118396&A-118397 A-118386&A-118387 A-118312&A-118313 A-118324&A-118325 A-119324&A-119325 A-119332&A-119333 A-119328&A-119329 A-119322&A-119323 A-119324&A-119325 A-119334&A-119335 A-119330&A-119331 A-119326&A-119327 A-125167&A-125173 or A-125647 A-125157&A-125173 or A-125647 A-125127&A-125173 or A-125647.

[0154] In one embodiment of the present disclosure, a C5 iRNA (e.g., Cemdisiran) comprises one or more galactosamines, e.g., three, e.g., represented by the following structure: wherein the wavy double helix-like structure represents the RNA portion of the molecule, and X is O or X is S; for example, However, in one embodiment of the present disclosure, the co-formulation of the present disclosure further comprises a degradation product represented by one or more of the following structures (wavy lines represent double-stranded RNA structures): (Cemdisiran Impurity 1) (Cemdisiran Impurity 2) (Cemdisiran impurity 3); One, two or three terminal N-acetylgalactosamine (GalNAc) residues are missing.

[0155] The iRNAs of the disclosure can be chemically linked through the RNA portion of the molecule to one or more ligands, moieties, or conjugates that enhance the activity, cellular distribution, or cellular uptake of the iRNA. Such moieties include, but are not limited to, lipid moieties, such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86:6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers, such as beryl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), aliphatic chains, such as dodecanediol or undecyl residues (Saison-Behmoaras et al., 1993). et al., EMBO J, 1991, 10: 1111-1118; Kabanov et al., FEBS Lett., 1990, 259: 327-330; Svinarchuk et al., Biochimie, 1993, 75: 49-54), phospholipids, such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18: 3777-3783), polyamines or polyethylene glycol chains (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18: 3777-3783), al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantaneacetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0156] The ligand can be a carbohydrate. Carbohydrate-conjugated RNA is conducive to the in vivo delivery of nucleic acids. "Carbohydrate" ligand used herein refers to a compound that is itself a carbohydrate consisting of one or more monosaccharide units, each of which has at least 6 carbon atoms (which can be linear, branched or cyclic), each carbon atom bonded to an oxygen, nitrogen or sulfur atom; or a compound having a carbohydrate moiety consisting of one or more monosaccharide units as a part thereof, each of which has at least six carbon atoms (which can be linear, branched or cyclic), each carbon atom bonded to an oxygen, nitrogen or sulfur atom. Representative carbohydrates include sugars (monosaccharides, disaccharides, trisaccharides and oligosaccharides containing about 4, 5, 6, 7, 8 or 9 monosaccharide units) and polysaccharides such as starch, glycogen, cellulose and polysaccharide gum. Specific monosaccharides include C5 and above (e.g., C5, C6, C7 or C8) sugars; disaccharides and trisaccharides include sugars with two or three monosaccharide units (e.g., C5, C6, C7 or C8).

[0157] In one embodiment, the carbohydrate conjugate used in the compositions and methods of the present disclosure is a monosaccharide. In one embodiment, the monosaccharide is N-acetylgalactosamine, e.g. When one of X or Y is an oligonucleotide, the other is hydrogen.

[0158] In some embodiments, the conjugates or ligands described herein can be linked to the iRNA oligonucleotide using a variety of cleavable or non-cleavable linkers. The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, such as an organic moiety that covalently links two parts of a compound. The linker typically comprises a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO2, SO2NH, or a chain of atoms such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl wherein one or more methylene radicals may be interrupted or terminated by O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycle; wherein R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is about 1 to 24 atoms, 2 to 24, 3 to 24, 4 to 24, 5 to 24, 6 to 24, 6 to 18, 7 to 18, 8 to 18 atoms, 7 to 17, 8 to 17, 6 to 16, 7 to 16, or 8 to 16 atoms. The linker can comprise a redox cleavable linking group, a phosphate-based cleavable linking group, an acid-cleavable linking group, an ester-based linking group, and / or a peptide-based cleavage group. Where x=1 to 30 and y=1 to 15; wherein y=1 to 30 and y=1 to 15; Where x=0 to 30 and y=1 to 15; wherein x=0 to 30, y=1 to 15 and z=1 to 20; wherein x=1 to 30, y=1 to 15 and z=1 to 20; wherein x=1 to 30, y=1 to 15 and z=1 to 20; when one of X or Y is an oligonucleotide, the other is hydrogen. In certain embodiments of the compositions and methods of the present disclosure, the ligand is one or more GalNAc (N-acetylgalactosamine) derivatives connected by a divalent or trivalent branched linker. Co-formulation

[0159] The present disclosure provides pharmaceutical co-formulations, preferably aqueous co-formulations, comprising a pharmaceutically acceptable carrier and the following separate components: (i) an anti-C5 antibody or antigen-binding fragment thereof (e.g., H2M11683N; H2M11686N; H4H12159P; H4H12161P; H4H12163P; H4H12164P; H4H12166P; H4H12166P2; H4H12166P3; H4H12166P4; H4H12166P5; H4H12166P 6; H4H12166P7; H4H12166P8; H4H12166P9; H4H12166P10; H4H12167P; H4H12168P; H4H12169P; H4H12170P; H4H 12171P; H4H12175P; H4H12176P2; H4H12177P2; H4H12183P2; H2M11682N; H2M11684N; H2M11694N; H2M11695N. preferably, valimulib, eculizumab, tertulumab, mubodina, or ravlizumab; preferably, pazelizumab) and; (ii) C5 iRNA, preferably a glycoconjugate, such as cemdisiran.

[0160] Co-formulations may be named in the format: Antibody / iRNA; for example, "Pazylimab / Cemdisiran" or "Cemdisiran / Pazylimab" refers to a co-formulation of the present disclosure comprising Pazylimab and Cemdisiran.

[0161] As used herein, co-formulation or pharmaceutical co-formulation refers to a formulation comprising an anti-C5 antigen binding protein (e.g., an antibody or antigen-binding fragment thereof), a C5 iRNA, and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include, for example, one or more excipients. In one embodiment of the present disclosure, the co-formulation of the present disclosure is aqueous, i.e., comprises water.

[0162] Pharmaceutical formulations containing anti-C5 antigen binding proteins can be prepared by mixing the antigen binding protein with one or more excipients (see, e.g., Hardman et al. (2001) Goodman and Gilman's The Pharmacological Basis ofTherapeutics, McGraw-Hill, New York, NY; Gennaro (2000) Remington: The Science and Practice of Pharmacy, Lippincott, Williams, and Wilkins, New York, NY; Avis et al. (eds.) (1993) Pharmaceutical Dosage Forms: Parental Medications, Marcel Dekker, NY; Lieberman et al. (eds) (1990) Pharmaceutical Dosage Forms: Tablets, Marcel Dekker, NY; Lieberman et al. (eds.) (1990) Pharmaceutical Dosage Forms: DisperseSystems, Marcel Dekker, NY; Weiner and Kotkoskie (2000) Excipient Toxicity andSafety, Marcel Dekker, Inc., New New York, NY).

[0163] The present invention provides a method for preparing a co-formulation, the method comprising combining: a C5 iRNA (e.g., Cemdisiran or its Na + salt; for example, wherein the C5 iRNA is reconstituted with water from a lyophilized composition thereof), an antibody or antigen-binding fragment thereof that specifically binds to C5 (e.g., pazylimab), a buffer (e.g., histidine), a viscosity reducer (e.g., L-arginine), a stabilizer (e.g., sucrose), and a nonionic surfactant (e.g., polysorbate 80); and optionally, adjusting the pH of the co-formulation to greater than or less than about 6 (e.g., about 6.5±0.2); and optionally, sterile filtering the co-formulation.

[0164] The present disclosure provides methods for preparing co-formulations of the present disclosure, comprising combining an RNAi (e.g., Cemdisiran) with an antibody or antigen-binding fragment (e.g., Pazylimab) (e.g., comprising a detectable amount of a β-hexosaminidase contaminant), and (i) adding GalNAc to the co-formulation and / or (ii) adjusting the pH of the co-formulation to about 6 or less than about 6 (e.g., within 0.5). In one embodiment of the present disclosure, additional excipients, such as buffers, viscosity reducers, stabilizers, and / or surfactants, are also combined. The co-formulations (e.g., Cemdisiran / Pazylimab) produced by such methods are part of the present disclosure. In one embodiment of the present disclosure, the antibody or fragment combined with the other components is initially in a batch containing a β-hexosaminidase contaminant and is diluted to 0.25, 0.5, or 0.75 fold when incorporated into the co-formulation.

[0165] A variety of viscosity reducers known in the art are used with co-formulations. A viscosity reducer is an agent that reduces the viscosity of a formulation. A viscosity reducer can also function as a tonicifier to adjust the osmolarity of the formulation. Such viscosity reducers include adipic acid; an amino acid or a salt thereof; (D- or L-) arginine; L-arginine HCl; (D- or L-) alanine; benzenesulfonic acid; caffeine; a dicarboxylic acid; an ester of citric acid; (D- or L-) glutamic acid; glycine; (D- or L-) histidine; an inorganic salt; L-ornithine; (D- or L-) lysine; proline; (D- or L-) phenylalanine; (D- or L-) serine; NaCl; pyridoxamine; pyridoxine; thiamine chloride phosphate dihydrate; triethyl citrate; (D- or L-) valine; and / or xanthine. In one embodiment of the present disclosure, the amino acid is an L-amino acid, such as L-arginine. L-Arginine acts as both a tonicity agent, a stabilizer, and a viscosity reducer. Arginine HCl reduces the degradation of cemdisiran and allows for a near-isotonic solution.

[0166] Stabilizers include agents that contribute to reducing the degradation (e.g., aggregation) of, for example, antibodies or Fabs. Polyols are sugar alcohols with multiple hydroxyls. Stabilizers include sugars or polyols, such as trehalose, sorbitol, mannitol, taurine, propanesulfonic acid, L-proline, sucrose, glycerol, threitol, maltitol, and / or polyethylene glycol (PEG, e.g., PEG3350).

[0167] Nonionic surfactants include molecules with uncharged head groups. Nonionic surfactants include nonionic surfactants containing polyoxyethylene moieties; sorbitan; polyoxyethylene glycol alkyl ethers, such as octaethylene glycol monododecyl ether; pentaethylene glycol monododecyl ether; polyoxypropylene glycol alkyl ethers; glucoside alkyl ethers, such as decyl glucoside, lauryl glucoside, octyl glucoside; polyoxyethylene glycol octylphenol ethers, such as triton X-100; polyoxyethylene glycol alkylphenol ethers, such as nonoxynol-9; glyceryl alkyl esters, such as glyceryl laurate; polyoxyethylene glycol dehydrated sorbitan. Sugar alcohol alkyl esters, such as polysorbates; Sorbitan alkyl esters, such as spans; Cocamide MEA, cocamide DEA, dodecyldimethylamine oxide; Block copolymers of polyethylene glycol and polypropylene glycol, such as poloxamer; and polyethoxylated tallow amine (POEA); Poloxamer 188, polyethylene glycol 3350, polyethylene glycol (e.g., PEG3350) or polysorbates such as polysorbate 80 (PS80) or polysorbate 20 (PS20). In one embodiment of the present disclosure, the nonionic detergent is polysorbate 20 (PS20), polysorbate 80 (PS80).

[0168] A buffer is a mixture of a weak acid and its conjugate base that resists changes in its pH and thus maintains the pH at a near constant value, or vice versa. A variety of buffers can be used in the co-formulations of the present disclosure, for example, histidine-based buffers, phosphate buffers, or citrate buffers. A histidine-based buffer is a buffer that contains histidine. Some examples of histidine buffers include histidine chloride, histidine hydrochloride, histidine acetate, histidine phosphate, and histidine sulfate.

[0169] The present disclosure encompasses co-formulations having any of the specifically recited components, eg, at the specifically recited concentrations, wherein the pH of the co-formulation is about 6.5.

[0170] In one embodiment of the present disclosure, the co-formulation contains the impurity β-hexosaminidase in an amount of, e.g., about 0.04 to about 0.17 micrograms / ml, e.g., when the pH of the co-formulation is less than or greater than about 6 (e.g., at least 0.5), e.g., 6.5.

[0171] For example, the present disclosure includes pharmaceutical co-formulations (e.g., Cemdisiran / Pazylimab) comprising: ● One or more C5 iRNAs, e.g., as described herein (e.g., Cemdisiran, preferably Na +170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395 or 400 mg / ml); wherein the content of the free acid form can be determined by adding Na + The form concentration was determined by multiplying by 0.9443; one or more anti-C5 antibodies or antigen-binding fragments thereof (e.g., pazelizumab), e.g., at a concentration of about 90 to about 275 mg / ml (e.g., about 90; 91; 92; 93; 94; 95; 96; 97; 98; 99; 100; 101; 102; 103; 104; 105; 106; 107; 108; 109; 110; 111; 112; 113; 114; 115; 116;117;118;119;120;121;122;123;124;125;126;127;128;129;130;131;132;133;134;135;136;137;138;139;140;141;142;143;144;145;146;147;148;149;150;151;152;1 53;154;155;156;157;158;159;160;161;162;163;164;165;166;167;168;169;170;171;172;173;174;175;176;177;178;179;180;181;182;183;184;185;186;187;188;189;19 0; 191; 192; 193; 194; 195; 196; 197; 198; 199; 200; 211, 220, 242, 274 mg / ml) or at least about 150 mg / ml, at least about 175 mg / ml, at least about 200 mg / ml, at least about 211 mg / ml, at least about 220 mg / ml, at least about 242 mg / ml or at least about 274 mg / ml); Viscosity reducing agents, such as L-arginine (e.g., L-arginine HCl) (e.g., at a concentration of about 40 to 140 mM, e.g., about 50 mM or 90 mM) (e.g., 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87 7, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139 or 140 mM); Stabilizers, such as sugars or polyols (e.g., at a concentration of about 0.8 to about 3.6% (w / v), such as about 1%) (e.g., 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6% (w / v)); a nonionic surfactant, such as polysorbate 80 (PS80) or polysorbate 20 (PS20) (e.g., at a concentration of about 0.025 to about 0.2% (w / v), e.g., about 0.075% (w / v) (e.g., 0.025, 0.05, 0.075, 0.1, 0.125, 0.15, 0.175, 0.2% (w / v))); a buffer, such as a histidine-based buffer (e.g., at a concentration of about 10 to about 50 mM, such as about 30 mM (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mM)); and having • A pH of about 5.5 to about 7.0, such as about 6.5; or within no less than 0.5 of pH 6.0.

[0172] In one embodiment of the disclosure, a co-formulation (e.g., Cemdisiran / Pazyrumab) comprises (e.g., such as, with a detectable amount of β-hexosaminidase, as discussed herein): a double-stranded C5 iRNA conjugated to a triantennary GalNAc moiety; and An anti-C5 antibody or antigen-binding fragment thereof, which is expressed and isolated from a mammalian host cell containing β-hexosaminidase, a pH above or below 6.0 (at least 0.5); C5 iRNA (e.g., C5 iRNA conjugated to a triantennary GalNAc moiety), an anti-C5 antibody or antigen-binding fragment thereof (e.g., an anti-C5 antibody or antigen-binding fragment thereof expressed and isolated from a mammalian host cell containing β-hexosaminidase), buffer, Viscosity reducers, stabilizers, and Nonionic surfactants; C5 iRNA (e.g., C5 iRNA conjugated to a triantennary GalNAc moiety), an anti-C5 antibody or antigen-binding fragment thereof (e.g., an anti-C5 antibody or antigen-binding fragment thereof expressed and isolated from a mammalian host cell containing β-hexosaminidase), Histidine-based buffers, L-arginine, stabilizers, and Nonionic surfactants; C5 iRNA (e.g., C5 iRNA conjugated to a triantennary GalNAc moiety), an anti-C5 antibody or antigen-binding fragment thereof (e.g., an anti-C5 antibody or antigen-binding fragment thereof expressed and isolated from a mammalian host cell containing β-hexosaminidase), Histidine-based buffers, L-arginine, sugars or polyols, and Nonionic surfactants; Cemdisiran, Pazelimumab (e.g., pazelimumab expressed and isolated from a mammalian host cell containing β-hexosaminidase), Histidine-based buffers, L-arginine, stabilizers, and nonionic surfactants, pH about 6.5; Cemdisiran, Pazelimumab (e.g., pazelimumab expressed and isolated from a mammalian host cell containing β-hexosaminidase), Histidine-based buffers, L-arginine, sucrose, and Polysorbate 80, pH about 6.5; 100(±10)mg / mL C5 iRNA, such as Cemdisiran(Na + form), 100 (±10) mg / mL anti-C5 antibody or an antigen-binding fragment thereof, such as pazelimumab (e.g., pazelimumab expressed and isolated from a mammalian host cell containing β-hexosaminidase), 50 (± 10) mM viscosity reducer, such as L-arginine (e.g. L-arginine HCl), 10(±2) mM buffer, such as a histidine-based buffer, 1.0 (± 0.2)% stabilizer, such as sucrose, 0.075 (± 0.00375)% nonionic surfactant, such as PS80, pH 6.5; 75(±7.5)mg / mL C5 iRNA, such as Cemdisiran(Na + form), 150 (±15) mg / mL anti-C5 antibody or an antigen-binding fragment thereof, such as pazelimumab (e.g., pazelimumab expressed and isolated from a mammalian host cell containing β-hexosaminidase), 75 (± 15) mM viscosity reducer, such as L-arginine (e.g. L-arginine HCl), 15 (± 3) mM buffer, such as a histidine-based buffer, 1.5 (± 0.3)% stabilizer, such as sucrose, 0.1125 (± 0.056)% nonionic surfactant, such as PS80, pH 6.5; 50(±5)mg / mL C5 iRNA, such as Cemdisiran(Na + form), 100 (±10) mg / mL anti-C5 antibody or an antigen-binding fragment thereof, such as pazelimumab (e.g., pazelimumab expressed and isolated from a mammalian host cell containing β-hexosaminidase), 75 mM (±15) viscosity reducer, such as L-arginine (e.g. L-arginine HCl), 15 (± 3) mM buffer, such as a histidine-based buffer, 1.5 (± 0.3)% stabilizer, such as sucrose, 0.1125 (± 0.056)% nonionic surfactant, such as PS80; pH 6.5; 50(±5)mg / mL C5 iRNA, such as Cemdisiran(Na + form), 100 (±10) mg / mL anti-C5 antibody or an antigen-binding fragment thereof, such as pazelimumab (e.g., pazelimumab expressed and isolated from a mammalian host cell containing β-hexosaminidase), 75 (± 15) mM viscosity reducer, such as L-arginine (e.g. L-arginine HCl), 35 (± 7) mM buffer, such as a histidine-based buffer, 1.5 (± 0.3)% stabilizer, such as sucrose, 0.1125 (± 0.056)% nonionic surfactant, such as PS80, pH 6.5; 100(±10)mg / mL C5 iRNA, such as Cemdisiran(Na + form), 100 (±10) mg / mL anti-C5 antibody or an antigen-binding fragment thereof, such as pazelimumab (e.g., pazelimumab expressed and isolated from a mammalian host cell containing β-hexosaminidase), 50 (± 10) mM viscosity reducer, such as L-arginine (e.g. L-arginine HCl), 30 (± 6) mM buffer, such as a histidine-based buffer, 1 (± 0.2)% stabilizer, such as sucrose, 0.075 (± 0.00375)% nonionic surfactant, such as PS80, pH 6.5; 50(±5)mg / mL C5 iRNA, such as Cemdisiran(Na + form), 100 (±10) mg / mL anti-C5 antibody or an antigen-binding fragment thereof, such as pazelimumab (e.g., pazelimumab expressed and isolated from a mammalian host cell containing β-hexosaminidase), 90 (± 18) mM viscosity reducer, such as L-arginine (e.g. L-arginine HCl), 30 (± 6) mM buffer, such as a histidine-based buffer, 1 (± 0.2)% stabilizer, such as sucrose, 0.075 (± 0.00375)% nonionic surfactant, such as PS80, pH 6.5; 100mg / mL Cemdisiran(Na + form), 100mg / mL pazelizumab, 50 mM L-arginine (e.g. L-arginine HCl), 30 mM histidine-based buffer, 1% (w / v) sucrose, 0.075% (w / v) PS80, pH 6.5; 50mg / mL Cemdisiran(Na + form), 100mg / mL pazelizumab, 90 mM L-arginine (e.g. L-arginine HCl), 30 mM histidine-based buffer, 1% (w / v) sucrose, 0.075% (w / v) PS80, pH 6.5; 100mg / mL Cemdisiran(Na + form), 100mg / mL pazelizumab, 50 mM L-arginine (e.g. L-arginine HCl), 10 mM histidine-based buffer, 1.0% sucrose, 0.075% PS80, pH 6.5; 75mg / mL Cemdisiran(Na + form), 150mg / mL pazelizumab, 75 mM L-arginine (e.g. L-arginine HCl), 15 mM histidine-based buffer, 1.5% sucrose, 0.1125% PS80, pH 6.5; 50mg / mL Cemdisiran(Na + form), 100mg / mL pazelizumab, 75 mM L-arginine (e.g. L-arginine HCl), 15 mM histidine-based buffer, 1.5% sucrose, 0.1125% PS80; pH 6.5; 50mg / mL Cemdisiran(Na + form), 100mg / mL pazelizumab, 75 mM L-arginine (e.g. L-arginine HCl), 35mM histidine-based buffer, 1.5% sucrose, 0.1125% PS80, pH 6.5; 100mg / mL Cemdisiran(Na + form), 100mg / mL pazelizumab, 50 mM L-arginine (e.g. L-arginine HCl), 30 mM histidine-based buffer, 1% sucrose, 0.075% PS80, pH 6.5; 47.2 mg / mL Cemdisiran (Free Acid Form, FAF) molecule, which can be in any salt form, such as Na + , 100mg / mL pazelizumab, 30 mM histidine, 90mM L-arginine, 1% (w / v) sucrose, 0.075% (w / v) polysorbate 80 (e.g., super refined grade (SR)), pH 6.5; 50mg / mL Cemdisiran(Na + form), 100mg / mL pazelizumab, 90 mM L-arginine (e.g. L-arginine HCl), 30 mM buffer, such as a histidine-based buffer, 1% stabilizer, such as sucrose, 0.075% PS80, pH 6.5; Optionally, any of the co-formulations presented herein further comprises GalNAc or GlcNAc, such as about 5% (w / v) GalNAc or GlcNAc.

[0173] In one embodiment of the disclosure, a co-formulation of the disclosure comprises an antibody and an iRNA and is combined with an additional therapeutic agent, such as, for example, an anticoagulant, warfarin, aspirin, heparin, phenindione, fondaparinux, idraparinux, a thrombin inhibitor, argatroban, lepirudin, bivalirudin, dabigatran, an anti-inflammatory drug, a corticosteroid, a non-steroidal anti-inflammatory drug (NSAID), an antihypertensive agent, an angiotensin-converting enzyme inhibitor, an immunosuppressant, vincristine, cyclosporin A, or methotrexate, the fibrinolytic agent ancrod, E-aminocaproic acid, plasmin inhibitor-a1, prostacyclin, defibrotide, a lipid-lowering agent, a hydroxymethylglutaryl CoA reductase inhibitor, an anti-CD20 agent, rituximab, an anti-TNFα agent, infliximab, an anti-epileptic agent, magnesium sulfate, a C3 inhibitor, and / or an antithrombotic agent.

[0174] The term "in combination" means that the co-formulation is provided together with (2) one or more additional therapeutic agents (e.g., methotrexate), which can be formulated as a single composition, e.g., for simultaneous delivery, or separately formulated as two or more compositions (e.g., a kit containing each component, e.g., with the additional therapeutic agent in a separate formulation). The components administered in combination with each other can be administered to a subject at the same time or at a different time when the other components are administered; for example, each administration can be given simultaneously (e.g., together in a single composition or substantially simultaneously during the same administration period) or non-simultaneously at one or more intervals within a given time period. In addition, the individual components administered in combination with each other can be administered to a subject by the same or by different routes. Thus, the present disclosure includes co-formulations in combination with additional therapeutic agents, as well as methods of treating or preventing a disease or disorder associated with C5 (e.g., PNH, MG, or CHAPLE) in a subject by administering a co-formulation of the present disclosure in combination with an additional therapeutic agent to a subject in need thereof.

[0175] The present disclosure includes the co-formulations described herein, wherein the concentration of the antibody and / or iRNA is ±10% of the indicated value; the concentration of the surfactant is ±50% of the indicated value; and / or the concentration of any other excipient (e.g., viscosity reducer, buffer, stabilizer) or pH is ±20% of the indicated value.

[0176] In one embodiment of the present disclosure, the co-formulation of the present disclosure, comprising about 0.04 to 0.17 micrograms / ml of beta-hexosaminidase (e.g., about 0.04, 0.05, 0.06, 0.06, 0.0605, 0.0605, 0.0605, 0.063, 0.07, 0.07, 0.0765, 0.078, 0.08, 0.14, 0.141, 0.15, 0.1525, 0.166, or 0.17 micrograms / ml (or not more than such amount)); ●It is a transparent to slightly milky liquid; ● Essentially free of visible particles; ● Has colorless to yellow color; ● characterized by a ratio of cemdisiran concentration: pazelizumab concentration of about 1:1, 1:2, 1:3, 1:4, 1:5, or 2:3, e.g., wherein the viscosity is less than about 20 cP or less than about 30 cP at 20°C; A viscosity of <30 cP (at 20°C) (e.g., about 6, 10, 20, or 30 cP); an osmolarity of 266 to 706 (e.g., about 266, 276, 286, 296, 306, 316, 326, 334, 336, 346, 356, 366, 376, 386, 396, 406, 416, 426, 436, 446, 456, 466, 476, 486, 496, 506, 516, 526, 536, 546, 556, 566, 576, 586, 596, 606, 616, 626, 636, 646, 656, 666, 676, 686, 696, or 706) mOsm / kg; Density of approximately 1.1 or 1.061 g / ml; pH of approximately 6.5 ± 0.2; a pH above 6, which resulted in significantly reduced degradation of cemdisiran at 40°C, 25°C, and 2°C to 8°C relative to pH 6; cemdisiran purity (%) as demonstrated by dIPRP is approximately 90.5% at t=0; 91.1% after 1 month storage at 2°C to 8°C; 90.8% after 3 months storage at 2°C to 8°C; 90% after 6 months storage at 2°C to 8°C; 88.8% after 9 months storage at 2°C to 8°C; 88.7% after 12 months storage at 2°C to 8°C; 89% after 18 months storage at 2°C to 8°C; 89.4% after 24 months storage at 2°C to 8°C; and / or 87.4% after 36 months storage at 2°C to 8°C, e.g., wherein the co-formulation is liquid (aqueous) during storage and comprises 100 mg / ml cemdisiran and 100 mg / ml pazelizumab (e.g., at pH 5.0). 6.0 below); for example, wherein the co-formulation comprises about 60.5 ng / ml of β-hex; cemdisiran purity (%) as demonstrated by dIPRP is approximately 90.8% at t=0; 90.6% after 1 month storage at 2°C to 8°C; 90.5% after 3 months storage at 2°C to 8°C; 89.4% after 6 months storage at 2°C to 8°C; 88.3% after 9 months storage at 2°C to 8°C; 87.8% after 12 months storage at 2°C to 8°C; 87.8% after 18 months storage at 2°C to 8°C; and / or 87.4% after 24 months storage at 2°C to 8°C, and / or about 85.4% after 36 months storage at 2°C to 8°C; for example, wherein the co-formulation is liquid (aqueous) during storage and comprises 75 mg / ml cemdisiran and 150 mg / ml pazelizumab (e.g., at pH 5.0). 6.0 below); for example, wherein the co-formulation comprises about 60.5 ng / ml of β-hex; cemdisiran single chain purity (%) as demonstrated by dIPRP is approximately 90.5% at t=0; 90.2% after 1 month storage at 25°C and 60% RH (relative humidity); 87.8% after 3 months storage at 25°C and 60% RH; 85.1% after 6 months storage at 25°C and 60% RH; 90% after 0.5 month storage at 40°C and 75% RH; 88.9% after 1 month storage at 40°C and 75% RH; and 85.8% after 3 months storage at 40°C and 75% RH; e.g., wherein the co-formulation is liquid (aqueous) during storage and comprises 100 mg / ml cemdisiran and 100 mg / ml pazyrumab (e.g., at pH 6.0); e.g., wherein the co-formulation comprises approximately 60.5 ng / ml β-hex; cemdisiran single chain purity (%) demonstrated by dIPRP of about 91.4% after about 48 hours of agitation and / or about 90.7% after about 4 freeze-thaw cycles, e.g., wherein the co-formulation is liquid (aqueous) and comprises 100 mg / ml cemdisiran and 100 mg / ml pazyrumab (e.g., at pH 6.0); cemdisiran purity (%) as demonstrated by dIPRP is approximately 90.8% at t=0; 88.8% after 1 month storage at 25°C and 60% RH; 85.9% after 3 months storage at 25°C and 60% RH; 82.3% after 6 months storage at 25°C and 60% RH; 88.9% after 0.5 month storage at 40°C and 75% RH; 87.3% after 1 month storage at 40°C and 75% RH; and 82.3% after 3 months storage at 40°C and 75% RH; e.g., wherein the co-formulation is liquid (aqueous) during storage and comprises 75 mg / ml cemdisiran and 150 mg / ml pazyrumab (e.g., at pH 6.0); e.g., wherein the co-formulation comprises approximately 60.5 or 91 ng / ml β-hex; cemdisiran purity (%) demonstrated by dIPRP of about 90.7% after about 48 hours of agitation and / or about 91.2% after about 4 freeze-thaw cycles, e.g., wherein the co-formulation is liquid (aqueous) during storage and comprises 75 mg / ml cemdisiran and 150 mg / ml pazyrumab (e.g., at pH 6.0); exhibits no greater (e.g., within 5%) increase in detectable high molecular weight species (HMW species) after stirring at 250 rpm on an orbital shaker for 48 hours in the presence of 0.025% nonionic surfactant (e.g., polysorbate 80) compared to in the presence of 0.050, 0.075, 0.100, 0.125, 0.150, 0.175, or 0.200% (w / v); for example, wherein the co-formulation comprises 50 or 100 mg / mL cemdisiran and 100 mg / mL pazyrumumab, e.g., 100 mg / mL cemdisiran, 100 mg / mL pazyrumumab, 50 mM arginine HCl, 30 mM histidine, 1% sucrose, X% PS80, pH 6.5, or 50 mg / mL Cemdisiran, 100 mg / mL pazelimumab, 90 mM arginine HCl, 30 mM histidine, 1% sucrose, X% PS80, pH 6.5 (wherein X is about 0.025% to about 0.2% (w / v), e.g., 0.075%); cemdisiran purity (%) as demonstrated by dIPRP is about 90.9% at t=0; about 90.1% after 1 month storage at 25°C, 60% RH; about 90.9% after 3 months storage at 25°C, 60% RH; about 90.4% after 6 months storage at 25°C, 60% RH; about 89.9% after 0.5 month storage at 40°C, 75% RH; about 89.7% after 1 month storage at 40°C, 75% RH; and / or about 89.5% after 3 months storage at 40°C, 75% RH; e.g., wherein the co-formulation is liquid (aqueous) during storage and contains 50 mg / ml cemdisiran and 100 mg / ml pazyrumab, pH 6, and 5% GlcNAc; e.g., wherein the co-formulation comprises about 78 ng / ml β-hex; cemdisiran purity (%) as demonstrated by dIPRP is about 90.8% at t=0; about 90.2% after 1 month storage at 25°C, 60% RH; about 90.8% after 3 months storage at 25°C, 60% RH; about 90.3% after 6 months storage at 25°C, 60% RH; about 89.5% after 0.5 month storage at 40°C, 75% RH; about 89.6% after 1 month storage at 40°C, 75% RH; and / or about 89.1% after 3 months storage at 40°C, 75% RH; e.g., wherein the co-formulation is liquid (aqueous) during storage and contains 50 mg / ml cemdisiran and 100 mg / ml pazyrumab, pH 6, and 5% GalNAc; e.g., wherein the co-formulation comprises about 78 ng / ml β-hex; cemdisiran purity (%) as demonstrated by dIPRP is about 90.5% at t=0; about 89.9% after 1 month storage at 25°C, 60% RH; about 90.8% after 3 months storage at 25°C, 60% RH; about 90.4% after 6 months storage at 25°C, 60% RH; about 90.1% after 0.5 month storage at 40°C, 75% RH; about 89.6% after 1 month storage at 40°C, 75% RH; and / or about 89.9% after 3 months storage at 40°C, 75% RH; e.g., wherein the co-formulation is liquid (aqueous) during storage and contains 100 mg / ml cemdisiran and 100 mg / ml pazyrumab, pH 6, and 5% GlcNAc; e.g., wherein the co-formulation comprises about 78 ng / ml β-hex; and / or cemdisiran purity (%) as demonstrated by dIPRP is about 91.1% at t=0; about 90% after 1 month storage at 25°C, 60% RH; about 91% after 3 months storage at 25°C, 60% RH; about 90.7% after 6 months storage at 25°C, 60% RH; about 90% after 0.5 month storage at 40°C, 75% RH; about 89.7% after 1 month storage at 40°C, 75% RH; and / or about 89.9% after 3 months storage at 40°C, 75% RH; e.g., wherein the co-formulation is liquid (aqueous) during storage and contains 100 mg / ml cemdisiran and 100 mg / ml pazyrumab, pH 6, and 5% GalNAc; e.g., wherein the co-formulation comprises about 78 ng / ml β-hex; Combination therapy regimen of anti-C5 and C5 iRNA

[0177] The present disclosure includes methods comprising administering to a subject in need thereof suffering from a disease, disorder, or condition associated with C5 an anti-C5 antibody or antigen-binding fragment thereof in combination with a C5 iRNA (e.g., in a co-formulation comprising both the antibody or fragment and the iRNA, e.g., as set forth herein) in an amount and at a frequency that achieves a safe and effective therapeutic response (combination therapy of the present disclosure).

[0178] In some embodiments, the present disclosure relates to the combined administration of one or more doses of an anti-C5 antibody or antigen-binding fragment thereof (e.g., Pazylimab) and one or more doses of a C5 iRNA (e.g., Cemdisiran). Preferably, administration is performed in a co-formulation of the present disclosure (as discussed herein), e.g., 100:100 or 50:100 (Cemdisiran mg / ml:Pazylimab mg / ml), e.g., in an injection volume of about 2 ml.

[0179] Generally, herein, co-formulations comprising Cemdisiran and Pazyrumab may be referred to in the following forms: 100: 100, 75: 150, or 50: 100. In such notations, when referring to such co-formulations, the first number represents mg / ml Cemdisiran and the second number represents mg / ml Pazyrumab.

[0180] A "dosing regimen" or "combination therapy dosing regimen" refers to a method for treating or preventing a disease or disorder or condition associated with C5, preferably PNH, comprising administering an amount of the combination therapy of the present disclosure at a frequency as discussed herein.

[0181] For example, the present disclosure encompasses methods for administering anti-C5 antibodies or antigen-binding fragments thereof, and C5 iRNA, comprising introducing the agent into a subject, e.g., by injection, e.g., by subcutaneous injection or intravenous infusion, e.g., on a schedule according to any of the dosing regimens discussed herein (e.g., about 400 mg of anti-C5 antibody or antigen-binding fragment (e.g., pazylimab) subcutaneously about every 2 to 4 weeks (± 3, 4, 5, 6, or 7 days) and about 200 mg of iRNA (e.g., cemdisiran) subcutaneously about every 4 weeks (± 3, 4, 5, 6, or 7 days)).

[0182] Thus, the present disclosure provides methods for treating or preventing a C5-related disease or disorder (e.g., dry AMD or MG; preferably PNH) in a subject in need thereof, the methods comprising administering to the subject an anti-C5 antibody or antigen-binding fragment thereof ("anti-C5 Ab") and a C5 iRNA according to: (i) one or more doses of about 400 mg subcutaneously of an anti-C5 Ab (e.g., pazelimab) and about 200 mg subcutaneously of a C5 iRNA (e.g., cemdisiran); (ii) about 400 mg of anti-C5 Ab (e.g., pazylimab) is administered subcutaneously about every 2 weeks, and about 200 mg of C5 iRNA (e.g., cemdisiran) is administered subcutaneously about every 4 weeks. Preferably, a single injection of a co-formulation comprising anti-C5 Ab and C5 iRNA is administered every 4 weeks (Q4W), and a separate additional injection of anti-C5 Ab, but not C5 iRNA, is administered on a biweekly basis (Q2W); (iii) subcutaneously administering about 400 mg of an anti-C5 Ab (e.g., pazylimab) about every 4 weeks and subcutaneously administering about 200 mg of a C5 iRNA (e.g., cemdisiran) about every 4 weeks, preferably a single injection of a co-formulation comprising the anti-C5 Ab and the C5 iRNA about every 4 weeks; or (iv) about 400 mg of anti-C5 Ab (eg, Pazylimab) and about 200 mg of C5 iRNA (eg, Cemdisiran) administered subcutaneously in about 4 ml about every 4 weeks in a 50:100 co-formulation.

[0183] In one embodiment of the present disclosure, the subject is simultaneously administered: About 400 mg of an anti-C5 antibody or antigen-binding fragment (e.g., pazelimumab) subcutaneously approximately every two to four weeks (±3, 4, 5, 6, or 7 days); and • About 200 mg of iRNA (eg, Cemdisiran) subcutaneously approximately every 2 to 4 weeks (eg, 4 weeks) (± 3, 4, 5, 6, or 7 days).

[0184] The present disclosure also includes embodiments wherein the following are concurrently administered to the subject: About 400 mg of anti-C5 antibody or antigen-binding fragment subcutaneously approximately every 2 weeks (± 3, 4, 5, 6, or 7 days); and ● C5 iRNA at a dose of 200 mg subcutaneously every 4 weeks (± 3, 4, 5, 6, or 7 days).

[0185] The present disclosure also includes embodiments wherein the following are concurrently administered to the subject: About 400 mg of anti-C5 antibody or antigen-binding fragment subcutaneously approximately every four weeks (±3, 4, 5, 6, or 7 days); and C5 iRNA at a dose of 200 mg subcutaneously every 4 weeks (±3, 4, 5, 6, or 7 days) (May be referred to herein as "Pazelimab Q4W and Cemdisiran" or "Pazelimab 400 mg SC Q4W + Cemdisiran 200 mg SC Q4W"). Switching from pazelimumab monotherapy

[0186] Dosing regimens, e.g., for treating a disease or disorder or condition associated with C5 (e.g., PNH), comprising anti-C5 and C5 iRNA, for subjects who have previously received pazelimumab monotherapy, e.g., as described herein, may be referred to herein as a "pazelimumab monotherapy switch" regimen.

[0187] In one embodiment of the invention, the regimen is as follows: On day 1 (7 to 8 days after the last dose of pazilimab monotherapy) or when the next dose of pazilimab monotherapy is due, the subject is started on: (1) Pazelimab 400 mg SC and Cemdisiran 200 mg SC every 4 weeks (Q4W); or (2) Pazelimab 400 mg SC every 2 weeks (Q2W) and Cemdisiran 200 mg SC Q4W.

[0188] Pazylimab monotherapy includes treatment of a disease or disorder or condition associated with C5 (preferably PNH) with pazylimab as the sole C5-specific inhibitor, or more specifically, as the sole anti-C5 antibody or antigen-binding fragment (e.g., without both pazylimab and eculizumab). In one embodiment of the present disclosure, prior to receiving the combination treatment of 400 mg of an anti-C5 antibody or antigen-binding fragment SC about every 2, 3, or 4 weeks and 400 mg of a C5 iRNA SC about every 4 weeks as discussed herein, the subject has received a dosing regimen according to the following: (i) one or more doses of about 30 mg / kg of antigen binding protein intravenously (IV); followed by (ii) one or more doses (e.g., weekly) of about 800 mg of pazelimumab subcutaneously (SC) [which may be referred to as a maintenance phase]; e.g., wherein the subject has PNH; or, (a) one or more doses, preferably only one dose, of about 30 mg / kg pazelimab intravenously (IV); followed by (b) one or more doses (e.g., weekly) of 10 mg / kg pazelimab subcutaneously (SC) [may be referred to as the maintenance phase], For example, where a subject suffers from CHAPLE or, (a) one or more doses, preferably only one dose, of about 30 mg / kg of pazelimab intravenously (IV); then (b) Pazelimab, subcutaneous (SC), at one or more doses (e.g., weekly) according to the following: - For body weight (BW) < about 10 kg: about 125 mg; - For BW ≥ 10 kg and < about 20 kg: about 200 mg; -For BW ≥ 20 kg and < about 40 kg: about 350 mg; - For BW ≥ 40 kg and < about 60 kg: about 500 mg; and - For BW ≥ 60 kg: approximately 800 mg; [May be called the maintenance phase] For example, where the subject suffers from CHAPLE; Wherein the subject has received one or more such doses and is switched to the combination therapy at any point (e.g., starting from the maintenance phase). In one embodiment of the present disclosure, the subject begins receiving the combination of anti-C5 and C5 iRNA on the day the next dose of pazyrumab monotherapy is expected to be administered, and also stops the monotherapy at that time. For example, where the subject is switched from pazyrumab monotherapy and receives the first dose of the combination after receiving: (i) one or more doses of about 800 mg of pazelizumab subcutaneously (SC); (ii) one or more doses of about 30 mg / kg pazelimab intravenously (IV); (iii) one or more doses of about 125 mg pazelizumab subcutaneously (SC); (iv) one or more doses of about 200 mg of pazelizumab subcutaneously (SC); (v) one or more doses of approximately: 350 mg pazelimumab subcutaneously (SC); (vi) one or more doses of approximately: 500 mg pazelizumab subcutaneously (SC); (vii) one or more doses of about 800 mg of pazelizumab subcutaneously (SC); (viii) one or more doses of 10 mg / kg pazelizumab subcutaneously (SC), e.g., wherein the first dose of the combination is received on the date the dose labeled (i), (ii), (iii), (iv), (v), (vi), (vii), or (viii) is due, or about 1 week after the last dose of pazelizumab monotherapy is received.

[0189] In one embodiment of the present disclosure, a subcutaneous single therapeutic dose of pazyrumab is administered in a formulation comprising about: 161 to 274 mg / mL or more of pazelizumab, and a pharmaceutically acceptable carrier comprising: a buffer; L-arginine; water; and optionally an oligosaccharide (e.g., sucrose, mannitol, dextrose, glycerol, TMAO (trimethylamine N-oxide), trehalose, ethylene glycol, glycine betaine, xylitol, or sorbitol); and optionally a non-ionic detergent (e.g., polysorbate 20, polysorbate 80), wherein the pH is as high as about 5.8, 6.1, or 5.5 to 6.1; and the viscosity is about 6.8, about 9.6, about 11.9, about 13.2, about 16.7, about 20.6, about 33.0, about 48.4, about 13.2 to 16.7, or about 6.8 to 48.4 at 20° C. After the formulation is introduced into an aqueous intravenous solution (e.g., 0.9% saline), an intravenous dose of pazelimumab monotherapy can be administered. Not receiving complement inhibitors

[0190] Complement inhibitor-naive or -unexperienced patients have never or recently (e.g., not within the last 1, 2, 3, 4, 5, or 6 months or within at least about 4 or 5 half-lives of the last complement inhibitor they received) received a complement inhibitor therapy (e.g., eculizumab, ravulizumab, pazelizumab).

[0191] In one embodiment of the present disclosure, a C5-related disease or disorder or condition (preferably PNH) is treated in a subject who has not received a complement inhibitor by a method comprising administering: On Day 1: a single loading dose of 30 mg / kg intravenously (IV) and (e.g., optionally followed by a delay of at least about 30 minutes) 400 mg subcutaneously (SC) of pazelimab, and cemdisiran 200 mg SC (combined maintenance dose); Starting on day 29 or approximately 4 weeks later: Pazelimumab 400 mg SC every 4 weeks (q4W), and cemdisiran 200 mg SC q4W (e.g., as a cemdisiran / pazelimab co-formulation).

[0192] In one embodiment of the present disclosure, a C5-related disease or disorder or condition (preferably PNH) is treated in a subject who has not received a complement inhibitor by a method comprising administering: (i) on about day 1, a single loading dose of about 30 mg / kg intravenously (IV) of an anti-C5 antibody or antigen-binding fragment, preferably pazyrumab, followed by about 400 mg subcutaneously (SC) of an anti-C5 antibody or fragment and about 200 mg SC of a C5 iRNA, preferably cemdisiran; and (ii) Starting on about day 29, a SC dose of about 400 mg of anti-C5 antibody or fragment Q4W and a SC dose of about 200 mg of C5 iRNA Q4W.

[0193] During the transition from eculizumab or ravelizumab to a therapy comprising an anti-C5 Ab (e.g., pazelizumab) and a C5 iRNA (e.g., cemdisiran), an additional dose of pazelizumab (e.g., a dose of 30 or 60 mg / kg IV) may be administered, for example, if a potential adverse event (AE) caused by a large drug-target-drug (DTD) immune complex is suspected or has occurred, and / or if systemic corticosteroids are administered for a type III hypersensitivity reaction. This additional dose will establish conditions of pazelizumab excess in the circulation and thereby minimize the risk of further immune complex formation. Switching from eculizumab

[0194] For example, as described above, a dosing regimen for a subject who has previously received eculizumab may be referred to herein as an "eculizumab switch" regimen. Preferably, the subject is being treated for a disease or disorder or condition associated with C5, such as PNH.

[0195] In one embodiment of the invention, the eculizumab switch regimen has the following lead-in loading phase and switch phase: Import

[0196] Initially, subjects remained on background therapy with eculizumab at its usual dose / frequency, and cemdisiran alone was introduced as follows: On Day 1 (the day the subject is scheduled to receive eculizumab, preferably while the subject is on a q2w maintenance regimen of eculizumab): Cemdisiran 200 mg SC and eculizumab ≥ 900 mg IV (the subject's usual dose). Note: Eculizumab, if not administered with cemdisiran on Day 1, may be administered up to 2 days after cemdisiran; On Day 15 (±2 days), for subjects on eculizumab q14 (labeled dose regimen): labeled eculizumab dose [for subjects on eculizumab more frequently than q14: patients are dosed within 2 days of their regularly scheduled dose]; Conversion On Day 29 (or week 4 (counted from Day 1) or about 2 weeks later or when the next eculizumab dose is due or about 1 to 2 half-lives of eculizumab): a 60 mg / kg IV loading dose of pazelizumab, and (e.g., optionally followed by a delay of at least about 30 minutes) pazelizumab 400 mg SC and cemdisiran 200 mg SC (e.g., as a cemdisiran / pazelizumab co-formulation); and Starting on day 57 (or week 8, or approximately 4 weeks later): Pazelimumab 400 mg subcutaneously and cemdisiran 200 mg subcutaneously every 4 weeks (± 7 days) (eg, as a cemdisiran / pazelimab co-formulation) [may be referred to as the maintenance phase]

[0197] In one embodiment of the invention, the half-life of eculizumab (e.g., in a subject with PNH) is about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 days, for example, about 11 days (Wijnsma et al., Pharmacology, Pharmacokinetics and Pharmacodynamics of Eculizumab, and Possibilities for an Individualized Approach to Eculizumab. Clin Pharmacokinet. 2019 Jul; 58(7): 859-874; Al-Ani et al., Eculizumab in the management of paroxysmal nocturnal hemoglobinuria: patient selection and special considerations. Ther Clin Risk Manag. 2016 Aug 1; 12: 1161-70).

[0198] In one embodiment of the present disclosure, the dosing regimen comprises: (i) an initial dose of eculizumab (at a conventional dose for subjects, e.g., ≥ about 900 mg) intravenously (on Day 1; e.g., on the day or up to 2 days before the next dose of eculizumab is due) and about 200 mg of C5 iRNA subcutaneously; (ii) up to about 14 days (±2 days) later, a second dose of eculizumab (at a conventional dose for subjects, e.g., ≥ about 900 mg); (iii) on about day 29 (week 4): an about 60 mg / kg intravenous (IV) dose of anti-C5 Ab, followed by an about 400 mg subcutaneous dose of anti-C5 Ab and an about 200 mg subcutaneous dose of C5 iRNA; and (iv) on day 57 (week 8) and thereafter, about 400 mg subcutaneous dose of anti-C5 Ab approximately every 4 weeks (± 3, 4, 5, 6, or 7 days), and about 200 mg subcutaneous dose of C5 iRNA approximately every 4 weeks (± 3, 4, 5, 6, or 7 days).

[0199] The prescribed dosing regimen for eculizumab for PNH (eg, in subjects 18 years of age or older) is as follows: 600 mg weekly for the first 4 weeks, then A fifth dose of 900 mg is given one week later, followed by ●900 mg every 2 weeks thereafter.

[0200] The prescribed dosing regimen for eculizumab in the treatment of aHUS is as follows: 900 mg weekly for the first 4 weeks, then A fifth dose of 1200 mg is given one week later, followed by ●1200 mg every 2 weeks thereafter.

[0201] Eculizumab is prescribed for the treatment of generalized myasthenia gravis or neuromyelitis optica spectrum disorder as follows: 900 mg weekly for the first 4 weeks, then A fifth dose of 1200 mg is given one week later, followed by ●1200 mg every 2 weeks thereafter. See also Prescribing Information. In one embodiment of the disclosure, the subject has previously received at least 12 weeks of eculizumab treatment.

[0202] In one embodiment of the present disclosure, eculizumab is administered to a subject at a dose obtained from a pharmaceutical formulation comprising 300 mg of eculizumab, polysorbate 80 (6.6 mg) (vegetable source), sodium chloride (263.1 mg), sodium phosphate dibasic (53.4 mg), sodium phosphate monobasic (13.8 mg), and water for injection, USP, at a pH of 7, in a volume of 30 mL. See also Prescribing Information. Switching from ravulizumab

[0203] For example, as described above, a dosing regimen for a subject who has previously received Ravelizumab may be referred to herein as a "Ravelizumab switch" regimen. Preferably, the subject is being treated for a disease or disorder or condition associated with C5, such as PNH.

[0204] In one embodiment of the present disclosure, the ravlizumab switching regimen is as follows: On Day 1 (4 weeks after the last dose of ravulizumab, preferably while subjects are receiving the q8w ravulizumab maintenance regimen): Cemdisiran 200 mg SC; On day 29 or 4 weeks later or 8 weeks after the last dose of ravlizumab or 1 to 2 half-lives of ravlizumab: a single IV loading dose of pazelizumab at 30 mg / kg or 60 mg / kg, and (e.g., optionally followed by a delay of at least about 30 minutes) pazelizumab 400 mg SC and cemdisiran 200 mg SC (e.g., as a cemdisiran / pazelizumab co-formulation); and • Starting on day 57 or 4 weeks later or after 1 to 2 half-lives of ravlizumab: Initiate a maintenance regimen of pazelizumab 400 mg SC every 4 weeks and cemdisiran 200 mg SC (e.g., as a cemdisiran / pazelizumab co-formulation) every 4 weeks.

[0205] In one embodiment of the invention, the half-life of ravulizumab (e.g., in a subject with PNH) is about 32 days (Stern et al., Ravulizumab: a novel C5 inhibitor for the treatment of paroxysmal nocturnal hemoglobinuria. Ther Adv Hematol. 2019 Sep 10; 10: 2040620719874728; Lee et al., Ravulizumab (ALXN1210) vs eculizumab in adult patients with PNH naive to complement inhibitors: the 301 study. Blood. 2019 Feb 7; 133(6): 530-539; Lee et al., Immediate, complete, and sustained inhibition of C5 with ALXN1210 reduces complement-mediated hemolysis in patients with paroxysmal nocturnal hemoglobinuria (PNH): interim analysis of a dose-escalation study[abstract].Blood.2016;128(22).Abstract 2428).

[0206] In one embodiment of the present disclosure, a subject is treated for a disease, disorder or condition associated with C5, preferably PNH, wherein the subject who previously received ravlizumab (e.g., according to a prescribed dosing regimen) and is being switched to a treatment regimen with a different anti-C5 antibody or antigen-binding fragment (anti-C5 Ab), preferably pazelizumab, and a C5 iRNA (the C5 iRNA), preferably cemdisiran, is administered: (i) C5 iRNA 200 mg SC on day 1 (e.g., 4 weeks (±7 days) or 26 days (±7 days) or 27 days (±7 days) or 28 days (±7 days) after the last dose of ravulizumab); (ii) On approximately day 29, a single IV loading dose of 30 mg / kg or 60 mg / kg of anti-C5 Ab. This IV loading dose may be followed by a 30-minute observation period. The IV dose may be followed by an additional loading dose of 400 mg SC of anti-C5 Ab and 200 mg SC of C5 iRNA; (iii) On approximately day 57, start a maintenance regimen of anti-C5 Ab 400 mg SC and C5 iRNA 200 mg SC, and may be followed by, (iv) Thereafter, anti-C5 Ab 400 mg SC and C5 iRNA 200 mg SC were administered approximately every 4 weeks.

[0207] The loading dose of ravulizumab on day 1 can be based on the patient's weight (≥40 kg to <60 kg, 2400 mg IV; ≥60 kg to <100 kg, 2700 mg IV; ≥100 kg, 3000 mg IV). The first maintenance dose, administered 2 weeks after the loading dose, is as follows: (≥40 kg to <60 kg, 3000 mg IV; ≥60 kg to <100 kg, 3300 mg IV; ≥100 kg, 3600 mg IV). Thereafter, the maintenance dose should be administered IV every 8 weeks (±7 days).

[0208] The maintenance dose of ravulizumab subcutaneously for adult patients weighing 40 kg or more (e.g., those with PNH or aHUS) is 490 mg once weekly. The subcutaneous dosing schedule allows for occasional variations of ±1 day from the scheduled dosing date, but subsequent doses should be administered according to the original schedule.

[0209] The prescribed dosing regimen for ravulizumab in the treatment of PNH is as follows: For patients weighing 5 to less than 10 kg, the loading dose is 600 mg and the maintenance dose is 300 mg every 4 weeks. For patients weighing 10 to less than 20 kg, the loading dose is 600 mg and the maintenance dose is 600 mg every 4 weeks. For patients weighing 20 to less than 30 kg, the loading dose is 900 mg and the maintenance dose is 2,100 mg every 8 weeks; For patients weighing 30 to less than 40 kg, the loading dose is 1200 mg and the maintenance dose is 2,700 mg every 8 weeks; For patients weighing 40 to less than 60 kg, the loading dose is 2,400 mg and the maintenance dose is 3,000 mg every 8 weeks. For patients weighing 60 to less than 100 kg, a loading dose of 2,700 mg and a maintenance dose of 3,300 mg every 8 weeks; and For patients weighing 100 kg or more, the loading dose is 3,000 mg and the maintenance dose is 3,600 mg every 8 weeks. See also Prescribing Information.

[0210] In adult patients with PNH who are greater than or equal to 40 kg body weight, the subcutaneous revlizumab maintenance dose can be 490 mg once a week. Patients who are not currently undergoing revlizumab or eculizumab treatment and who weigh ≥ 40 kg at the start of treatment can start a subcutaneous dose of revlizumab approximately 2 weeks after the intravenous revlizumab loading dose. Patients who are currently being treated with eculizumab and who weigh ≥ 40 kg at the time of the next planned eculizumab dose can start a subcutaneous dose of revlizumab approximately 2 weeks after the intravenous revlizumab loading dose. Patients who are currently being treated with revlizumab intravenously (IV) can start a subcutaneous dose of revlizumab approximately 8 weeks after the last intravenous revlizumab maintenance dose. In one embodiment of the present disclosure, the subject has previously received at least 24 weeks of revlizumab treatment. Table C. Summary of Eculizumab and Ravelizumab Switching Regimens *For example, 900 mg of eculizumab (IV)

[0211] As discussed, the subject may have previously received pazelimab monotherapy, e.g., at a subcutaneous (SC) dose of about 800 mg every 1, 2, 3, or 4 weeks (which may have previously received a loading dose of pazelimab, e.g., intravenously), or ravelizumab or eculizumab, e.g., according to a prescribed dosing regimen. Patients who have previously received pazelimab monotherapy, ravelizumab, or eculizumab may be at any stage of the prescribed dosing regimen for the antibodies prior to switching to a combination therapy of the present disclosure. For example, the subject may have received one or more loading doses and / or one or more maintenance doses of eculizumab. In one embodiment of the invention, prior to or on the same day as starting treatment with a monthly regimen of 400 mg of Pazlimab and 200 mg of Cemdisiran, when a subject is switched from eculizumab or Ravlizumab or another anti-C5 antibody or antigen-binding fragment thereof, the subject receives an intravenous loading dose of Pazlimab (e.g., 30 mg / kg or 60 mg / kg) and / or a single SC dose of Cemdisiran (e.g., 200 mg). The transition phase mitigates the risk of forming large DTD (drug-target-drug) immune complexes of Eculizumab-C5-Pazlimab during the switch from Eculizumab to the Pazlimab + Cemdisiran combination or forming large DTD (drug-target-drug) immune complexes of Ravlizumab-C5-Pazlimab during the switch from Eculizumab to the Pazlimab + Cemdisiran combination.

[0212] Pazylimab binds non-competitively to C5 with eculizumab and therefore has the potential to form heteromeric complexes containing large DTD immune complexes. In vitro, neither pazylimab nor eculizumab alone formed higher-order multimers with C5 greater than a 1:2 mAb:C5 complex. Pazylimab was added to preformed internal eculizumab:C5 complexes in the presence of excess pazylimab (5:1:1 pazylimab:internal eculizumab:C5) and in an equimolar ratio of total mAb to C5 (1:1:2 pazylimab:internal eculizumab:C5). With pazylimab in excess, the majority of samples (approximately 86%) contained free antibody and trimeric or pentameric complexes (mAb:C5 molar ratio of 2:1 or 3:2, respectively), with the remainder containing large HMW complexes. At equimolar ratios of total mAb and C5, the majority of samples (approximately 86%) contained large HMW complexes greater than pentamers. Although eculizumab and pazelizumab were able to form heteromeric complexes in combination with C5, the presence of excess pazelizumab reduced the formation of large, high-order immune complexes relative to conditions where total mAb and C5 were present at equimolar concentrations.

[0213] When switching from a regimen comprising an antibody that does not significantly compete with pazyrumab for binding to C5 (a non-competing antibody or antigen-binding fragment thereof (N / C Ab), e.g., eculizumab or ravelizumab), a transition phase is designed to mitigate the potential risk of formation of large DTD immune complexes of eculizumab-C5-pazyrumab, e.g., during the switch from eculizumab to the pazyrumab / cemdisiran combination. The transition phase can include an introduction dose of cemdisiran followed by a higher pazyrumab IV loading dose (60 mg / kg) than used in treatment-naive patients (30 mg / kg). The initial dose of cemdisiran (e.g., occurring on day 1) reduces C5 production and thereby reduces circulating levels of total C5 available for potential large DTD complex formation prior to the introduction of pazyrumab. To further minimize risk, the 60 mg / kg pazyrumab IV loading dose establishes a high pazyrumab:eculizumab molar ratio. This excess pazelizumab concentration, relative to equimolar concentrations of total antibody and C5, reduces the formation of high-order DTD immune complexes by ensuring saturation of C5 binding sites with pazelizumab. Based on the mean trough concentrations of eculizumab (prescribing information) and predicted pazelizumab concentrations, this IV loading dose results in a molar ratio of pazelizumab to eculizumab of approximately 17:1.

[0214] In cases where, for example, adverse events [AEs] that may be caused by large DTD (drug-target-drug) immune complexes are suspected and / or systemic corticosteroids are administered for type III hypersensitivity reactions, an additional dose of about 30 mg / kg IV of an anti-C5 antibody or antigen-binding fragment, preferably pazyrumumab, may be included. This additional dose will likely establish conditions of excess pazyrumumab in the circulation and thereby minimize the risk of further immune complex formation.

[0215] Therefore, this disclosure includes: Methods for reducing the likelihood of forming large DTD complexes and / or establishing an excess of pazelimumab (relative to those of an N / C antibody, such as eculizumab or ravelizumab, e.g., a ratio >1:1::pazelimumab:N / C Ab (greater than equimolar), e.g., about 17:1::pazelimumab:N / C Ab) in a subject prior to initiation of a regimen comprising cemdisiran and pazelimumab (as described herein, e.g., pazelimumab 400 mg SC Q4W and cemdisiran 200 mg SC Q4W); and A method for treating or preventing a C5-related disease or disorder (preferably PNH) in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of pazyrumab and a C5 iRNA (preferably cemdisiran), wherein the subject has previously received a treatment regimen comprising an antibody or antigen-binding fragment thereof that does not compete with pazyrumab for binding to C5 (a non-competing antibody or antigen-binding fragment thereof (N / CAb), such as eculizumab or ravlizumab), wherein the subject is administered: (1) a C5 iRNA (e.g., Cemdisiran) dose after the N / C Ab (e.g., Eculizumab or Ravelizumab) dose but before the first dose of Pazyrumab (e.g., Pazyrumab IV (e.g., 60 mg / kg) and / or Pazyrumab 400 mg SC Q4W and Cemdisiran 200 mg SC Q4W); or (1) a dose of C5 iRNA (e.g., Cemdisiran) after the N / C Ab dose but before the first dose of Pazelimab; then (2) an intravenous loading dose of pazelimab (e.g., 60 mg / kg), which is the first dose of pazelimab; or (1) an intravenous loading dose of pazelimab (e.g., 60 mg / kg) and a dose of pazelimab 400 mg SC every 4 weeks and cemdisiran 200 mg SC every 4 weeks; then (2) starting approximately 4 weeks thereafter (and continuing every 4 weeks thereafter), pazelimab 400 mg SC every 4 weeks and cemdisiran 200 mg SC every 4 weeks; or (1) a dose of C5 iRNA (e.g., Cemdisiran) approximately 4 weeks after the N / C Ab dose has been administered and prior to an intravenous loading dose of Pazelimab (e.g., 60 mg / kg) and doses of Pazelimab 400 mg SC Q4W and Cemdisiran 200 mg SC Q4W; then (2) starting approximately 4 weeks thereafter (and continuing every 4 weeks thereafter), Pazelimab 400 mg SC Q4W and Cemdisiran 200 mg SC Q4W; or (1) The dose of C5 iRNA (e.g., Cemdisiran) and non-competing antibody or fragment (N / C Ab) on the day the N / C Ab dose is due; (2) the next dose of N / C Ab, on the day such dose is due; (3) Pazelimab IV loading dose (e.g., 60 mg / kg) and Pazelimab 400 mg SC and Cemdisiran 200 mg SC after approximately 1 to 2 half-lives of N / C Ab or when the next dose of N / C Ab is due; (4) starting 4 weeks thereafter (and continuing every 4 weeks thereafter), pazelimab 400 mg SC Q4W and cemdisiran 200 mg SC Q4W; or (1) a dose of C5 iRNA (e.g., Cemdisiran) after approximately 1 to 2 half-lives of N / C Ab from its last dose, or on the day the next dose of N / C Ab is due, or after half of the interval between doses has passed since the last dose of N / C Ab; (2) after approximately another 1 to 2 half-lives of the N / C Ab, a Pazelimab IV loading dose (e.g., 60 mg / kg), Pazelimab 400 mg SC, and Cemdisiran 200 mg SC; and (3) Starting 4 weeks thereafter (and continuing every 4 weeks thereafter), pazelimab 400 mg SC Q4W and cemdisiran 200 mg SC Q4W.

[0216] Often, the initial or non-repeating dose may be referred to as a "loading" dose, and the repetitive subsequent doses may be referred to as "maintenance" doses.

[0217] In one embodiment of the invention, a large DTD complex refers to a complex that is larger than a pentameric complex (eg, 2:1 or 3:2::mAb:C5 molar ratio) or a complex with a molecular weight of 1000 kDa or greater.

[0218] In one embodiment of the invention, an excess of pazelizumab relative to N / C Ab (e.g., eculizumab or ravelizumab) refers to a molar excess of greater than 1:1::pazelizumab:N / C Ab (e.g., 17:1).

[0219] A dosing regimen comprising monthly doses of an anti-C5 antibody or antigen-binding fragment thereof (e.g., Pazylimab, e.g., about 400 mg) and a C5 iRNA (e.g., Cemdisiran, e.g., about 200 mg) can be referred to as a q4w or Q4W regimen.

[0220] A dosing regimen comprising a 2-weekly dose (eg, about 400 mg) of an anti-C5 antibody or antigen-binding fragment thereof and a monthly dose (eg, about 200 mg) of a C5 iRNA can be referred to as a q2w or Q2W regimen.

[0221] In one embodiment of the invention, the term "4 weeks" or "month" refers to about 28, 29 or 30 days (± 3, 4, 5, 6 or 7 days).

[0222] In one embodiment of the invention, the term "2 weeks" refers to about 14 days (± 3, 4, 5, 6 or 7 days).

[0223] Anti-C5 antibody or antigen-binding fragment thereof 400 mg SC Q4W refers to subcutaneous administration of about 400 mg of the antibody or fragment (eg, pazelimab) approximately every month, 4 weeks, or 28 days (± 3, 4, 5, 6, or 7 days).

[0224] Anti-C5 antibody or antigen-binding fragment thereof 400 mg SC Q2W refers to subcutaneous administration of about 400 mg of the antibody or fragment (eg, pazelimab) approximately every 2 weeks or 14 days (± 3, 4, 5, 6, or 7 days).

[0225] C5 iRNA 200 mg SC Q4W refers to subcutaneous administration of 200 mg iRNA (eg, Cemdisiran) approximately every 4 weeks or 28 days (± 3, 4, 5, 6, or 7 days).

[0226] As described herein, any dosing episode (e.g., one involving multiple doses of a drug) may be followed by an observation period of 30 minutes to 2 hours after the last administration, or for however long it is not likely that an adverse event will occur acutely in the judgment of the treating physician. Typically, on a given day, when a subject receives an intravenous dose and one or more subcutaneous doses, the intravenous dose is administered first; however, the scope of the present disclosure includes embodiments in which the doses are administered in any order, e.g., SC then IV then SC.

[0227] In one embodiment of the present disclosure, a subject receiving combination therapy of an anti-C5 Ab and a C5 iRNA achieves, or achieves and maintains, one or more of the following while receiving treatment: ● Stable hemoglobin; Not receiving red blood cell transfusions; ●No detectable and / or clinically significant amounts of drug-target-drug complexes (e.g., pazelimumab-C5-pazelimumab) have accumulated; ● Failure to accumulate detectable and / or clinically significant amounts of eculizumab-C5-pazelizumab complexes, for example, if the subject is switched from eculizumab treatment to combination therapy; ●No adverse events attributable to large DTD complexes, such as rash, fever, fatigue, rashes, or polyarthralgia; ●No decrease in hemoglobin ≥2 g / dL; ● No breakthrough hemolysis was experienced; CH50 levels in the blood were completely suppressed relative to the pre-treatment baseline and / or during any breakthrough hemolytic event; Improvement in fatigue compared to before treatment; An improvement of >5 points in the FACIT-Fatigue score compared to before treatment; Improvement in the European Organisation for Research and Treatment of Cancer Quality of Life Questionnaire - Core 30 (EORTCQLQ-C30) physical function score compared to before treatment; Improvement in GHS / QoL (Global Health Status / QoL Scale (GHS)) relative to pre-treatment; A decrease in lactate dehydrogenase (LDH) levels relative to pre-treatment levels; LDH ≤1.5 × upper limit of normal (ULN) relative to pre-treatment level; Achieve and maintain LDH ≤ 1.0 × ULN; A decrease in blood bilirubin levels compared to before treatment; A decrease in reticulocyte count relative to before treatment; A decrease in the alternative pathway hemolytic activity assay (AH50) relative to before treatment; PNH: A decrease in red blood cells and / or granulocytes compared to before treatment; Improvement in fatigue, shortness of breath, muscle weakness, headache, abdominal pain, back / leg pain, chest tightness, difficulty sleeping, difficulty thinking clearly, and / or difficulty swallowing, compared to before treatment; Improvement in renal function relative to before treatment, as measured by estimated glomerular filtration rate (eGFR); A decrease in free hemoglobin compared to before treatment; and / or ● Increase in haptoglobin levels relative to before treatment.

[0228] In one embodiment of the present disclosure, a subject receiving combination therapy of an anti-C5 Ab and a C5 iRNA achieves, or achieves and maintains, one or more of the following while receiving treatment: An increase of about 13 on the FACIT-Fatigue score when on the q4-week regimen or about 11 on the q2-week regimen, e.g., by about 2 weeks from the start of treatment; An increase of about 8 on the FACIT-Fatigue score when on the q4-week regimen, or about 8 on the q2-week regimen, e.g., by about 4 weeks from the start of treatment; An increase of about 11 on the q4-week regimen or about 7 on the q2-week regimen on the FACIT-Fatigue score, for example, by about 8 weeks from the start of treatment; An increase of about 11 on the q4-week regimen or about 8 on the q2-week regimen on the FACIT-Fatigue score, for example, by about 12 weeks from the start of treatment; An increase of about 12 on the FACIT-Fatigue score when on the q4-week regimen or about 9 on the q2-week regimen, e.g., by about 16 weeks from the start of treatment; An increase of about 11 on the q4-week regimen or about 4 on the q2-week regimen in the FACIT-Fatigue score, for example, by about 20 weeks from the start of treatment; An increase of about 12 on the FACIT-Fatigue score when on the q4-week regimen or about 11 on the q2-week regimen, e.g., by about 24 weeks from the start of treatment; An increase of about 11 on the q4-week regimen or about 9 on the q2-week regimen in the FACIT-Fatigue score, for example, by about 28 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 physical function score of approximately 23 when on a 4-week regimen, or an increase in the EORTC-QLQ-C30 physical function score of approximately 14 when on a 2-week regimen, for example, at approximately 2 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 physical function score of approximately 19 when on a q4-week regimen, or an increase in the EORTC-QLQ-C30 physical function score of approximately 13 when on a q2-week regimen, for example, at approximately 4 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 physical function score of approximately 22 when on a q4-week regimen, or an increase in the EORTC-QLQ-C30 physical function score of approximately 14 when on a q2-week regimen, for example, at approximately 8 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 physical function score of approximately 20 when on a 4-week regimen, or an increase in the EORTC-QLQ-C30 physical function score of approximately 17 when on a 2-week regimen, for example, at approximately 12 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 physical function score of approximately 19 when on the q4-week regimen, or an increase in the EORTC-QLQ-C30 physical function score of approximately 14 when on the q2-week regimen, for example, at approximately 16 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 physical function score of approximately 23 when on the q4-week regimen, or an increase in the EORTC-QLQ-C30 physical function score of approximately 11 when on the q2-week regimen, for example, at approximately 20 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 physical function score of approximately 20 when on the q4-week regimen, or an increase in the EORTC-QLQ-C30 physical function score of approximately 15 when on the q2-week regimen, for example, at approximately 24 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 physical function score of approximately 24 when on the q4-week regimen, or an increase in the EORTC-QLQ-C30 physical function score of approximately 20 when on the q2-week regimen, for example, at approximately 28 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 15 when on a q4-week regimen, or an increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 14 when on a q2-week regimen, for example, by approximately two weeks from the start of treatment; An increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 10 when on a q4-week regimen, or an increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 15 when on a q2-week regimen, for example, by approximately 4 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 9 when on the q4-week regimen, or an increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 9 when on the q2-week regimen, for example, by approximately 8 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 11 when on the q4-week regimen, or an increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 12 when on the q2-week regimen, for example, by approximately 12 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 12 when on the q4-week regimen, or an increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 8 when on the q2-week regimen, for example, by approximately 16 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 17 when on the q4w regimen, or an increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 6 when on the q2w regimen, for example, by approximately 20 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 15 when on the q4w regimen, or an increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 13 when on the q2w regimen, for example, by approximately 24 weeks from the start of treatment; An increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 14 when on the q4w regimen, or an increase in the EORTC-QLQ-C30 GHS / QoL score of approximately 13 when on the q2w regimen, for example, by approximately 28 weeks from the start of treatment; A FACIT-Fatigue score of approximately 45 (±4), for example, when on a q4w regimen, or a score of 43 (±8), for example, when on a q2w regimen, for example, by week 2 after the start of treatment; A FACIT-Fatigue score of approximately 40 (±11), for example, when on a q4w regimen, or a score of 40 (±10), for example, when on a q2w regimen, for example, by week 4 after the start of treatment; A FACIT-Fatigue score of approximately 43 (±7), for example, when on a q4w regimen, or a score of 39 (±11), for example, when on a q2w regimen, for example, by week 8 after the start of treatment; A FACIT-Fatigue score of approximately 44 (±7), for example, when on a q4w regimen, or a score of 40 (±9), for example, when on a q2w regimen, for example, by week 12 after the start of treatment; A FACIT-Fatigue score of approximately 44 (±5), for example, when on a q4w regimen, or a score of 41 (±11), for example, when on a q2w regimen, for example, by week 16 after the start of treatment; A FACIT-Fatigue score of approximately 43 (±7), for example, when on a q4w regimen, or a score of 37 (±13), for example, when on a q2w regimen, for example, by week 20 after the start of treatment; A FACIT-Fatigue score of approximately 44 (±7), for example, when on a q4w regimen, or a score of 43 (±9), for example, when on a q2w regimen, for example, by week 24 after the start of treatment; A FACIT-Fatigue score of approximately 44 (±7), for example, when on a q4w regimen, or a score of 42 (±10), for example, when on a q2w regimen, for example, by week 28 after the start of treatment; An EORTC-QLQ-C30 physical function score of approximately 94 (±9), for example, when on a q4w regimen, or a score of 85 (±19), for example, when on a q2w regimen, for example, by week 2 after the start of treatment; An EORTC-QLQ-C30 physical function score of approximately 90 (±9), for example, when on a q4w regimen, or a score of 84 (±19), for example, when on a q2w regimen, for example, by week 4 after the start of treatment; An EORTC-QLQ-C30 physical function score of approximately 93 (±7), for example, when on a q4w regimen, or a score of 84 (±19), for example, when on a q2w regimen, for example, by week 8 after the start of treatment; An EORTC-QLQ-C30 physical function score of approximately 91 (±9), for example, when on a q4w regimen, or a score of 88 (±16), for example, when on a q2w regimen, for example, by week 12 after the start of treatment; An EORTC-QLQ-C30 physical function score of approximately 90.0 (±9.6), for example, when on a q4w regimen, or 85.0 (±19.9), for example, when on a q2w regimen, for example, by week 16 after the start of treatment; An EORTC-QLQ-C30 physical function score of approximately 94 (±8), for example, when on a 4-week regimen, or a score of 82 (±19), for example, when on a 2-week regimen, for example, by week 20 after the start of treatment; An EORTC-QLQ-C30 physical function score of approximately 91 (±9), for example, when on a q4w regimen, or a score of 86 (±19), for example, when on a q2w regimen, for example, by week 24 after the start of treatment; An EORTC-QLQ-C30 physical function score of approximately 95 (±6), for example, when on a q4w regimen, or 91 (±17), for example, when on a q2w regimen, for example, by week 28 after the start of treatment; An EORTC-QLQ-C30 GHS / QoL score of approximately 76 (±18), for example, when on a q4w regimen, or 75 (±17), for example, when on a q2w regimen, for example, by week 2 after the start of treatment; An EORTC-QLQ-C30 GHS / QoL score of approximately 71 (±26), for example, when on a q4w regimen, or 76 (±23), for example, when on a q2w regimen, for example, by week 4 after the start of treatment; An EORTC-QLQ-C30 GHS / QoL score of approximately 69 (±21), for example, when on a q4w regimen, or 70 (±26), for example, when on a q2w regimen, for example, by week 8 after the start of treatment; An EORTC-QLQ-C30 GHS / QoL score of approximately 72 (±15), for example, when on a q4w regimen, or 73 (±20), for example, when on a q2w regimen, for example, by week 12 after the start of treatment; An EORTC-QLQ-C30 GHS / QoL score of approximately 72 (±22), for example, when on a q4w regimen, or a score of 69 (±29), for example, when on a q2w regimen, for example, by week 16 after the start of treatment; An EORTC-QLQ-C30 GHS / QoL score of approximately 77 (±20), for example, when on a q4w regimen, or a score of 67 (±25), for example, when on a q2w regimen, for example, by week 20 after the start of treatment; An EORTC-QLQ-C30 GHS / QoL score of approximately 76 (±19.0), for example, when on a q4w regimen, or 74 (±29), for example, when on a q2w regimen, for example, by week 24 after the start of treatment; and / or An EORTC-QLQ-C30 GHS / QoL score of approximately 75 (±17), for example, when on a q4w regimen, or a score of 74 (±24), for example, when on a q2w regimen, for example, by week 28 after the start of treatment. Achieving a given score or improvement in score (e.g., in terms of the EORTC-QLQ-C30 GHS / QoL score, the EORTC-QLQ-C30 physical function score, or the FACIT-fatigue score) includes embodiments in which the subject's condition is measured, for example, according to a relevant questionnaire or scale; and embodiments in which, although not measured using a questionnaire or scale, the subject's condition would achieve such a score or improvement if measured using a questionnaire or scale.

[0229] In one embodiment of the present disclosure, while being treated with the combination therapy of the present disclosure, a subject may be administered red blood cell (RBC) transfusions, for example, according to the following: RBC transfusion if the hemoglobin level is ≤9 g / dL and there are new onset or worsening signs or symptoms due to anemia severe enough to warrant a transfusion; or If the hemoglobin level is ≤7 g / dL, with or without symptoms or signs of anemia, red blood cell transfusion is indicated.

[0230] In one embodiment of the present disclosure, a subject receiving a combination therapy of the present disclosure receives "boost" therapy, e.g., if the subject experiences breakthrough hemolysis that is not due to a complement activation disorder (e.g., concurrent infection) and / or if the subject experiences a persistent (e.g., in 2 consecutive measurements spanning at least about 2 weeks) inadequate LDH response (i.e., LDH>1.5×ULN). Boost therapy comprises one or more doses of an anti-C5 antibody or antigen-binding fragment, preferably pazyrumab, and / or a C5 iRNA, preferably cemdisiran, in addition to the doses specified in the combination therapy as discussed herein, e.g., For subjects receiving pazelimab 400 mg SC Q4W (±3, 4, 5, 6, or 7 days) and cemdisiran 200 mg SC Q4W (±3, 4, 5, 6, or 7 days), subjects received a single 30 mg / kg pazelimab intravenous (IV) dose on the day of the boost and received the boosted pazelimab regimen of 400 mg Q2W (±3, 4, 5, 6, or 7 days) and cemdisiran 200 mg Q4W (±3, 4, 5, 6, or 7 days) starting on the day of the boost. For subjects receiving pazelimab 400 mg SC Q2W (±3, 4, 5, 6, or 7 days) and cemdisiran 200 mg SC Q4W (±3, 4, 5, 6, or 7 days), subjects received a single dose of 30 mg / kg pazelimab IV on the day of the boost and restarted the combination regimen of pazelimab 400 mg SC Q2W (±3, 4, 5, 6, or 7 days) and cemdisiran 200 mg SC Q4W (±3, 4, 5, 6, or 7 days) starting on the day of the boost.

[0231] In one embodiment of the present disclosure, subjects receiving intensive therapy (e.g., subjects receiving an eculizumab switch regimen) (preferably for the treatment of PNH) receive 30 mg / kg of pazelizumab IV on the day of initiation (e.g., they may continue to be initiated from day 57), and in addition receive a maintenance regimen of shortened frequency pazelizumab 400 mg SC Q2W (±3, 4, 5, 6, or 7 days) and cemdisiran 200 mg SC Q4W (±3, 4, 5, 6, or 7 days), for example, starting on the day of initiation, for a period of 32 weeks.

[0232] In some embodiments, the disclosed combination therapies comprise administering an anti-C5 antibody or antigen-binding fragment thereof to a subject in need thereof in one or more doses approximately four times a week, twice a week, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every eight weeks, once every twelve weeks, or less frequently, as long as a therapeutic response is achieved. In one embodiment, the disclosed anti-C5 antibody or antigen-binding fragment thereof (e.g., pazylimab) is administered to a subject once every two weeks or once every four weeks.

[0233] As used herein, the expression "in combination with" means administering the anti-C5 antibody or antigen-binding fragment thereof before, after, or simultaneously with the C5 iRNA. This expression includes sequential or simultaneous administration of the anti-C5 antibody or antigen-binding fragment thereof and the C5 iRNA.

[0234] In some embodiments, when the anti-C5 antibody or antigen-binding fragment thereof is administered "before" a C5 iRNA, the anti-C5 antibody or antigen-binding fragment thereof can be administered more than 12 weeks, about 12 weeks, about 11 weeks, about 10 weeks, about 9 weeks, about 8 weeks, about 7 weeks, about 6 weeks, about 5 weeks, about 4 weeks, about 3 weeks, about 2 weeks, about 1 week, about 150 hours, about 100 hours, about 72 hours, about 60 hours, about 48 hours, about 36 hours, about 24 hours, about 12 hours, about 10 hours, about 8 hours, about 6 hours, about 4 hours, about 2 hours, about 1 hour, about 30 minutes, about 15 minutes, or about 10 minutes before administration of the C5 iRNA.

[0235] In some embodiments, when the anti-C5 antibody or antigen-binding fragment thereof is administered "after" a C5 iRNA, the anti-C5 antibody or antigen-binding fragment thereof can be administered about 10 minutes, about 15 minutes, about 30 minutes, about 1 hour, about 2 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, about 72 hours, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 5 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, or more than 12 weeks after administration of the C5 iRNA.

[0236] As used herein, "simultaneous" administration means that the anti-C5 antibody or antigen-binding fragment thereof (e.g., Pazylimab) and the C5 iRNA (e.g., Cemdisiran) are administered to a subject in a single dosage form (e.g., co-formulated) or in separate dosage forms administered to the subject during the same treatment event, preferably within about 1 or 2 hours or 30 minutes or less (i.e., before, after, or at the same time) of each other, such as about 15 minutes or less, or about 5 minutes or less. If administered in separate dosage forms, each dosage form can be administered by the same route (e.g., both intravenously, subcutaneously, etc.); or, alternatively, each dosage form can be administered by a different route. In any case, for the purposes of this disclosure, administration of the components in a single dosage form, in separate dosage forms by the same route, or in separate dosage forms by different routes are all considered to be "simultaneous" administration. In one embodiment of the present disclosure, subcutaneous doses of the anti-C5 antibody or antigen-binding fragment and the C5 iRNA are administered simultaneously by injection into separate arms.

[0237] As used herein, "sequential" administration means administering each dose of the selected treatment to the subject at different time points, for example, on different days separated by a predetermined interval (e.g., hours, days, weeks, or months). For the purpose of illustration, sequential administration may include administering an initial dose of an anti-C5 antibody, or antigen-binding fragment thereof (or C5 iRNA), followed by one or more second doses of C5 iRNA (or anti-C5 antibody, or antigen-binding fragment thereof), optionally followed by one or more third doses of anti-C5 antibody, or antigen-binding fragment thereof (or C5 iRNA). For the purpose of illustration, sequential administration may include administering an initial dose of an anti-C5 antibody, or antigen-binding fragment thereof (or C5 iRNA), followed by one or more second doses of C5 iRNA (or anti-C5 antibody, or antigen-binding fragment thereof), and optionally followed by one or more third doses of C5 iRNA (or anti-C5 antibody, or antigen-binding fragment thereof).

[0238] As used herein, "initial," "secondary," and "tertiary" doses refer to the temporal order of administration. Thus, the "initial" dose is the dose administered at the beginning of the treatment regimen (also referred to as the "baseline dose"); the "secondary" dose is administered after the initial dose; and the "tertiary" dose is administered after the second dose. The initial, second, and third doses may all contain the same amount of the selected treatment, or may contain different amounts of the selected treatment. Treatment and administration

[0239] The co-formulations and / or combination therapies of the present disclosure (e.g., Cemdisiran / Pazylimab) can be used to treat or prevent diseases, disorders, or conditions associated with C5, comprising the steps of administering a therapeutically effective amount of an anti-C5 antibody or antigen-binding fragment and a C5 iRNA, preferably an anti-C5 antibody or antigen-binding fragment and a C5 iRNA in a co-formulation, for example, by a parenteral route, such as intramuscular (IM), subcutaneous (SC), intravenous (IV), or intravitreal (IVT) or intraocular injection. Preferably, about 400 mg of the antibody, preferably Pazylimab, is administered every about 2 to 4 weeks (e.g., 2, 3, or 4 weeks), while about 200 mg of the iRNA, preferably Cemdisiran, is administered about every 4 weeks.

[0240] In some embodiments, the disclosed co-formulations and / or combination therapies (e.g., Cemdisiran / Pazyrumab) can be used to treat or prevent myasthenia gravis (MG), e.g., a 100:100 co-formulation. Signs and symptoms of MG include, but are not limited to, weakness of the eye muscles (ophthalmospasm), drooping of one or both eyelids (ptosis), blurred or double vision (diplopia), changes in facial expression, difficulty swallowing, shortness of breath, speech problems (dysarthria), weakness in the arms, hands, fingers, legs, and / or neck. Severe weakness in myasthenia gravis can sometimes lead to respiratory failure. Thus, the present disclosure includes methods for treating or preventing MG in a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of a co-formulation of the present disclosure (e.g., by SC, IM, or IV injection). In one embodiment of the invention, such a therapeutically effective amount is any dosing regimen described herein (eg, one or more doses of 400 mg Pazyrumab SC and 200 mg Cemdisiran SC (eg, every 4 weeks)).

[0241] In some embodiments, the co-formulations and / or combination therapies disclosed herein (e.g., Cemdisiran / Pazyrumab) can be used to treat or prevent atypical hemolytic uremic syndrome (aHUS). Signs and symptoms of aHUS include, but are not limited to, platelet activation, hemolysis, systemic thrombotic microangiopathy (formation of blood clots in small blood vessels throughout the body) leading to stroke, heart attack, renal failure, and / or death, end-stage renal disease, permanent kidney damage, abdominal pain, confusion, edema, fatigue, nausea / vomiting, diarrhea, and microangiopathic anemia. Thus, the present disclosure includes methods for treating or preventing aHUS in a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of a co-formulation of the present disclosure (e.g., by SC, IM, or IV injection). In one embodiment of the invention, such a therapeutically effective amount is any dosing regimen described herein (eg, one or more doses of 400 mg Pazyrumab SC and 200 mg Cemdisiran SC (eg, every 4 weeks)).

[0242] In some embodiments, the disclosed co-formulations and / or combination therapies (e.g., Cemdisiran / Pazylimab) can be used to treat or prevent paroxysmal nocturnal hemoglobinuria (PNH), for example, a 50:100 co-formulation (Cemdisiran mg / ml:Pazylimab mg / ml). Signs and symptoms of PNH include, but are not limited to, red blood cell destruction, thrombosis (including deep vein thrombosis, pulmonary embolism), intravascular hemolytic anemia, red discoloration of urine, anemia symptoms such as fatigue, shortness of breath and palpitations, abdominal pain, and difficulty swallowing. Thus, the present disclosure includes methods for treating or preventing PNH in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a co-formulation of the present disclosure (e.g., by SC, IM, or IV injection). In one embodiment of the invention, such a therapeutically effective amount is any dosing regimen described herein (e.g., one or more doses of 400 mg Pazylimab SC and 200 mg Cemdisiran SC (e.g., every 4 weeks)).

[0243] In some embodiments, the disclosed co-formulations and / or combination therapies can be used to treat PNH patients (including PNH patients who have been switched from pazelimab monotherapy), for example, by controlling hemolysis without any breakthrough hemolytic events, achieving hemoglobin stabilization, and / or maintaining LDH normalization over a sustained period of time (e.g., at least 28 weeks). In some embodiments, the disclosed co-formulations and / or combination therapies can be used to treat PNH patients (including PNH patients who have been switched from pazelimab monotherapy), for example, by improving patient fatigue, improving global health status (GHS) / quality of life (QoL), and / or improving physical function compared to baseline.

[0244] In some embodiments, the disclosed co-formulations and / or combination therapies (e.g., Cemdisiran / Pazylimab) can be used to treat or prevent CHAPLE disease (CD55 deficiency with complement hyperactivation, angiopathic thrombosis, and protein-losing enteropathy). CHAPLE disease is characterized by symptoms such as inflammatory bowel disease, protein-losing enteropathy (which can be associated with hypoalbuminemia), hypogammaglobulinemia, intestinal lymphangiectasia, and / or thrombotic events. Thus, the present disclosure includes methods for treating or preventing CHAPLE in a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of a co-formulation of the present disclosure (e.g., by SC, IM, or IV injection). In one embodiment of the invention, such a therapeutically effective amount is any dosing regimen described herein (e.g., one or more doses of 400 mg Pazylimab SC and 200 mg Cemdisiran SC (e.g., every 4 weeks)).

[0245] In some embodiments, the disclosed co-formulations and / or combination therapies (e.g., Cemdisiran / Pazylimab) can be used to treat or prevent (including reducing or eliminating signs or symptoms thereof, or reducing complement activation associated therewith) diseases or disorders or conditions associated with C5, such as: disorders of inappropriate or undesirable complement activation; systemic inflammatory responses in post-pump syndrome caused by cardiopulmonary bypass or renal bypass; neurological disorders; renal disorders; hemodialysis complications; inflammatory disorders; inflammation of autoimmune diseases; thermal injury; immune complex disorders; autoimmune diseases or proteinuric kidney diseases. Thus, the present disclosure includes methods for treating or preventing any such disorder in a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of a co-formulation of the present disclosure (e.g., by SC, IM, or IV injection). In one embodiment of the invention, such a therapeutically effective amount is any dosing regimen described herein (e.g., one or more doses of 400 mg Pazylimab SC and 200 mg Cemdisiran SC (e.g., every 4 weeks)).

[0246] In some embodiments, the disclosed co-formulations and / or combination therapies (e.g., Cemdisiran / Pazelimab) can be used to treat or prevent (including reducing or eliminating signs or symptoms thereof, or reducing complement activation associated therewith) diseases or disorders or conditions associated with C5, such as: complement activation due to burns; hereditary CD59 deficiency; renal ischemia; post-ischemia-reperfusion disorder; adult-onset respiratory distress syndrome; Alport syndrome; Alzheimer's disease; atherosclerosis; bullous pemphigoid; C3 glomerulopathy; capillary leak syndrome; Crohn's disease; diabetes; diabetic nephropathy; epilepsy; glomerulopathy; Guillain-Barré syndrome; hemolytic anemia; hyperacute allograft rejection Rejection; infectious diseases; interleukin-2-induced toxicity during IL-2 therapy; lupus nephritis; membranoproliferative glomerulonephritis; mesenteric artery reperfusion after aortic remodeling; multiple sclerosis; myasthenia gravis; myocardial infarction; neuromyelitis optica; complement activation caused by obesity; Parkinson's disease; progressive renal failure; psoriasis; renal ischemia-reperfusion injury; rheumatoid arthritis; schizophrenia; SLE nephritis; stroke; systemic lupus erythematosus (SLE); traumatic brain injury; vasculitis; xenograft rejection; CHAPLE disease / syndrome (CD55 deficiency with complement hyperactivation, vasculothrombosis, and PLE); complement activation caused by pernio; complement activation caused by sepsis. Accordingly, the present disclosure includes methods for treating or preventing any such condition or disease in a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of a co-formulation of the present disclosure (e.g., by SC, IM, or IV injection). In one embodiment of the invention, such a therapeutically effective amount is any dosing regimen described herein (eg, one or more doses of 400 mg Pazyrumab SC and 200 mg Cemdisiran SC (eg, every 4 weeks)).

[0247] In some embodiments, the co-formulations and / or combination therapies disclosed herein (e.g., Cemdisiran / Pazyrumab) can be used to treat or prevent (including reducing or eliminating signs or symptoms thereof, or reducing complement activation associated therewith) diseases or disorders or conditions associated with C5, such as: pulmonary diseases or disorders such as dyspnea, hemoptysis, ARDS, asthma, chronic obstructive pulmonary disease (COPD), emphysema, pulmonary embolism and infarction, pneumonia, fibrotic dust diseases, damage caused by inert dusts and minerals (e.g., silicon, coal dust, beryllium and asbestos), pulmonary fibrosis, organic dust diseases, chemical injury (due to irritant gases and chemicals such as chlorine, phosgene, sulfur dioxide, hydrogen sulfide, nitrogen dioxide, ammonia and hydrochloric acid), smoke injury, thermal injury (e.g., burns or frostbite), asthma, allergies, bronchoconstriction, hypersensitivity pneumonitis, parasitic diseases, Goodpasture's syndrome, pulmonary vasculitis, hereditary angioedema, or immune complex-associated inflammation. Thus, the present disclosure includes methods for treating or preventing any such condition or disease in a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of a co-formulation of the present disclosure (e.g., by SC, IM, or IV injection). In one embodiment of the invention, such a therapeutically effective amount is any dosing regimen described herein (e.g., one or more doses of 400 mg pazyrumab SC and 200 mg cemdisiran SC (e.g., every 4 weeks)).

[0248] In some embodiments, the co-formulations and / or combination therapies disclosed herein (e.g., Cemdisiran / Pazyrumab) can be used to treat or prevent (including reducing or eliminating signs or symptoms thereof, or reducing complement activation associated therewith) a disease or disorder or condition associated with C5, which is an eye disease such as age-related macular degeneration (AMD), diabetic macular edema (DME), diabetic retinopathy, ocular angiogenesis (formation of new blood vessels in the eye that affects the choroid, cornea, or retinal tissue), geographic atrophy (GA), uveitis, and neuromyelitis optica. The co-formulations of the present disclosure can be used to treat or ameliorate at least one sign and / or symptom of dry AMD or wet AMD. Accordingly, the present disclosure includes methods for treating or preventing any such condition or disease in a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of a co-formulation of the present disclosure (e.g., parenterally; or preferably by intraocular or intravitreal injection). In one embodiment of the invention, such a therapeutically effective amount is any dosing regimen described herein (eg, one or more doses of 400 mg Pazyrumab SC and 200 mg Cemdisiran SC (eg, every 4 weeks)).

[0249] "Treat," or variations thereof, means administering a co-formulation of the present disclosure (e.g., Cemdisiran / Pazelimumab) to a subject suffering from a disease, disorder, or condition associated with C5 such that one or more signs or symptoms in the subject are reduced or eliminated, e.g., by reducing complement activation associated therewith.

[0250] In a co-formulation for treating a disease, disorder or condition associated with C5, the therapeutically effective dose or amount of the anti-C5 antibody and C5 iRNA is each in the range of about 10 to 800 mg, administered once every 1, 2, 3, 4, 5, 6, 7 or 8 weeks.

[0251] As used herein, the subject or patient refers to a mammal, preferably a human. In one embodiment of the present disclosure, the subject suffers from a disease or disorder or condition associated with C5, such as PNH or MG or aHUS or CHAPLE. In one embodiment of the present disclosure, the subject is receiving or has previously received a therapeutic agent for the treatment of the disease or disorder (e.g., a complement inhibitor, such as kovalizumab, eculizumab, tertulumab, mubodina and / or ravlizumab) and is then switched to a co-formulation and / or combination therapy of the present disclosure comprising a different agent (e.g., cemdisiran / pazelimab). In one embodiment of the present disclosure, the subject is "treatment naive" having never previously received a complement inhibitor or having not recently received a complement inhibitor (e.g., within 1, 2, 3, 4, 5, or 6 months). In one embodiment of the present disclosure, the subject has been diagnosed with paroxysmal nocturnal hemoglobinuria, which has been confirmed by a history of high-sensitivity flow cytometry. In one embodiment of the present disclosure, the subject has a lactate dehydrogenase of at least 1.5 x ULN (upper limit of normal). Sahin et al., Pesg PNH diagnosis, follow-up and treatment guidelines. Am J Blood Res 2016; 6(2): 19-27. In one embodiment of the present disclosure, the subject or patient does not have any one or more of the following characteristics: History of bone marrow transplant or organ transplant ●Weight <40kg Any two of the following three abnormalities: a. Peripheral blood absolute neutrophil count (ANC) <500 / μL [<0.5×10 9 / L]; or b. Peripheral blood platelet count <20,000 / μL; or c. Abnormal peripheral blood reticulocyte count limited to <20,000 / μL or <1% Cytopenic bone marrow ≤ 25% based on age-adjusted history of bone marrow cytopenia and / or history of bone marrow cytopenia No record of meningococcal vaccination Not being able to take antibiotics for meningococcal prophylaxis Any active, ongoing, or recent infection requiring ongoing systemic treatment with antibiotics, antivirals, or antifungals within 2 weeks History of systemic fungal disease or unresolved tuberculosis (TB) or active or latent tuberculosis infection (LTBI) Hepatitis B surface antigen or hepatitis C virus RNA positive History of human immunodeficiency virus (HIV) infection SARS-CoV-2 infection Hereditary complement deficiencies History of active, uncontrolled, ongoing systemic autoimmune disease A history of cirrhosis or liver disease with current evidence of impaired liver function, or an ALT or AST level greater than 3 × ULN (not associated with PNH) eGFR <30 mL / minute / 1.73 m 2 (Based on the Chronic Kidney Disease-Epidemiology Collaboration 2009 [CKD-EPI]) Anticipated need for major surgery Cancer within the past 5 years, except for adequately treated basal cell skin cancer, squamous cell skin cancer, or cervical cancer in situ Allergy to pazelimab or cemdisiran Documented functional or anatomic asplenia Pregnant or breastfeeding women Women of childbearing potential who are unwilling to use highly effective contraception ●Not vaccinated against Streptococcus pneumoniae and / or Haemophilus influenza type B.

[0252] In one embodiment of the disclosure, the subject is receiving or has received a blood transfusion.

[0253] In one embodiment of the present disclosure, a subject receiving a co-formulation of the present disclosure to treat a disease, disorder or condition associated with C5 achieves a reduction in intravascular hemolysis or blood lactate dehydrogenase (LDH) levels and / or receives a reduction in blood transfusions compared to before starting treatment. Device

[0254] The present disclosure also provides an injection device comprising a co-formulation of the present disclosure (e.g., Cemdisiran / Pazerizumab). An injection device is a device that introduces a substance into a patient's body by a parenteral route, such as intramuscularly, subcutaneously, intravitreally, intraocularly, or intravenously. For example, an injection device can be a syringe (e.g., a prefilled syringe or an automatic syringe), which, for example, comprises a barrel or a tube for accommodating a fluid to be injected (e.g., a co-formulation), a needle for puncturing the skin and / or a blood vessel to inject the fluid; and a plunger for pushing the fluid out of the barrel and through the needle hole. In one embodiment of the present disclosure, the injection device comprising the co-formulation is suitable for subcutaneous, intravitreal, or intravenous (IV) injection. Such a device comprises a co-formulation in a cannula or trocar / needle that can be connected to tubing that can be connected to a bag or reservoir for containing a fluid (e.g., saline; or lactated Ringer's solution containing NaCl, sodium lactate, KCl, CaCl2, and optionally dextrose) that is introduced into the patient through the cannula or trocar / needle.

[0255] In one embodiment of the present disclosure, once the trocar and cannula are inserted into a vein of the subject and the trocar is removed from the inserted cannula, the co-formulation can be introduced into the device. The IV device can, for example, be inserted into a peripheral vein (e.g., in the hand or arm); the superior or inferior vena cava, or within the right atrium of the heart (e.g., a central IV); or inserted into the subclavian, internal jugular, or femoral veins and advanced toward the heart, for example, until it reaches the superior vena cava or right atrium (e.g., a central venous line).

[0256] In one embodiment of the present disclosure, the injection device is an automatic syringe, a jet syringe or an external infusion pump. A jet syringe uses a high-pressure narrow liquid jet that penetrates the epidermis to introduce the co-formulation into the patient's body. An external infusion pump is a medical device that delivers the co-formulation into the patient's body in a controlled amount. The external infusion pump can be electrically driven or mechanically driven. Different pumps operate in different ways. For example, a syringe pump contains fluid in the reservoir of a syringe and a movable piston controls fluid delivery, while an elastic pump contains fluid in a retractable balloon reservoir and pressure from the elastic wall of the balloon drives fluid delivery. In a peristaltic pump, a group of rollers squeeze downwards on the length of a flexible tube, pushing the fluid forward. In a multichannel pump, fluid can be delivered from multiple reservoirs at multiple rates. β-Hexosaminidase (β-Hex)

[0257] The present disclosure provides methods for reducing the level of β-hexosami...

Claims

1. A co-formulation comprising: a C5 iRNA conjugated to a ligand comprising one or more terminal N-acetylgalactosamine (GalNAc) and / or N-acetylglucosamine (GlcNAc) residues; An antibody or antigen-binding fragment thereof (anti-C5) that specifically binds to C5 and is isolated from a mammalian host cell; a pH greater than or less than about 6; and a pharmaceutically acceptable carrier.

2. A co-formulation comprising: C5 iRNA; An antibody or antigen-binding fragment thereof that specifically binds to C5; buffer; viscosity reducers; stabilizers; and nonionic surfactants; and The pH is greater than or less than about 6.

3. The co-formulation of any one of claims 1 to 2, which has a pH of about 6.5 or is within no less than 0.5 of a pH of 6.

0.

4. The co-formulation of any one of claims 1 to 3, comprising a buffer which is a histidine-based buffer, a citrate-based buffer, a phosphate-based buffer and / or an acetate-based buffer.

5. The co-formulation of any one of claims 1 to 4, comprising about 10 to 35, 35 to 45, 20 to 50, 20, 25, 30, 35, 40, 45, or 50 mM buffer.

6. The co-formulation of any one of claims 1 to 5, comprising a viscosity reducing agent, wherein the viscosity reducing agent is an inorganic salt and / or an amino acid.

7. The co-formulation of any one of claims 1 to 6, comprising a viscosity-lowering agent, which is (D- or L-)arginine, L-arginine HCl, (D- or L-)alanine, proline, (D- or L-)valine, glycine, (D- or L-)serine, (D- or L-)phenylalanine, (D- or L-)lysine, and (D- or L-)glutamic acid, and salts thereof; inorganic salts, NaCl, pyridoxamine, L-ornithine, thiamine chloride phosphate dihydrate, benzenesulfonic acid and / or pyridoxine.

8. The co-formulation of any one of claims 1 to 7, comprising about 20 to 140, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, or 140 mM viscosity reducing agent.

9. The co-formulation of any one of claims 1 to 8, comprising a stabilizer which is a polyol or a sugar.

10. The co-formulation of any one of claims 1 to 9, comprising a stabilizer selected from the group consisting of trehalose, sorbitol, mannitol, taurine, propanesulfonic acid, L-proline, sucrose, glycerol, threitol, maltitol, polyethylene glycol (PEG) and / or PEG3350.

11. The co-formulation of any one of claims 1 to 10, comprising about 0.8 to 3.6, 0.8, 0.9, 1.0, 1.25, 1.50, 2.0, 2.25, 2.50, 2.75, 3.00, 3.1, 3.2, 3.3, 3.4, 3.5, or 3.6% (w / v) stabilizer.

12. The co-formulation of any one of claims 1 to 11, comprising a nonionic surfactant which is a polyoxyethylene glycol alkyl ether; a glucoside alkyl ether; a polyoxyethylene glycol octylphenol ether; a polyoxyethylene glycol alkylphenol ether; a glycerol alkyl ester; a polyoxyethylene glycol sorbitan alkyl ester; a sorbitan alkyl ester; a block copolymer of polypropylene glycol; a block copolymer of polyethylene glycol; and / or a polysorbate.

13. The co-formulation of any one of claims 1 to 12, comprising a nonionic surfactant, wherein the nonionic surfactant is octaethylene glycol monododecyl ether; pentaethylene glycol monododecyl ether; polyoxypropylene glycol alkyl ether; decyl glucoside, lauryl glucoside, octyl glucoside; triton X-100; nonoxynol-9; glyceryl laurate; cocamide MEA, cocamide DEA, lauryl dimethylamine oxide; poloxamer; polyethoxylated tallow amine (POEA); polysorbate 20 (PS20) and / or polysorbate 80 (PS80).

14. The co-formulation of any one of claims 1 to 13, comprising about 0.025, 0.05, 0.075, 0.1, 0.125, 0.15, 0.175% (w / v) nonionic surfactant.

15. The co-formulation of any one of claims 1 to 14, further comprising one or more viscosity reducing agents.

16. The co-formulation of any one of claims 1 to 15, further comprising one or more viscosity reducing agents, each at a concentration of about 5 mM to about 100 mM.

17. The co-formulation of any one of claims 1 to 16, further comprising one or more viscosity reducing agents, each at a concentration of about 50 mM to about 75 mM.

18. The co-formulation of any one of claims 15 to 17, wherein the viscosity reducing agent is one or more of the following: an amino acid, a dicarboxylic acid, an inorganic salt, an ester of citric acid, and / or a xanthine.

19. The co-formulation of any one of claims 15 to 18, wherein the viscosity reducing agent is one or more of: Arginine; Adipic acid; NaCl; Lysine; Proline; Histidine; caffeine; Phenylalanine; and / or Triethyl citrate.

20. The co-formulation of any one of claims 15 to 19, wherein the viscosity reducing agent is an amino acid, the amino acid being its L-enantiomer or its D-enantiomer.

21. The co-formulation of any one of claims 15 to 20, wherein the viscosity-lowering agent is a conjugate base of an acidic viscosity-lowering agent or a salt thereof.

22. The co-formulation of any one of claims 1 to 21, comprising an anti-C5 antibody or antigen-binding fragment of about 96% or greater purity as assessed by size exclusion chromatography at 2°C to 8°C after about 1 month.

23. The co-formulation of any one of claims 10 to 22, comprising about 94% or greater purity of C5 iRNA as assessed by ion exchange chromatography at 2°C to 8°C after about 1 month.

24. The co-formulation of any one of claims 1 to 23, comprising the C5 iRNA and the anti-C5 antibody or antigen-binding fragment at a 1:1 ratio of mg / ml concentration.

25. The co-formulation of claim 24, wherein the viscosity reducing agent is arginine, adipate, NaCl, lysine, aspartate, proline, histidine, caffeine, phenylalanine and / or triethyl citrate.

26. The co-formulation of claim 25, wherein the viscosity reducing agent is 75 mM 75 mM arginine, 75 mM adipate, 75 mM NaCl, 75 mM lysine, 75 mM aspartate, 75 mM proline, 50 mM histidine (wherein, If the buffer is histidine-based, the total histidine concentration in the co-formulation is 50 mM), 50 mM caffeine, 50 mM phenylalanine and / or 75 mM triethyl citrate.

27. The co-formulation of any one of claims 1 to 26, comprising the C5 iRNA and the anti-C5 antibody or antigen-binding fragment at a 1:2 ratio of mg / ml concentration.

28. The co-formulation of claim 27, wherein the viscosity reducing agent is arginine, adipate, NaCl, lysine and / or aspartate.

29. The co-formulation of claim 28, wherein the viscosity reducing agent is 75 mM arginine, 75 mM adipate, 75 mM NaCl, 75 mM lysine and / or 75 mM aspartate.

30. The co-formulation of any one of claims 1 to 29, wherein the antibody or antigen-binding fragment thereof that specifically binds to C5 (anti-C5) comprises: (1) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence set forth in SEQ ID NO: 2, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence set forth in SEQ ID NO: 10; (2) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence set forth in SEQ ID NO: 18, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence set forth in SEQ ID NO: 26; (3) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 34, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 42; (4) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence set forth in SEQ ID NO: 50, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence set forth in SEQ ID NO: 58; (5) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 66, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 74; (6) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 82, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 90; (7) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 98, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 106; (8) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 98, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 114; (9) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 122, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 106; (10) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 98, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 130; (11) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 138, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 106; (12) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 146, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 106; (13) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 122, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 130; (14) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 146, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 114; (15) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 146, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 130; (16) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 138, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 130; (17) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 154, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 162; (18) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 170, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 178; (19) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 186, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 194; (20) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 202, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 210; (21) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 218, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 226; (22) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 234, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 242; (23) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 250, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 258; (24) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 266, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 258; (25) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 274, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 282; (26) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 290, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 298; (27) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 306, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 314; (28) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR having the amino acid sequence of SEQ ID NO: 322, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR having the amino acid sequence of SEQ ID NO: 330; and / or (29) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR having the amino acid sequence of SEQ ID NO: 338, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR having the amino acid sequence of SEQ ID NO:

346.

31. The co-formulation of any one of claims 1 to 30, wherein the antibody or antigen-binding fragment thereof that specifically binds to C5 (anti-C5) comprises: (i) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 4, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 8, and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 12, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 14, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 16; (ii) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 20, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 22, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 24; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 28, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 30, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 32; (iii) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 36, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 38, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 40; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 44, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 46, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 48; (iv) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 52, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 54, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 56; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 60, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 62, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 64; (v) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 68, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 70, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 72; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 76, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 78, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 80; (vi) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 84, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 86, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 88; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 92, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 94, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; (vii) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 100, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 102, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 104; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 108, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 110, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 112; (viii) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 100, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 102, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 104; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 116, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 118, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; (ix) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 124, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 126, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 128; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 108, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 110, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 112; (x) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 100, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 102, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 104; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 132, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 134, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 136; (xi) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 140, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 142, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 144; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 108, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 110, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 112; (xii) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 148, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 150, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 152; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 108, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 110, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 112; (xiii) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 124, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 126, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 128; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 132, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 134, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 136; (xiv) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 148, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 150, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 152; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 116, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 118, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; (xv) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 148, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 150, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 152; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 132, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 134, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 136; (xvi) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 140, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 142, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 144; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 132, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 134, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 136; (xvii) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 156, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 158, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 160; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 164, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 166, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 168; (xviii) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 172, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 174, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 176; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 180, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 182, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 184; (xix) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 188, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 190, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 192; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 196, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 198, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 200; (xx) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 204, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 206, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 208, and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 212, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 214, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 216; (xxi) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 220, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 222, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 224; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 228, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 230, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 232; (xxii) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 236, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 238, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 240; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 244, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 246, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 248; (xxiii) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 252, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 254, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 256; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 260, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 262, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 264; (xxiv) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 268, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 270, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 272; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 260, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 262, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 264; (xxv) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 276, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 278, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 280; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 284, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 286, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 288; (xxvi) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 292, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 294, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 296; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 300, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 302, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 304; (xxvii) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 308, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 310, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 312; and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 316, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 318, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 320; (xxviii) a heavy chain variable region comprising a HCDR1 comprising the amino acid sequence of SEQ ID NO: 324, a HCDR2 comprising the amino acid sequence of SEQ ID NO: 326, and a HCDR3 comprising the amino acid sequence of SEQ ID NO: 328, and a light chain variable region comprising a LCDR1 comprising the amino acid sequence of SEQ ID NO: 332, a LCDR2 comprising the amino acid sequence of SEQ ID NO: 334, and a LCDR3 comprising the amino acid sequence of SEQ ID NO: 336; or (xxix) a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises HCDR1 comprising the amino acid sequence of SEQ ID NO: 340, HCDR2 comprising the amino acid sequence of SEQ ID NO: 342, and HCDR3 comprising the amino acid sequence of SEQ ID NO: 344; and the light chain variable region comprises LCDR1 comprising the amino acid sequence of SEQ ID NO: 348, LCDR2 comprising the amino acid sequence of SEQ ID NO: 350, and LCDR3 comprising the amino acid sequence of SEQ ID NO:

352.

32. The co-formulation of any one of claims 1 to 31, wherein the antibody or antigen-binding fragment thereof that specifically binds to C5 (anti-C5) comprises: (1) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 2, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 10; (2) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 18 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 26; (3) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:34, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:42; (4) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 50, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 58; (5) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 66 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 74; (6) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 82 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 90; (7) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 98 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 106; (8) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 98 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 114; (9) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 122, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 106; (10) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 98 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 130; (11) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 138, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 106; (12) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 146, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 106; (13) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 122 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 130; (14) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 146, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 114; (15) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 146, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 130; (16) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 138, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 130; (17) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 154 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 162; (18) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 170, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 178; (19) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 186 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 194; (20) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 202, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 210; (21) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 218, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 226; (22) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 234, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 242; (23) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 250, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 258; (24) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 266, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 258; (25) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 274, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 282; (26) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 290, and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 298; (27) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 306 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 314; (28) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 322 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 330; or (29) A heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:

346.

33. The co-formulation of any one of claims 1 to 32, comprising from about 90 to about 275 mg / ml; or about 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 9, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 1 57, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194 , 195, 196, 197, 198, 199, 200, 211, 220, 242 or 274 mg / ml; or at least about 150 mg / ml, at least about 175 mg / ml, at least about 200 mg / ml, at least about 211 mg / ml, at least about 220 mg / ml, at least about 242 mg / ml or at least about 274 mg / ml of an antibody or antigen-binding fragment that specifically binds to C5.

34. The co-formulation of any one of claims 1 to 33, wherein the C5 iRNA is a double-stranded ribonucleic acid (dsRNA) agent comprising a sense strand and an antisense strand, wherein the antisense strand comprises a complementary region comprising at least 17 consecutive nucleotides that differ from the nucleotide sequence of 5′-UAUUAUAAAAAUAUCUUGCUUUU-3′ (SEQ ID NO: 364) by no more than 3 nucleotides, and wherein the dsRNA agent comprises at least one modified nucleotide.

35. The co-formulation of any one of claims 1 to 34, wherein the C5 iRNA is a double-stranded ribonucleic acid (dsRNA) agent comprising a sense strand and an antisense strand, wherein the sense strand comprises 5′-asasGfcAfaGfaUfAfUfuUfuuAfuAfaua-3′ (SEQ ID NO: 406) and the antisense strand comprises 5′-usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudTdT-3′ (SEQ ID NO: 369), in a, g, c, and u are 2′-O-methyl (2′-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2′-fluoro A, G, C, and U, respectively; dT is deoxythymidine nucleotide; s is a phosphorothioate linkage; and The sense strand is conjugated to the following ligand at its 3' end:

36. The co-formulation of any one of claims 1 to 35, wherein the C5 iRNA is Cemdisiran or its Na + Salt form.

37. The co-formulation of any one of claims 1 to 36, comprising a C5 iRNA that is cemdisiran, and one or more of cemdisiran impurity 1, cemdisiran impurity 2, and cemdisiran impurity 3.

38. The co-formulation of any one of claims 1 to 37, comprising about 20 to 100, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 115, 120, 130, 140, 150, 155, 160, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410 375, 380, 385, 390, 395, or 400 mg / ml C5 iRNA.

39. The co-formulation of any one of claims 1 to 38, having a viscosity of <30 cP at 20°C and / or an osmolarity of 240 to 450 mOsm / kg.

40. The co-formulation of claim 39, which has a viscosity of ≤ 20 cP at 20°C.

41. The co-formulation of claims 1 to 40, comprising: double-stranded C5 iRNA; and anti-C5 antibody or antigen-binding fragment thereof, pH above or below 6.0 (at least 0.5); C5 iRNA, an anti-C5 antibody or an antigen-binding fragment thereof, buffer, Viscosity reducers, stabilizers, and Nonionic surfactants; C5 iRNA, an anti-C5 antibody or an antigen-binding fragment thereof, Histidine-based buffers, L-arginine, stabilizers, and Nonionic surfactants; C5 iRNA, anti-C5 antibody or antigen-binding fragment thereof, Histidine-based buffers, L-arginine, sugars or polyols, and Nonionic surfactants; Cemdisiran, Pazelimab, Histidine-based buffers, L-arginine, stabilizers, and nonionic surfactants, pH about 6.5; Cemdisiran, Pazelimab, Histidine-based buffers, L-arginine, sucrose, and Polysorbate 80, pH about 6.5; 100 (±10) mg / mL C5 iRNA, 100 (±10) mg / mL anti-C5 antibody or its antigen-binding fragment, 50(±5)mM viscosity reducer, 10(±1)mM buffer, 1.0 (± 0.1)% stabilizer, 0.075 (± 0.0075)% nonionic surfactant, pH 6.5; 75 (±7.5) mg / mL C5 iRNA, 150 (±15) mg / mL anti-C5 antibody or its antigen-binding fragment, 75 (± 7.5) mM viscosity reducer, 15 (± 1.5) mM buffer, 1.5 (± 0.15)% stabilizer, 0.1125 (± 0.01125)% nonionic surfactant, pH 6.5; 50 (±5) mg / mL C5 iRNA, 100 (±10) mg / mL anti-C5 antibody or its antigen-binding fragment, 75mM (±7.5) viscosity reducer, 15 (± 1.5) mM buffer, 1.5 (± 0.15)% stabilizer, 0.1125 (± 0.01125)% nonionic surfactant; pH 6.5; 50 (±5) mg / mL C5 iRNA, 100 (±10) mg / mL anti-C5 antibody or its antigen-binding fragment, 75 (± 7.5) mM viscosity reducer, 35 (± 3.5) mM buffer, 1.5 (± 0.15)% stabilizer, 0.1125 (± 0.01125)% nonionic surfactant, pH 6.5; 100 (±10) mg / mL C5 iRNA, 100 (±10) mg / mL anti-C5 antibody or its antigen-binding fragment, 50(±5)mM viscosity reducer, 30 (± 3) mM buffer, 1(±0.1)% stabilizer, 0.075 (± 0.0075)% nonionic surfactant, pH 6.5; 50 (±5) mg / mL C5 iRNA, 100 (±10) mg / mL anti-C5 antibody or its antigen-binding fragment, 90(±9)mM viscosity reducer, 30 (± 3) mM buffer, 1(±0.1)% stabilizer, 0.075 (± 0.0075)% nonionic surfactant, pH 6.5; 100mg / mL Cemdisiran, 100mg / mL pazelizumab, 50 mM L-arginine, 30 mM histidine-based buffer, 1% (w / v) sucrose, 0.075% (w / v) PS80, pH 6.5; 50mg / mL Cemdisiran, 100mg / mL pazelizumab, 90mM L-arginine, 30 mM histidine-based buffer, 1% (w / v) sucrose, 0.075% (w / v) PS80, pH 6.5; 100mg / mL Cemdisiran, 100mg / mL pazelizumab, 50 mM L-arginine, 10 mM histidine-based buffer, 1.0% sucrose, 0.075% PS80, pH 6.5; 75mg / mL Cemdisiran, 150mg / mL pazelizumab, 75mM L-arginine, 15mM histidine-based buffer, 1.5% sucrose, 0.1125% PS80, pH 6.5; 50mg / mL Cemdisiran, 100mg / mL pazelizumab, 75mM L-arginine, 15mM histidine-based buffer, 1.5% sucrose, 0.1125% PS80; pH 6.5; 50mg / mL Cemdisiran, 100mg / mL pazelizumab, 75mM L-arginine, 35mM histidine-based buffer, 1.5% sucrose, 0.1125% PS80, pH 6.5; 100mg / mL Cemdisiran, 100mg / mL pazelizumab, 50 mM L-arginine, 30 mM histidine-based buffer, 1% sucrose, 0.075% PS80, pH 6.5; 50mg / mL Cemdisiran, 100mg / mL pazelizumab, 90mM L-arginine, 30 mM histidine-based buffer, 1% sucrose, 0.075% PS80, pH 6.5; Optionally, further comprising GalNAc and / or GlcNAc; 120 mg / mL C5 iRNA, 120 mg / mL anti-C5 antibody or antigen-binding fragment, viscosity reducer; 15 mM histidine, pH 6.2; 75mg / mL C5 iRNA, 150 mg / mL anti-C5 antibody or antigen-binding fragment, viscosity reducer; 15 mM histidine, pH 6.2; 120mg / mL C5 iRNA, 120 mg / mL anti-C5 antibody or antigen-binding fragment, 15 mM histidine, pH 6.2; 75mg / mL C5 iRNA, 150 mg / mL anti-C5 antibody or antigen-binding fragment, 15 mM histidine, pH 6.2; 120mg / mL Cemdisiran, 120mg / mL pazelizumab, 15 mM histidine, pH 6.2; 120mg / mL Cemdisiran, 120mg / mL pazelizumab, 75 mM arginine, 15 mM histidine, pH 6.2; 120mg / mL Cemdisiran, 120mg / mL pazelizumab, 75 mM adipate, 15 mM histidine, pH 6.2; 120mg / mL Cemdisiran, 120mg / mL pazelizumab, 75 mM NaCl, 15 mM histidine, pH 6.2; 120mg / mL Cemdisiran, 120mg / mL pazelizumab, 75 mM lysine, 15 mM histidine, pH 6.2; 120mg / mL Cemdisiran, 120mg / mL pazelizumab, 75 mM aspartate, 15 mM histidine, pH 6.2; 120mg / mL Cemdisiran, 120mg / mL pazelizumab, 75 mM proline, 15 mM histidine, pH 6.2; 120mg / mL Cemdisiran, 120mg / mL pazelizumab, 50 mM histidine, pH 6.2; 120mg / mL Cemdisiran, 120mg / mL pazelizumab, 50mM caffeine, 15 mM histidine, pH 6.2; 120mg / mL Cemdisiran, 120mg / mL pazelizumab, 50 mM phenylalanine, 15 mM histidine, pH 6.2 120mg / mL Cemdisiran, 120mg / mL pazelizumab, 50 mM triethyl citrate, 15 mM histidine, pH 6.2; 75mg / mL Cemdisiran, 150mg / mL pazelizumab, 15 mM histidine, pH 6.2; 75mg / mL Cemdisiran, 150mg / mL pazelizumab, 75 mM arginine, 15 mM histidine, pH 6.2; 75mg / mL Cemdisiran, 150mg / mL pazelizumab, 75 mM adipate, 15 mM histidine, pH 6.2; 75mg / mL Cemdisiran, 150mg / mL pazelizumab, 75 mM NaCl, 15 mM histidine, pH 6.2; 75mg / mL Cemdisiran, 150mg / mL pazelizumab, 75 mM lysine, 15 mM histidine, pH 6.2; or 75mg / mL Cemdisiran, 150mg / mL pazelizumab, 75 mM aspartate, 15 mM histidine, pH 6.

2.

42. The co-formulation of any one of claims 1 to 41, wherein The C5 iRNA is Cemdisiran; The antibody or antigen-binding fragment is pazelizumab; The viscosity reducing agent is L-arginine; The buffer is a histidine-based buffer; The stabilizer is sucrose; The nonionic surfactant is polysorbate 80; and The pH was about 6.

5.

43. The co-formulation of any one of claims 1 to 42, wherein The C5 iRNA is conjugated to a ligand comprising one or more terminal N-acetylgalactosamine (GalNAc) or N-acetylglucosamine (GlcNAc) residues; The pH is within no less than about 0.5 of about 6; and / or • The pH is about 6.

5.

44. The co-formulation of any one of claims 1 to 43, wherein Contains β-hexosaminidase; comprising the antibody or antigen-binding fragment thereof, which is expressed and isolated from a mammalian host cell comprising β-hexosaminidase; comprising the antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof is expressed and isolated from Chinese hamster ovary cells; Contains no more than about 1% of Cemdisiran Impurity 1 relative to total Cemdisiran; Contains not less than about 80% cemdisiran relative to total cemdisiran after storage at 2°C to 8°C for 2 years; Before storage (at t=0) had approximately 91% Cemdisiran; Store at 2°C to 8°C for 1, 1 1 / 2, 2, 2 1 / After 2 or 3 years, having not less than about 80% Cemdisiran; Having from about 80% to about 91% Cemdisiran; cemdisiran purity (%) as demonstrated by dIPRP is approximately 90.5% at t=0; 91.1% after 1 month storage at 2°C to 8°C; 90.8% after 3 months storage at 2°C to 8°C; 90% after 6 months storage at 2°C to 8°C; 88.8% after 9 months storage at 2°C to 8°C; 88.7% after 12 months storage at 2°C to 8°C; 89% after 18 months storage at 2°C to 8°C; and / or 89.4% after 24 months storage at 2°C to 8°C; cemdisiran purity (%) as demonstrated by dIPRP is approximately 90.8% at t=0, 90.6% after 1 month storage at 2°C to 8°C; 90.5% after 3 months storage at 2°C to 8°C; 89.4% after 6 months storage at 2°C to 8°C; 88.3% after 9 months storage at 2°C to 8°C; 87.8% after 12 months storage at 2°C to 8°C; 87.8% after 18 months storage at 2°C to 8°C; and / or 89.4% after 24 months storage at 2°C to 8°C; The single-chain purity (%) of cemdisiran by dIPRP was approximately 90.5% at t=0; 90.2% after 1 month storage at 25°C and 60% RH; 87.8% after 3 months storage at 25°C and 60% RH; 85.1% after 6 months storage at 25°C and 60% RH; 90% after 0.5 month storage at 40°C and 75% RH; 88.9% after 1 month storage at 40°C and 75% RH; and 85.8% after 3 months storage at 40°C and 75% RH. The purity (%) of cemdisiran as demonstrated by dIPRP was approximately 90.8% at t=0; 88.8% after 1 month storage at 25°C and 60% RH; 85.9% after 3 months storage at 25°C and 60% RH; 82.3% after 6 months storage at 25°C and 60% RH; 88.9% after 0.5 month storage at 40°C and 75% RH; 87.3% after 1 month storage at 40°C and 75% RH; and 82.3% after 3 months storage at 40°C and 75% RH. cemdisiran purity (%) as demonstrated by dIPRP is about 90.9% at t=0; about 90.1% after 1 month storage at 25°C, 60% RH; about 90.9% after 3 months storage at 25°C, 60% RH; about 90.4% after 6 months storage at 25°C, 60% RH; about 89.9% after 0.5 month storage at 40°C, 75% RH; about 89.7% after 1 month storage at 40°C, 75% RH; and / or about 89.5% after 3 months storage at 40°C, 75% RH; cemdisiran purity (%) as demonstrated by dIPRP is about 90.8% at t=0; about 90.2% after 1 month storage at 25°C, 60% RH; about 90.8% after 3 months storage at 25°C, 60% RH; about 90.3% after 6 months storage at 25°C, 60% RH; about 89.5% after 0.5 month storage at 40°C, 75% RH; about 89.6% after 1 month storage at 40°C, 75% RH; and / or about 89.1% after 3 months storage at 40°C, 75% RH; cemdisiran purity (%) as demonstrated by dIPRP at t=0 of about 90.5%; about 89.9% after 1 month storage at 25°C, 60% RH; about 90.8% after 3 months storage at 25°C, 60% RH; about 90.4% after 6 months storage at 25°C, 60% RH; about 90.1% after 0.5 month storage at 40°C, 75% RH; about 89.6% after 1 month storage at 40°C, 75% RH; and / or about 89.9% after 3 months storage at 40°C, 75% RH; and / or The purity (%) of Cemdisiran as demonstrated by dIPRP is approximately 91.1% at t=0; approximately 90% after 1 month storage at 25°C, 60% RH; approximately 91% after 3 months storage at 25°C, 60% RH; approximately 90.7% after 6 months storage at 25°C, 60% RH; approximately 90% after 0.5 month storage at 40°C, 75% RH; approximately 89.7% after 1 month storage at 40°C, 75% RH; and / or approximately 89.9% after 3 months storage at 40°C, 75% RH.

45. The co-formulation of any one of claims 1 to 44, comprising: No more than about 2.1 parts per million (ppm) molar ratio of β-hexosaminidase to the antibody or antigen-binding fragment; contains no more than about 0.170 micrograms / ml of beta-hexosaminidase, contains no more than about 0.04 micrograms / ml of beta-hexosaminidase; and / or about 0.04, 0.05, 0.06, 0.06, 0.0605, 0.0605, 0.0605, 0.063, 0.07, 0.07, 0.0765, 0.078, 0.08, 0.14, 0.141, 0.15, 0.1525, 0.166, or 0.17 micrograms / ml beta-hexosaminidase; or no more than any of these concentrations.

46. ​​A method for administering the co-formulation of any one of claims 1 to 45 to a subject, comprising introducing the co-formulation into the body of the subject.

47. The method of claim 46, wherein the co-formulation is administered by injection into the subject.

48. The method of claim 47, wherein the co-formulation is administered by intramuscular, subcutaneous, intravenous, intraocular, and / or intravitreal injection.

49. A method for treating or preventing a C5-related disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the co-formulation of any one of claims 1 to 48.

50. The method of claim 49, wherein the disease or disorder is: Disorders of inappropriate or undesirable complement activation; hemodialysis complications; pulmonary diseases or disorders; neurological disorders; parasitic diseases; post-ischemia-reperfusion conditions; proteinuric nephropathy; renal disorders; adult-onset respiratory distress syndrome; adult-onset respiratory distress syndrome (ARDS); age-related macular degeneration (AMD); allergies; Alport syndrome; Alzheimer's disease; autoimmune diseases or; immune complex disorders; inflammatory disorders; eye diseases; organic dust diseases; vasculo-thrombotic and protein-losing enteropathy; asthma; asthma; atherosclerosis; bronchitis contraction; bullous pemphigoid; C3 glomerulopathy; capillary leak syndrome; CHAPLE disease (CD55 deficiency with complement hyperactivation); chemical injury from irritants and / or chemicals; chronic obstructive pulmonary disease (COPD); complement activation from burns; complement activation from frostbite; complement activation from obesity; complement activation from sepsis; Crohn's disease; diabetes mellitus; diabetic macular edema (DME); diabetic nephropathy; diabetic retinopathy; dry AMD; dyspnea; emphysema; epilepsy; fibrogenic dust disease disease; geographic atrophy (GA); glomerulopathy; Goodpasture's syndrome; Guillain-Barré syndrome; hemolytic anemia; hemoptysis; hereditary angioedema; hyperacute allograft rejection; hypersensitivity pneumonitis; immune complex-associated inflammation; infectious diseases; inflammatory conditions in autoimmune diseases; hereditary CD59 deficiency; injury from inert dust and / or minerals; interleukin-2-induced toxicity during IL-2 therapy; lupus nephritis; membranoproliferative glomerulonephritis; mesenteric artery reperfusion after aortic reconstruction; multiple sclerosis; myasthenia gravis; Myocardial infarction; neuromyelitis optica; ocular angiogenesis; Parkinson's disease; pneumonia; progressive renal failure; psoriasis; pulmonary embolism and infarction; pulmonary fibrosis; pulmonary vasculitis; renal ischemia; renal ischemia-reperfusion injury; rheumatoid arthritis; schizophrenia; Systemic lupus erythematosus nephritis; moyamoya injury; stroke; systemic inflammatory response in post-pump syndrome with cardiopulmonary bypass or renal bypass; systemic lupus erythematosus (SLE); thermal injury; traumatic brain injury; uveitis; vasculitis; wet AMD; paroxysmal nocturnal hemoglobinuria (PNH); and / or xenograft rejection.

51. The method of any one of claims 46 to 50, wherein one or more additional therapeutic agents are administered to the subject.

52. The method of claim 51, wherein the additional chemotherapeutic agent is an androgen, an anticoagulant, an anti-inflammatory agent, an antihypertensive agent, an immunosuppressant, a fibrinolytic agent, a lipid-lowering agent, an anti-CD20 agent, an anti-TNF agent, a C3 inhibitor, an antithrombotic agent, a corticosteroid, a nonsteroidal anti-inflammatory drug, an angiotensin-converting enzyme inhibitor, a hydroxymethylglutaryl CoA reductase inhibitor, and / or an anti-epileptic agent.

53. The method of claim 52, wherein the additional chemotherapeutic agent is warfarin, aspirin, heparin, phenindione, fondaparinux, idraparinux, and a thrombin inhibitor such as argatroban, lepirudin, bivalirudin, dabigatran, vincristine, cyclosporin A, methotrexate, ancrodine, epsilon-aminocaproic acid, plasmin inhibitor-a1, prostacyclin, defibrotide, rituximab, infliximab, and / or magnesium sulfate.

54. A method for increasing the stability of RNA or decreasing the activity of β-hexosaminidase in a composition comprising RNA conjugated to a ligand comprising one or more terminal N-acetylgalactosamine (GalNAc) residues and / or N-acetylglucosamine (GlcNAc) residues, and β-hexosaminidase, the method comprising (i) adding GalNAc and / or GlcNAc to the composition and / or (ii) increasing or decreasing the pH of the composition from about 6.

55. The method of claim 54, wherein the composition comprises - said RNA, which is a C5 iRNA; - an anti-C5 antibody or an antigen-binding fragment thereof, which is expressed and isolated from a mammalian host cell comprising the β-hexosaminidase; and, optionally, - buffers; -Viscosity reducers; - stabilizers; and -Nonionic surfactants.

56. The method of any one of claims 54 to 55, wherein the composition comprises an antibody expressed in Chinese Hamster Ovary (CHO) cells.

57. The method of any one of claims 54 to 56, wherein the RNA is double-stranded RNA, optionally comprising an overhang of 1 or 2 nucleotides on one or both ends.

58. The method of any one of claims 54 to 57, wherein the RNA is chemically synthesized.

59. A method for preparing the co-formulation of any one of claims 1 to 45, comprising Combining RNAi with anti-C5 antibodies or antigen-binding fragments, and (i) adding GalNAc to the co-formulation and / or (ii) adjusting the pH of the co-formulation to about 6 or below.

60. A co-formulation which is the product of the method of claim 59.

61. A method for administering to a subject an antibody or antigen-binding fragment thereof that specifically binds to C5 (anti-C5) in combination with a C5 iRNA, comprising introducing the antibody or fragment and the iRNA into the body of the subject.

62. The method of claim 61, wherein the antibody or fragment and the iRNA are introduced by subcutaneous injection or intravenous infusion of a co-formulation comprising both the antibody or fragment and the iRNA; or The introduction is by subcutaneous injection or intravenous infusion of separate formulations each containing the antibody or fragment or the iRNA.

63. A method for treating or preventing a C5-related disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an antibody or antigen-binding fragment thereof that specifically binds to C5, in combination with a C5 iRNA, in a single co-formulation or in separate formulations.

64. The method of any one of claims 61 to 63, further comprising one or more initial intravenous or subcutaneous loading doses of the antibody or antigen-binding fragment and / or the iRNA.

65. The method of any one of claims 61 to 64, comprising administering one or more doses of both: (1) about 400 mg of the anti-C5 antibody or antigen-binding fragment; and (2) About 200 mg of the C5 iRNA.

66. The method of any one of claims 61 to 65, wherein: administering about 400 mg of the anti-C5 antibody or antigen-binding fragment approximately every 2, 3, or 4 weeks (± 3 days); and About 200 mg of the C5 iRNA was administered approximately every 4 weeks (± 3 days).

67. The method of any one of claims 61 to 66, wherein the subject is administered: (i) about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously approximately every 2 weeks (± 3, 4, 5, 6, or 7 days); and about 200 mg of the C5 iRNA subcutaneously approximately every 4 weeks (± 3, 4, 5, 6, or 7 days); (ii) about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously approximately every 4 weeks (±3, 4, 5, 6, or 7 days); and about 200 mg of the C5 iRNA subcutaneously approximately every 4 weeks (±3, 4, 5, 6, or 7 days); (iii) an intravenous loading dose of an anti-C5 antibody or antigen-binding fragment, about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of the C5 iRNA subcutaneously; and then about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of the C5 iRNA subcutaneously about every 4 weeks (±3, 4, 5, 6 or 7 days) thereafter; (iv) an intravenous loading dose of about 30 or 60 mg / kg of the anti-C5 antibody or antigen-binding fragment, about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously, and about 200 mg of the C5 iRNA subcutaneously; and then about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of the C5 iRNA subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days) thereafter; (v) an intravenous loading dose of about 30 or 60 mg / kg of an anti-C5 antibody or antigen-binding fragment, followed by one or more weekly subcutaneous doses of about 800 mg of an anti-C5 antibody or antigen-binding fragment, and then, optionally after a one-week period, about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of the C5 iRNA subcutaneously; and then about 400 mg of the anti-C5 antibody or antigen-binding fragment subcutaneously and about 200 mg of the C5 iRNA subcutaneously about every four weeks (±3, 4, 5, 6, or 7 days) thereafter; (vi) (a) an intravenous dose of eculizumab and about 200 mg subcutaneously of a C5 iRNA; (b) up to about 14 days (±3, 4, 5, 6, or 7 days) thereafter, the dose of eculizumab; and (c) about an additional 14 or 15 days (±3, 4, 5, 6, or 7 days) thereafter, a dose of 30 or 60 mg / kg body weight of anti-C5 antibody or antigen-binding fragment intravenously, about 400 mg subcutaneously of an anti-C5 antibody or antigen-binding fragment, and about 200 mg subcutaneously of a C5 iRNA, and (d) about every 4 weeks thereafter (±3, 4, 5, 6, or 7 days) a dose of about 400 mg subcutaneously of an anti-C5 antibody or antigen-binding fragment and about 200 mg subcutaneously of a C5 iRNA; or (vii) (a) about a 200 mg SC dose of a C5 iRNA; (b) after about 28 days (±3, 4, 5, 6, or 7 days), a 30 or 60 mg / kg IV loading dose of an anti-C5 antibody or antigen-binding fragment, a 400 mg SC dose of an anti-C5 antibody or antigen-binding fragment, and a 200 mg SC dose of a C5 iRNA; and (c) after about an additional 29 days (±3, 4, 5, 6, or 7 days) and about every 4 weeks (±3, 4, 5, 6, or 7 days) thereafter, an about 400 mg SC dose of an anti-C5 antibody or antigen-binding fragment and about a 200 mg SC dose of a C5 iRNA; or (viii) (a) approximately 4 weeks (±3, 4, 5, 6, or 7 days) after administration of ravlizumab, a 200 mg SC dose of C5 iRNA; (b) approximately 28 additional days (±3, 4, 5, 6, or 7 days) thereafter, a 30 or 60 mg / kg IV loading dose of anti-C5 antibody or antigen-binding fragment, a 400 mg SC dose of anti-C5 antibody or antigen-binding fragment, and a 200 mg SC dose of C5 iRNA; and (c) approximately 29 additional days (±3, 4, 5, 6, or 7 days) thereafter and approximately every 4 weeks (±3, 4, 5, 6, or 7 days) thereafter, a 400 mg SC dose of anti-C5 antibody or antigen-binding fragment and a 200 mg SC dose of C5 iRNA.

68. The method of any one of claims 61 to 67, wherein: The anti-C5 antibody or antigen-binding fragment and C5 iRNA are administered subcutaneously approximately every 4 weeks (±3, 4, 5, 6, or 7 days) as a single injection of a co-formulation comprising the anti-C5 antibody or antigen-binding fragment and C5 iRNA; and Additional injections of the anti-C5 antibody or antigen-binding fragment are administered subcutaneously approximately every 4 weeks (± 3, 4, 5, 6, or 7 days).

69. The method of any one of claims 61 to 67, wherein: the anti-C5 antibody or antigen-binding fragment and the C5 iRNA are administered subcutaneously about every 4 weeks (± 3, 4, 5, 6, or 7 days) as separate injections of separate formulations, one of which comprises the anti-C5 antibody or antigen-binding fragment and the other comprises the C5 iRNA; and Additional injections of the anti-C5 antibody or antigen-binding fragment are administered subcutaneously approximately every 4 weeks (± 3, 4, 5, 6, or 7 days).

70. The method of any one of claims 61 to 67, wherein: The anti-C5 antibody or antigen-binding fragment and C5 iRNA are administered subcutaneously approximately every 4 weeks (±3, 4, 5, 6, or 7 days) as a single injection of a co-formulation comprising the anti-C5 antibody or antigen-binding fragment and C5 iRNA; and Additional injections of the anti-C5 antibody or antigen-binding fragment are administered subcutaneously approximately every 2 weeks (± 3, 4, 5, 6, or 7 days).

71. The method of any one of claims 61 to 67, wherein: the anti-C5 antibody or antigen-binding fragment and the C5 iRNA are administered subcutaneously about every 4 weeks (± 3, 4, 5, 6, or 7 days) as separate injections of separate formulations, one of which comprises the anti-C5 antibody or antigen-binding fragment and the other comprises the C5 iRNA; and Additional injections of the anti-C5 antibody or antigen-binding fragment are administered subcutaneously approximately every 2 weeks (± 3, 4, 5, 6, or 7 days).

72. The method of any one of claims 61 to 70, wherein the subject has previously received treatment with ranvulizumab and / or eculizumab.

73. The method of claim 72, wherein administration of ravlizumab is intravenous or subcutaneous.

74. The method of claim 72, wherein the administration of eculizumab is about 900 mg intravenously.

75. The method of any one of claims 61 to 74, wherein the subject has previously received pazelimumab monotherapy.

76. The method of any one of claims 61-71, wherein the subject has not received a complement inhibitor.

77. The method of any one of claims 61 to 72 and 74 for treating or preventing a C5-related disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an anti-C5 antibody or antigen-binding fragment thereof and a C5 iRNA, wherein the subject has previously received eculizumab, wherein the subject is administered: (i) intravenous eculizumab dose and 200 mg subcutaneous C5 iRNA; (ii) up to about 14 days (±3, 4, 5, 6, or 7 days) later (about day 15), the dose of eculizumab; (iii) about 14 or 15 days (± 3, 4, 5, 6, or 7 days) later (about day 29), intravenously administering the anti-C5 antibody or antigen-binding fragment at a dose of about 30 or 60 mg / kg body weight, subcutaneously administering about 400 mg of the anti-C5 antibody or antigen-binding fragment, and subcutaneously administering about 200 mg of the C5 iRNA; and (iv) starting about 28 days (±3, 4, 5, 6, or 7 days) later (about day 57) and about every about 28 days (±3, 4, 5, 6, or 7 days) thereafter, about 400 mg of the anti-C5 antibody or antigen-binding fragment and about 200 mg of the C5 iRNA subcutaneously.

78. The method of any one of claims 61 to 73 for treating or preventing a C5-related disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an anti-C5 antibody or antigen-binding fragment thereof and a C5 iRNA, wherein the subject has previously received ravlizumab, wherein the subject is administered: (i) approximately 200 mg SC dose of C5 iRNA approximately 28 days (±3, 4, 5, 6, or 7 days) after the last administration of ravlizumab; (ii) about 28 days (±3, 4, 5, 6, or 7 days) later (about day 29), an IV dose of about 30 or 60 mg / kg of the anti-C5 antibody or antigen-binding fragment, an SC dose of about 400 mg of the anti-C5 antibody or antigen-binding fragment, and an SC dose of about 200 mg of the C5 iRNA; (iii) starting about 28 days (± 3, 4, 5, 6, or 7 days) later (about day 57) and about every about 28 days (± 3, 4, 5, 6, or 7 days) thereafter, a SC dose of about 400 mg of the anti-C5 antibody or antigen-binding fragment and a SC dose of about 200 mg of the C5 iRNA.

79. The method of any one of claims 61 to 71 and 76 for treating or preventing a C5-related disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an anti-C5 antibody or antigen-binding fragment thereof and a C5 iRNA, wherein the subject has not previously been treated with a complement inhibitor or has not recently been treated with a complement inhibitor, wherein the subject is administered: (i) on about day 1, an intravenous dose of about 30 or 60 mg / kg of an anti-C5 antibody or antigen-binding fragment, a subcutaneous (SC) dose of about 400 mg of the antibody or fragment, and a SC dose of about 200 mg of the C5 iRNA; and (ii) starting about 28 days later (± 3, 4, 5, 6, or 7 days) and about every 4 weeks thereafter (± 3, 4, 5, 6, or 7 days), about 400 mg SC of the anti-C5 antibody or antigen-binding fragment and about 200 mg SC of the C5 iRNA.

80. The method of any one of claims 61 to 71 and 75 for treating or preventing a C5-related disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an anti-C5 antibody or antigen-binding fragment thereof and a C5 iRNA, wherein the subject has previously received monotherapy with the anti-C5 antibody or antigen-binding fragment: (i) about 400 mg SC dose of the anti-C5 antibody or antigen-binding fragment and about 200 mg SC dose of the C5 iRNA starting about 7 to 8 days (± 3 days) after the last dose of the anti-C5 antibody or antigen-binding fragment monotherapy or when the next dose of the monotherapy is due and about every 4 weeks (± 3, 4, 5, 6, or 7 days) thereafter; or (ii) starting about 7 to 8 days (± 3 days) after the last dose of anti-C5 antibody or antigen-binding fragment monotherapy or when the next dose of said monotherapy is due: an approximately 400 mg SC dose of said anti-C5 antibody or antigen-binding fragment and additional doses thereof approximately every 2 weeks (± 3, 4, 5, 6, or 7 days) thereafter; and an approximately 200 mg SC dose of said C5 iRNA and additional doses thereof approximately every 4 weeks (± 3, 4, 5, 6, or 7 days) thereafter.

81. A method for treating or preventing a C5-related disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an anti-C5 antibody or antigen-binding fragment thereof in combination with a C5 iRNA, wherein the subject has received one or more doses of a non-competing anti-C5 antibody or antigen-binding fragment: (1) C5 iRNA dose after the N / C Ab dose but before the first dose of pazelimab; or (1) a dose of C5 iRNA after the N / C Ab dose but before the first dose of pazelimab; then (2) an intravenous loading dose of pazelimab, which is the first dose of pazelimab; or (1) an intravenous loading dose of pazelimab and a dose of pazelimab 400 mg SC every 4 weeks and cemdisiran 200 mg SC every 4 weeks; then (2) starting approximately 4 weeks thereafter (and continuing every 4 weeks thereafter), pazelimab 400 mg SC every 4 weeks and cemdisiran 200 mg SC every 4 weeks; or (1) a dose of C5 iRNA approximately 4 weeks after the N / C Ab dose has been administered and before the intravenous loading dose of pazelimumab and the doses of pazelimumab 400 mg SC Q4W and cemdisiran 200 mg SC Q4W; (2) starting approximately 4 weeks thereafter (and continuing every 4 weeks thereafter), pazelimab 400 mg SC every 4 weeks and cemdisiran 200 mg SC every 4 weeks; or (1) The doses of C5 iRNA and non-competing antibody or fragment (N / CAb) on the day the N / C Ab dose is due; (2) the next dose of N / C Ab, on the day such dose is due; (3) after approximately 1 to 2 half-lives of the N / C Ab or when the next dose of the N / C Ab is due, a 30 or 60 mg / kg IV loading dose of pazelimab, and 400 mg SC of pazelimab and 200 mg SC of cemdisiran; (4) starting 4 weeks thereafter (and continuing every 4 weeks thereafter), pazelimab 400 mg SC Q4W and cemdisiran 200 mg SC Q4W; or (1) a dose of C5 iRNA after about 1 to 2 half-lives of the N / C Ab from its last dose, or on the day the next dose of the N / C Ab is due, or after half of the interval between doses has passed since the last dose of the N / C Ab; (2) after about an additional 1 to 2 half-lives of the N / C Ab, a 30 or 60 mg / kg IV loading dose of Pazelimab, 400 mg SC of Pazelimab, and 200 mg SC of Cemdisiran; and (3) Starting 4 weeks thereafter (and continuing every 4 weeks thereafter), pazelimab 400 mg SC Q4W and cemdisiran 200 mg SC Q4W.

82. The method of claim 81, wherein: The dose of C5 iRNA was administered 2, 3, 4, 5, 6, 7, or 8 weeks after the N / C Ab dose but 1, 2, 3, or 4 weeks before the first dose of pazelimab; The C5 iRNA is Cemdisiran; The C5 iRNA was Cemdisiran and the dose was 200 mg SC; The anti-C5 antibody or antigen-binding fragment thereof is pazelizumab; The intravenous loading dose of pazelimab was 30 or 60 mg / kg; The non-competitive anti-C5 antibody or antigen-binding fragment is eculizumab; The non-competing anti-C5 antibody or antigen-binding fragment is eculizumab and dosages are due every 1, 2, 3, or 4 weeks; The non-competitive anti-C5 antibody or antigen-binding fragment is ravlizumab; The non-competing anti-C5 antibody or antigen-binding fragment is ravlizumab and dosages are due every 4 or 8 weeks; The half-life of the non-competing antibody is about 11 days; and / or The half-life of the non-competing antibody is approximately 32 days.

83. The method of any one of claims 46 to 53 and 61 to 82, wherein During treatment, the subject achieves or achieves and maintains any one or more of the following: Hemoglobin stability; Not receiving red blood cell transfusions; Hemoglobin has not decreased by ≥ 2 g / dL; Did not experience breakthrough hemolysis; CH50 levels in the blood were completely suppressed relative to the pre-treatment baseline (at 0 kIU / L) and / or during any breakthrough hemolytic event; There were no treatment-emergent adverse events; Improvement in fatigue compared to before treatment; An improvement of >5 points in the FACIT-Fatigue score compared to before treatment; Improvement in the European Organisation for Research and Treatment of Cancer Quality of Life Questionnaire: Core 30 (EORTC QLQ-C30) physical function score compared to before treatment; Improvement in GHS / QoL (Global Health Status / QoL Scale (GHS)) compared to before treatment; A decrease in lactate dehydrogenase (LDH) levels relative to before treatment; Achieve LDH ≤ 1.5 × upper limit of normal (ULN) relative to before treatment; Achieve and maintain LDH ≤ 1.0 × ULN; A decrease in blood bilirubin levels compared to before treatment; A decrease in reticulocyte count relative to before treatment; A decrease in the alternative pathway hemolytic activity assay (AH50) relative to before treatment; PNH: a decrease in red blood cells and / or granulocytes compared to before treatment; Improvement in fatigue, shortness of breath, muscle weakness, headache, abdominal pain, back / leg pain, chest tightness, difficulty sleeping, difficulty thinking clearly, and / or difficulty swallowing, compared to before treatment; Improvement in renal function relative to before treatment, as measured by estimated glomerular filtration rate (eGFR); Reduction in free hemoglobin in the blood compared to before treatment; A decrease in total C5 blood levels relative to before treatment; A decrease in PNH clone size relative to before treatment; and / or Increased haptoglobin levels relative to pre-treatment levels.

84. The method of any one of claims 61 to 83, wherein the C5-related disease or disorder is: a disorder of inappropriate or undesirable complement activation; a complication of hemodialysis; a pulmonary disease or disorder; a neurological disorder; a parasitic disease; a post-ischemia-reperfusion condition; a proteinuric nephropathy; a renal disorder; adult respiratory distress syndrome; adult respiratory distress syndrome (ARDS); age-related macular degeneration (AMD); an allergy; Alport syndrome; Alzheimer's disease; an autoimmune disease or; an immune complex disorder; an inflammatory disorder; an eye disease; an organic dust disease; or an angiothrombotic thrombotic thrombosis. inflammatory and protein-losing enteropathy); asthma; asthma; atherosclerosis; bronchoconstriction; bullous pemphigoid; C3 glomerulopathy; capillary leak syndrome; CHAPLE disease (CD55 deficiency with complement hyperactivation; chemical injury from irritants and / or chemicals; chronic obstructive pulmonary disease (COPD); complement activation from burns; complement activation from pernio; complement activation from obesity; complement activation from sepsis; Crohn's disease; diabetes mellitus; diabetic macular edema (DME); diabetic nephropathy; diabetic retinopathy; dry AMD; respiratory Dysphagia; emphysema; epilepsy; fibrogenic dust disease; geographic atrophy (GA); glomerulopathy; Goodpasture's syndrome; Guillain-Barré syndrome; hemolytic anemia; hemoptysis; hereditary angioedema; hyperacute allograft rejection; hypersensitivity pneumonitis; immune complex-associated inflammation; infectious diseases; inflammatory conditions associated with autoimmune diseases; hereditary CD59 deficiency; injury from inert dust and / or minerals; interleukin-2-induced toxicity during IL-2 therapy; lupus nephritis; membranoproliferative glomerulonephritis; mesenteric artery reperfusion after aortic remodeling; multiple sclerosis; myasthenia gravis; myocardial infarction; neuromyelitis optica; ocular angiogenesis; Parkinson's disease; pneumonia; progressive renal failure; psoriasis; pulmonary embolism and infarction; pulmonary fibrosis; pulmonary vasculitis; renal ischemia; renal ischemia-reperfusion injury; rheumatoid arthritis; schizophrenia; systemic lupus erythematosus nephritis; moyamoya injury; stroke; systemic inflammatory response in post-pump syndrome with cardiopulmonary bypass or renal bypass; systemic lupus erythematosus (SLE); thermal injury; traumatic brain injury; uveitis; vasculitis; wet AMD; paroxysmal nocturnal hemoglobinuria (PNH); and / or xenograft rejection.

85. The method of any one of claims 46 to 53 and 61 to 84, wherein the C5 iRNA and the anti-C5 antibody or antigen-binding fragment are co-formulated as a co-formulation, and both the antibody or fragment and the C5 iRNA are administered by a single injection of the co-formulation.

86. The method of claim 85, wherein the pH of the co-formulation is about 6.

5.

87. The method of any one of claims 46 to 53 and 61 to 86, wherein the C5 iRNA and the anti-C5 antibody or antigen-binding fragment are co-formulated into a co-formulation comprising 100 mg / ml Cemdisiran and 100 mg / ml Pazylimab, or 50 mg / ml Cemdisiran and 100 mg / ml Pazylimab.

88. The method of claims 46-53 and 61-87, wherein the co-formulation comprises: Cemdisiran; Pazelimab expressed and isolated from mammalian host cells containing β-hexosaminidase; buffer; viscosity reducers; stabilizers; and Nonionic surfactants; The pH was about 6.

5.

89. The method of any one of claims 46-53 and 61-88, wherein the subcutaneous injection is performed with a pre-filled syringe.

90. The method of any one of claims 46-53 and 61-89, wherein the subject has aplastic anemia and / or myelodysplastic syndrome.

91. The method of any one of claims 46 to 53 and 61 to 90, wherein the subject has previously received, or the method further comprises administering to the subject, prior to (optionally, on any of the preceding 1, 2, 3, 4, 5, 6, 7, 8, 9 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days), after, or during administration of 400 mg subcutaneous pazyrumab and 200 mg subcutaneous cemdisiran: One or more doses of subcutaneous or intravenous pazelimumab; One or more 400 mg subcutaneous doses of pazelimab; one or more doses of subcutaneous or intravenous anti-C5 antibody or antigen-binding fragment; One or more doses of subcutaneous or intravenous eculizumab; One or more doses of subcutaneous or intravenous ravulizumab; One or more doses of subcutaneous or intravenous cemdisiran; One or more doses of subcutaneous or intravenous C5 iRNA; One or more subcutaneous doses of 800 mg of pazelimab; one or more subcutaneous doses of 800 mg of an anti-C5 antibody or antigen-binding fragment; One or more intravenous doses of 30 mg / kg body weight of pazelimab; one or more intravenous doses of 30 mg / kg body weight of an anti-C5 antibody or antigen-binding fragment; one or more intravenous doses of about 60 mg / kg body weight of pazelimumab; one or more intravenous doses of about 60 mg / kg body weight of an anti-C5 antibody or antigen-binding fragment; one or more subcutaneous doses of about 800 mg of pazelimab; one or more subcutaneous doses of about 800 mg of an anti-C5 antibody or antigen-binding fragment; one intravenous dose of about 60 mg / kg body weight of pazelizumab followed by one or more subcutaneous doses of about 800 mg of pazelizumab; one intravenous dose of about 60 mg / kg body weight of an anti-C5 antibody or antigen-binding fragment followed by one or more subcutaneous doses of about 800 mg of an anti-C5 antibody or antigen-binding fragment; One or more doses intravenously > 300, > 600, > 900 or > 1200mg eculizumab; One or more doses of 200 mg of cemdisiran administered subcutaneously; and / or • One or more doses of 200 mg of C5 iRNA subcutaneously.

92. The method of any one of claims 46 to 53 and 61 to 91, wherein: The intravenous administration of the anti-C5 antibody or antigen-binding fragment is separated from the subcutaneous administration of the anti-C5 antibody or antigen-binding fragment or C5 iRNA by about 30 minutes; Subcutaneous administration of an anti-C5 antibody or antigen-binding fragment and a C5 iRNA followed by an observation period of about 30 minutes, 1 hour, or 2 hours; and / or • Subcutaneous administration of C5 iRNA was followed by an observation period of approximately 30 minutes, 1 hour, or 2 hours.

93. The method of any one of claims 46 to 53 and 61 to 92, wherein if the subject exhibits one or more of the following criteria: Breakthrough hemolysis not due to a complement activation disorder, and / or Elevated LDH ≥ 2 × ULN due to complement activation disorders, The subject then receives a booster treatment that also includes one or more 30 mg / kg IV doses of an anti-C5 antibody or antigen-binding fragment.

94. The method of any one of claims 46 to 53 and 61 to 94, wherein if the subject exhibits one or more of the following criteria: Breakthrough hemolysis not due to a complement activation disorder, and / or Elevated LDH ≥ 2 × ULN due to complement activation disorders, The subject then receives intensive treatment, wherein: (1) if the subject has received a treatment regimen comprising about 400 mg of the anti-C5 antibody or antigen-binding fragment administered subcutaneously approximately every 4 weeks (±3, 4, 5, 6, or 7 days) and about 200 mg of the C5 iRNA administered subcutaneously approximately every 4 weeks (±3, 4, 5, 6, or 7 days); then administering a single 30 mg / kg IV dose of the anti-C5 antibody or antigen-binding fragment on the day of the boost, and administering a boosting regimen of about 400 mg of the anti-C5 antibody or antigen-binding fragment administered subcutaneously approximately every 2 weeks (± 3, 4, 5, 6, or 7 days) and about 200 mg of the C5 iRNA administered subcutaneously approximately every 4 weeks (± 3, 4, 5, 6, or 7 days) starting on the day of the boost; or (2) if the subject has received a treatment regimen comprising about 400 mg of the anti-C5 antibody or antigen-binding fragment administered subcutaneously about every 2 weeks (±3, 4, 5, 6, or 7 days) and about 200 mg of the C5 iRNA administered subcutaneously about every 4 weeks (±3, 4, 5, 6, or 7 days); then A single 30 mg / kg IV dose of the anti-C5 antibody or antigen-binding fragment is administered on the day of the boost, and a treatment regimen comprising about 400 mg of the anti-C5 antibody or antigen-binding fragment administered subcutaneously approximately every 2 weeks (± 3, 4, 5, 6, or 7 days) and about 200 mg of the C5 iRNA administered subcutaneously approximately every 4 weeks (± 3, 4, 5, 6, or 7 days) is restarted starting on the day of the boost.

95. The method of any one of claims 46 to 53 and 61 to 94, wherein the anti-C5 antibody or antigen-binding fragment or Pazyrumab is expressed in a mammalian host cell and the iRNA or Cemdisiran is chemically synthesized.

96. The method of claim 95, wherein the host cell is a Chinese hamster ovary cell.

97. The method of any one of claims 46 to 53 and 61 to 96, wherein the anti-C5 antibody or antigen-binding fragment and C5 iRNA are co-formulated into a co-formulation comprising: No more than about 2.1 parts per million (ppm) molar ratio of β-hexosaminidase to the antibody or antigen-binding fragment; contains no more than about 0.170 micrograms / ml of beta-hexosaminidase, contains no more than about 0.04 micrograms / ml of beta-hexosaminidase; and / or About 0.04, 0.05, 0.06, 0.0605, 0.063, 0.07, 0.0765, 0.078, 0.08, 0.14, 0.141, 0.15, 0.1525, 0.166 or 0.17 micrograms / ml beta-hexosaminidase; or no more than any of these concentrations.

98. The method of any one of claims 61 to 97, wherein the antibody or antigen-binding fragment thereof is: (1) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence set forth in SEQ ID NO: 2, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence set forth in SEQ ID NO: 10; (2) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence set forth in SEQ ID NO: 18, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence set forth in SEQ ID NO: 26; (3) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR comprising the amino acid sequence of SEQ ID NO: 34, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR comprising the amino acid sequence of SEQ ID NO: 42; (4) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence set forth in SEQ ID NO: 50, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence set forth in SEQ ID NO: 58; (5) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 66, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 74; (6) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 82, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 90; (7) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 98, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 106; (8) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 98, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 114; (9) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 122, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 106; (10) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 98, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 130; (11) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 138, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 106; (12) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 146, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 106; (13) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 122, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 130; (14) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 146, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 114; (15) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 146, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 130; (16) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 138, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 130; (17) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 154, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 162; (18) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 170, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 178; (19) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 186, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 194; (20) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 202, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 210; (21) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 218, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 226; (22) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 234, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 242; (23) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 250, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 258; (24) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 266, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 258; (25) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 274, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 282; (26) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 290, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 298; (27) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of the HCVR having the amino acid sequence of SEQ ID NO: 306, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of the LCVR having the amino acid sequence of SEQ ID NO: 314; (28) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR having the amino acid sequence of SEQ ID NO: 322, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR having the amino acid sequence of SEQ ID NO: 330; and / or (29) a heavy chain variable region (HCVR) comprising HCDR1, HCDR2, and HCDR3 of a HCVR having the amino acid sequence of SEQ ID NO: 338, and a light chain variable region (LCVR) comprising LCDR1, LCDR2, and LCDR3 of a LCVR having the amino acid sequence of SEQ ID NO:

346.

99. The method of any one of claims 46 to 53 and 61 to 98, wherein the C5 iRNA comprises an RNA strand complementary to mRNA transcribed from the C5 gene sense strand DNA sequence AAGCAAGATATTTTTATAATA (nucleotides 782 to 802 of SEQ ID NO: 360).

100. The method of any one of claims 46 to 53 and 61 to 99, wherein the C5 iRNA is a double-stranded ribonucleic acid (dsRNA) agent comprising a sense strand and an antisense strand, wherein the antisense strand comprises a complementary region comprising at least 17 consecutive nucleotides that differ from the nucleotide sequence of 5′-UAUUAUAAAAAUAUCUUGGUUUU-3′ (SEQ ID NO: 364) by no more than 3 nucleotides, and wherein the dsRNA agent comprises at least one modified nucleotide.

101. The method of any one of claims 46 to 53 and 61 to 100, wherein the C5 iRNA is a double-stranded ribonucleic acid (dsRNA) agent comprising a sense strand and an antisense strand, wherein the sense strand comprises 5′-asasGfcAfaGfaUfafUfuUfuuAfuafaua-3′ (SEQ ID NO: 406) and the antisense strand comprises 5′-usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudTdT-3′ (SEQ ID NO: 369), in a, g, c, and u are 2′-O-methyl (2′-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2′-fluoro A, G, C, and U, respectively; dT is deoxythymidine nucleotide; s is a phosphorothioate linkage; and The sense strand is conjugated to the following ligand at its 3' end:

102. The method of any one of claims 61 to 101, wherein the C5 iRNA and the antibody or antigen-binding fragment thereof that specifically binds to C5 are in a co-formulation of any one of claims 1 to 45.

103. The method of any one of claims 46 to 53 and 61 to 102, wherein the C5 iRNA and the anti-C5 antibody or antigen-binding fragment thereof are in a single co-formulation and, when administered subcutaneously, are administered in one or two or more injections of the co-formulation.

104. The method of any one of claims 46 to 53 and 61 to 103, wherein the C5 iRNA and the anti-C5 antibody or antigen-binding fragment thereof are in a single co-formulation and, when administered subcutaneously, are administered as two injections of the co-formulation.

105. The method of any one of claims 46-104, wherein the C5 iRNA is Cemdisiran.

106. The method of claim 105, wherein the Cemdisiran is Na + Salt form.

107. The method of any one of claims 46 to 106, wherein the anti-C5 antibody or antigen-binding fragment thereof is pazelizumab.

108. The method of any one of claims 46 to 107, wherein the 30 mg / kg or 60 mg / kg IV dose of pazyrumab or an anti-C5 antibody or antigen-binding fragment thereof is a 30 mg / kg IV dose.

109. The method of any one of claims 46 to 107, wherein the 30 mg / kg or 60 mg / kg IV dose of pazyrumab or an anti-C5 antibody or antigen-binding fragment thereof is a 60 mg / kg IV dose.

110. The method or co-formulation of any one of claims 1 to 109, wherein the pazylimab or anti-C5 antibody or antigen-binding fragment comprises a heavy chain and a light chain, the heavy chain comprising the amino acid sequence: Optionally, lacking a C-terminal lysine; The light chain comprises the amino acid sequence:

Images