Acyl-coenzyme A synthetase in camellia oleifera and application of acyl-coenzyme A synthetase
By screening and expressing the camellia oleifera acyl-CoA synthetase gene, constructing recombinant vectors and genetically engineered bacteria, and optimizing protein induction conditions, angelica acyl-CoA was successfully synthesized, solving the research gap of acyl-CoA synthetase in the biosynthesis of camellia oleifera triterpenoid saponins and realizing the biosynthesis of camellia oleifera triterpenoid saponins.
Patent Information
- Application Number
- CN202511009739.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-22
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-07-22
AI Technical Summary
In the biosynthesis of camellia oleifera triterpenoid saponins, there is little research on acyl-CoA synthetase, especially on angelica acyl-CoA synthetase in camellia oleifera, and it is difficult to obtain angelica acyl-CoA from other pathways.
Based on the Camellia oleifera genome, acyl-CoA synthetase genes were screened, heterologously expressed using a prokaryotic expression system, and the synthesis of acyl-CoA was verified by in vitro enzymatic reaction. Recombinant vectors and genetically engineered bacteria were constructed, and protein induction conditions were optimized to finally synthesize Angelica acyl-CoA.
The invention provides an active camellia oleifera acyl-CoA synthetase for the biosynthesis of camellia oleifera triterpenoid saponins, realizes the effective synthesis of acyl-CoA, and provides a direct substrate for the biosynthesis of secondary metabolites in camellia oleifera.
Smart Images

Figure CN120665906A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of enzyme engineering, and more particularly to acyl-CoA synthetase in oil-tea camellia and application thereof. Background Art
[0002] Camellia oleifera is a woody oil-bearing tree species unique to my country, with extremely high medicinal and economic value. Camellia oleifera cake, obtained after oil extraction from camellia seeds, contains a variety of active substances, including camellia saponins. Camellia oleifera triterpenoid saponins possess important biological activities. Several camellia saponin monomers have been isolated and identified, and shown to possess pharmacological activities such as anti-inflammatory, anticancer, and antibacterial properties. Most of the camellia oleifera triterpenoid saponins with anticancer activity are modified with an angelicyl group. The donor for the angelicyl modification is angelicyl-CoA, the synthesis of which relies on angelicyl-CoA synthetase catalysis. Currently, the biosynthesis of camellia oleifera triterpenoid saponins has not been reported, and research on camellia oleifera acyl-CoA synthetase is limited, with even less research on this enzyme. Furthermore, obtaining angelicyl-CoA via other methods is difficult.
[0003] Therefore, whether it is possible to provide an acyl-CoA synthetase in Camellia oleifera and its application is an urgent problem to be solved by those skilled in the art. Summary of the Invention
[0004] In light of this, the present invention provides an acyl-CoA synthetase from Camellia oleifera and its application. Based on the Camellia oleifera genome, bioinformatics methods were used to screen for acyl-CoA synthetase genes. The target genes were heterologously expressed in a prokaryotic expression system, and functionally verified using an in vitro enzymatic reaction. Ultimately, angelica acyl-CoA was synthesized.
[0005] Deposit information: Escherichia coli ZCB1, deposited in China Center for Type Culture Collection, Wuhan University, Wuhan, China; deposit date: July 2, 2025; deposit number: CCTCC NO: M20251512.
[0006] In order to achieve the above object, the present invention adopts the following technical solutions:
[0007] A gene encoding acyl-CoA synthetase in Camellia oleifera, the gene sequence of which is shown as SEQ ID No. 1.
[0008] The present invention also provides the acyl-CoA synthetase in Camellia oleifera, the amino acid sequence of which is shown in SEQ ID No. 2.
[0009] The present invention also provides an expression box, a recombinant vector, or a genetically engineered bacterium containing the above-mentioned encoding gene.
[0010] Preferably, the engineered bacteria is Escherichia coli ZCB1, with a deposit number of CCTCCNO: M20251512.
[0011] The present invention also provides a method for constructing a genetically engineered bacterium containing the above-mentioned encoding gene, comprising the following steps:
[0012] (1) Cloning of the gene encoding acyl-CoA synthetase;
[0013] (2) The cloned product was connected to the cloning vector pClone007 Versatile Simple Vector and transformed into competent cells of Escherichia coli cloning strain DH5α to screen for positive clones;
[0014] (3) Design primers for pGEX-4T-1-CCL expression vector:
[0015] Forward primer F- gatctggttccgcgtggatcc atggtggaagagagagacatagacg, as shown in SEQ ID No. 5;
[0016] Reverse primer R- gacccatggagtctagaattc ttataacctgctgacactgacagatcc, as shown in SEQ ID No. 6;
[0017] The target gene fragment was cloned using the positive clone as a template; the expression vector pGEX-4T-1 was double-digested with EcoRI and BamHI; and the pGEX-4T-1-CCL recombinant vector was constructed by homologous recombination.
[0018] (4) Transform the competent cells of Escherichia coli expression strain RosettaDE3 to obtain genetically engineered bacteria.
[0019] The present invention also provides a protein induction method for the above-mentioned genetically engineered bacteria, wherein the induction expression conditions are: 20° C., a final IPTG concentration of 0.25 mM, and an induction time of 16 hours.
[0020] The present invention also provides the use of the above-mentioned encoding gene, or the above-mentioned synthase, or the above-mentioned expression cassette, or the recombinant vector, or the genetically engineered bacteria in fermentation.
[0021] Preferred: Application: Used for the biosynthesis of camellia oleifera triterpenoid saponins.
[0022] Preferred: Enzymatic reaction system: total volume 1 mL, 10 mM Coenzyme A 125 μL, 20 mM ATP 125 μL, 50 mM angelic acid 125 μL, 100 mM magnesium chloride 125 μL, acyl-CoA synthetase 250 μL, PBS buffer 250 μL; reaction conditions: 30° C., 12 h.
[0023] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses an acyl-CoA synthetase in Camellia oleifera and its application, and the technical effects achieved are:
[0024] The acyl-CoA synthetase provided by the present invention is a rare enzyme active towards angelic acid and can provide a direct substrate for cloning angelica acyltransferase from Camellia oleifera. The acyl-CoA synthetase provided by the present invention is active towards angelic acid and can also be used in the field of secondary metabolite biosynthesis.
[0025] Specifically, the present invention cloned the target gene CoCCL1 from Camellia oleifera kernels by designing specific primers, performed homology modeling on the protein encoded by the gene, predicted its tertiary structure, predicted its acyl-CoA biosynthesis function based on the structure, and predicted that the enzyme encoded by CoCCL1 did not have a transmembrane domain. The recombinant expression vector pGEX-4T-1-CCL, namely CoCCL1-4T1, was constructed using homologous recombination.
[0026] The Escherichia coli prokaryotic expression system was selected for protein expression. The induction temperature, induction time and inducer concentration were screened, and the optimal induction conditions for expressing the target protein in the prokaryotic expression system were obtained: 20°C, final inducer concentration of 0.25mM, and induction for 16h. The target protein was expressed under the optimal induction conditions and purified by affinity chromatography.
[0027] Using the purified enzyme as a catalyst, a suitable enzymatic reaction system was established: total volume 1 mL, 10 mM coenzyme A 125 μL, 20 mM ATP 125 μL, 50 mM angelic acid 125 μL, 100 mM magnesium chloride 125 μL, purified enzyme 250 μL, PBS buffer 250 μL, and in vitro enzymatic reaction was carried out. A suitable liquid chromatography-mass spectrometry (LC-MS) detection method was explored and established, and the target product was detected by LC-MS, indicating that the purified enzyme can catalyze the synthesis of angelic acid and coenzyme A in the system into angeloyl-CoA, and 30°C is the optimal temperature for the in vitro enzymatic reaction. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.
[0029] Figure 1 The accompanying drawing is an alignment diagram of the CoCCL1 amino acid sequences provided by the present invention.
[0030] Figure 2The accompanying figure is a map of the CoCCL1-4T1 recombinant plasmid provided by the present invention.
[0031] Figure 3 The accompanying drawings are diagrams for optimizing protein induction conditions provided by the present invention, wherein A: optimal induction temperature screening; B: optimal inducer concentration screening; C: optimal induction time screening.
[0032] Figure 4 The accompanying drawings are SDS-PAGE images of the target protein purification provided by the present invention, wherein M: protein marker; a: bacterial supernatant before induction; b: bacterial supernatant before ultrasonic disruption; c: bacterial supernatant after ultrasonic disruption; dg: purified protein samples.
[0033] Figure 5 The accompanying drawing is a diagram for detecting the synthesis activity of CoCCL angelicae acyl-CoA provided by the present invention, wherein A: HPLC chromatogram, 1: angelicae acyl-CoA, 2: CoA, 3: ATP, 4: angelic acid; B: mass spectrum of peak 1. DETAILED DESCRIPTION
[0034] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0035] The embodiment of the present invention discloses an acyl-CoA synthetase in oil-tea camellia and its application
[0036]
[0037] The amino acid sequence of CoCCL1 was compared with the sequences of genes with angelicae acyl-CoA synthesis function identified in the literature. Figure 1 ; The results showed that the structures were highly similar and had the same conserved domains, and the function of CoCCL1 was preliminarily predicted.
[0038] Example 1
[0039] CoCCL1 gene cloning
[0040] RNA extraction:
[0041] RNA extraction from different tissue parts of Camellia oleifera was performed using liquid nitrogen grinding method, with the following steps:
[0042] (1) Grind fresh or -80℃ frozen Camellia oleifera material into fine powder in liquid nitrogen.
[0043] (2) Take about 200 mg of fine powder and add it to 1 mL of preheated lysis buffer CLB (to which β-mercaptoethanol has been added). Use a pipette tip to mix the lysis buffer and plant sample. The lysis buffer can shear DNA, reduce viscosity and increase yield.
[0044] (3) Place in a 65°C metal bath for 10 min. Invert the centrifuge tube twice during the lysis process to aid lysis.
[0045] (4) Centrifuge the lysate at 13,000 rpm for 10 min to precipitate the insoluble fragments.
[0046] (5) Transfer the supernatant of the lysate to a new centrifuge tube, add half the volume of anhydrous ethanol, and immediately pipette to mix thoroughly. Do not centrifuge.
[0047] (6) Add the mixture to a genome cleanup column, place the cleanup column in a collection tube, centrifuge at 13,000 rpm for 2 minutes, and discard the waste liquid.
[0048] (7) Place the genomic DNA cleanup column in a clean 2 mL centrifuge tube, add 500 μL of lysis buffer RLT Plus, centrifuge at 13,000 rpm for 30 s, collect the filtrate (RNA is in the filtrate), accurately estimate the volume of the filtrate with a pipette, add 0.5 times the volume of anhydrous ethanol to the filtrate, and immediately pipette to mix. Do not centrifuge.
[0049] (8) Add the mixture to an adsorption column RA, place the adsorption column in a collection tube, centrifuge at 13,000 rpm for 2 min, and discard the waste liquid.
[0050] (9) Add 700 μL of deproteinized solution RW1, let it stand at room temperature for 1 min, then centrifuge at 13,000 rpm for 30 s and discard the waste liquid.
[0051] (10) Add 500 μL of Rinse Buffer RW to which anhydrous ethanol has been added, centrifuge at 13,000 rpm for 30 seconds, and discard the waste liquid. Add 500 μL of Rinse Buffer RW and repeat.
[0052] (11) Repeat the centrifugation at 13000 rpm for 2 min to fully remove the rinse solution.
[0053] (12) Remove the adsorption column RA and place it in a new centrifuge tube that does not contain RNase. Add 50 μL of 70°C preheated RNase-free water to the middle part of the adsorption membrane, let it stand at room temperature for 1 min, and centrifuge it at 12,000 rpm for 1 min.
[0054] (13) Use a microplate reader to determine the RNA concentration. If the expected RNA yield is >30 μg, add 30-50 μL RNase-free water and repeat step (12). Combine the two liquids, or use the first eluate and add it back to the adsorption column and repeat the step.
[0055] RNA reverse transcription to cDNA:
[0056] cDNA synthesis was performed using the Gold Reverse Transcription Kit as follows. The reaction system is shown in Table 1.
[0057] Table 1 RNA reverse transcription to cDNA reaction system
[0058]
[0059] The reaction procedure was: 42°C for 30 min, 85°C for 5 s, and storage at 12°C.
[0060] The target gene CoCCL1 was amplified by PCR using cDNA as a template. The reaction system is shown in Table 2.
[0061] Table 2 CoCCL1 gene cloning reaction system
[0062]
[0063] The reaction procedure was as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 2:30 min (1 min / 1 kb), final extension at 72°C for 5 min, storage at 12°C, ∞.
[0064] Phanta Max MasterMix requires the addition of loading buffer, and 20 μL of the product to be detected requires the addition of 4 μL of loading buffer. To increase product recovery efficiency, three replicate samples can be spotted consecutively to facilitate gel excision and recovery.
[0065] Among them: The positions of the primers designed in Table 2 are the non-coding regions (UTR) at both ends of the gene, which can encode the full-length gene.
[0066] PCR products were detected by 1% agarose gel electrophoresis;
[0067] After the PCR product was subjected to agarose gel electrophoresis, the target gene band was detected in a gel imager and the gel was recovered using the GeneJET gel recovery kit.
[0068] Example 2
[0069] Engineering bacteria construction
[0070] The cloning vector pClone007 Versatile Simple Vector (TSV-007VS purchased from Qingke Gene Co., Ltd.) was connected. The connection system is shown in Table 3.
[0071] Table 3 Target gene fragment ligation cloning vector system
[0072]
[0073] The ligation system was placed in a PCR instrument at 25°C for 10 minutes. After ligation, the competent cells of the E. coli cloning strain DH5α were immediately transformed. The transformation steps are as follows:
[0074] (1) Take 100 μL of competent cells thawed on ice (thaw only on ice), add 10 μL of ligation product to the competent cells, mix gently with a pipette, and let stand on ice for 25 minutes. The vector and competent cells are usually divided into 2 or 3 aliquots, i.e., 33 or 50 μL each.
[0075] (2) Heat shock in a 42°C water bath for 45-60 seconds, then quickly transfer to an ice bath and let stand for 2 minutes. Do not shake the sample during the ice bath. The temperature and time of this step must be very accurate, and shaking is not allowed.
[0076] (3) Add 700 μL of non-resistant liquid LB medium to the centrifuge tube, mix well, and shake at 37°C, 200 rpm for 1 hour to recover the cells. After recovery, centrifuge at 4000 rpm to enrich the cells.
[0077] (4) Invert the centrifuge tube to discard the culture medium, leaving about 100 μL of culture medium and bacteria. Mix the bacteria by pipetting, and evenly spread the bacterial liquid on the LB culture medium plate containing Amp antibiotics. Invert the plate and culture it in a 37°C incubator for 12-16 hours.
[0078] After the strain grows out of the plate, a positive clone test is required to ensure that the recombinant vector has been successfully transferred into the strain. The method is as follows:
[0079] PCR testing:
[0080] PCR identification of bacterial suspension was performed using 2×T5 SuperPCRMix (Colony). A single colony was picked with a pipette tip and transferred to 1 mL of ampicillin-resistant LB medium. The culture was incubated at 37°C, 200 rpm, for 6 h. 1 μL of the bacterial suspension was used as a template for identification using the universal vector primers M13F / M13R.
[0081] The PCR reaction system is shown in Table 4:
[0082] Table 4 PCR system for positive clone detection of cloning strains
[0083]
[0084] The reaction procedure was as follows: preliminary denaturation at 98°C for 1 min; denaturation at 98°C for 10 s, annealing at 60°C for 10 s, extension at 72°C for 20 s, 35 cycles; final extension at 72°C for 2 min; and storage at 12°C.
[0085] Detect bands by agarose gel electrophoresis. Positive clones containing the target band should be saved and sent to the company for sequencing.
[0086] The sequencing results were compared with the screening results of the Camellia oleifera genome, and the sequences with consistent results were used for subsequent experiments.
[0087] After successful sequencing, primers for the pGEX-4T-1-CCL expression vector were designed, and the target gene fragment was cloned using the above-mentioned positive strains as templates. PCR was performed according to the reaction conditions in Table 5:
[0088] The primer sequences are:
[0089] Forward primer F-gatctggttccgcgtggatccatggtggaagagagacatagacg, as shown in SEQ ID No. 5;
[0090] Reverse primer R-gacccatggagtctagaattcttataacctgctgacactgacagatcc, as shown in SEQ ID No.6
[0091] (Among them, the gatctggttccgcgtggatcc part of the forward primer and the gacccatggagtctagaattc part of the reverse primer are the homologous arm parts of homologous recombination).
[0092] Table 5 Target gene cloning system
[0093]
[0094]
[0095] Place in PCR instrument, reaction program is: initial denaturation at 94℃ for 5min; 35 cycles of reaction: 94℃ for 30s, 66℃ for 30s, 72℃ for 2min; final extension at 72℃ for 7min, and storage at 12℃.
[0096] The expression vector pGEX-4T-1 was double-digested to linearize it. The enzyme digestion system is shown in Table 6:
[0097] Table 6 Expression vector pGEX-4T-1 enzyme digestion system
[0098]
[0099] The enzyme digestion was carried out at 37°C for 1 h, and the PCR product and linearized vector were subjected to agarose gel electrophoresis. After confirming the acquisition of the target band, gel recovery was performed (gel recovery kit).
[0100] The pGEX-4T-1-CCL recombinant vector was constructed using homologous recombinase. The ligation system was reacted at 37°C for 30 min. The recombinant vector ligation system is shown in Table 7:
[0101] Table 7 Recombinant vector ligation system
[0102]
[0103] The ligation reaction was continued at 37°C for 30 minutes. After the reaction was completed, the ligation reaction was immediately placed on ice to obtain the recombinant vector connected with the target fragment. After the recombinant product was cooled on ice, it was transformed into E. coli competent cells, plated and cultured, and a single clone was selected for bacterial culture. The expression vector primers of pGEX-4T-1-CCL were used to detect the positive clones in the bacterial culture by PCR. The bacterial culture with the target band was subjected to plasmid extraction. The plasmid in the bacterial culture was extracted using the Tiangen Plasmid Extraction Kit (see Figure 2 ) and detect the plasmid concentration.
[0104] Transform E. coli expression strain Rosetta (DE3) competent cells (the method is the same as that for transforming E. coli cloning strain DH 5α competent cells) to obtain a protein expression strain, which is then deposited under patent procedures.
[0105] Example 3
[0106] Protein induction expression and optimization of induction conditions
[0107] To induce protein expression, follow these steps:
[0108] (1) Take 20 μL of protein expression strain and transfer to a 6 mL microplate and shake overnight;
[0109] (2) 6 mL was inoculated into 200 mL LB liquid medium and cultured in a 37°C, 200 rpm incubator with shaking for about 4-6 hours until the OD 600 When the pH reaches 0.6, 1 mL of bacterial solution was taken and reserved as a control sample before induction;
[0110] (3) During induction, set the IPTG concentration gradient of 0.25mM, 0.5mM, 0.75mM, and 1mM, the temperature gradient of 12℃, 16℃, 20℃, 25℃, and 37℃, and the time gradient of 12h, 16h, and 20h. After the induction, record the OD 600 value;
[0111] (4) After induction, the cells were collected by centrifugation at 4°C, 4000 rpm for 1 min, washed with 5 mL of 50 mM PBS buffer (pH 7.3), centrifuged at 4°C, 4000 rpm for 1 min, the supernatant was discarded, and the cells were resuspended in pre-cooled 1× PBS buffer to an OD of 600 The ultrasonic power was set to 50% after 3 s of ultrasonication.
[0112] (5) After the ultrasonic treatment, centrifuge at 12,000 rpm for 5 min at 4°C to separate the supernatant and precipitate, and transfer the supernatant to a new centrifuge tube.
[0113] The supernatants of the samples before induction and before and after induction and ultrasound were subjected to SDS-PAGE polyacrylamide gel electrophoresis.
[0114] After protein electrophoresis, the bands were observed using Coomassie Brilliant Blue staining.
[0115] Experimental conclusion: The optimal induction conditions for E. coli are: induction temperature 20℃, inducer IPTG concentration 0.25mM, induction time 16h. (Attached Figure 3 )
[0116] Example 4
[0117] Protein purification
[0118] Use GST protein purification medium to purify the target protein. The steps are as follows:
[0119] (1) Gravity column filling: Place a sieve plate at the bottom of the gravity column, rinse the gravity column and sieve plate with pure water, and then take 3 mL of the mixed medium and load it into the gravity column; add pure water to wash the medium, and then use the balance solution to wash the medium, and repeat 3 times.
[0120] (2) After sonication, the sample was centrifuged at 12,000 rpm for 10 min, and the supernatant was filtered through a 45 μm filter membrane and added to a gravity column;
[0121] (3) Incubate at 4°C, 30 rpm on a shaker for 3 h. After the incubation period, collect the flow-through.
[0122] (4) Wash the medium with a washing solution 5 times the volume of the medium, collect the washing solution, and repeat 3 times;
[0123] (5) Wash the medium with elution buffer 3 times the volume of the medium, incubate at room temperature for 5 minutes, collect the eluate, and repeat three times.
[0124] The purified samples were subjected to SDS-PAGE detection.
[0125] After obtaining the sample containing the target protein, the protein concentration was determined using the BCA protein concentration assay kit from Beyotime Biotechnology.
[0126] Experimental conclusion: The purified target protein was obtained (attached Figure 4 ), the purified enzyme concentration was 7.56 mg / mL.
[0127] Example 5
[0128] In vitro enzymatic reaction
[0129] The purified protein was used for in vitro enzymatic reactions. A blank control without purified enzyme was also performed. Three biological replicates were performed for each group. The reaction system consisted of: 1 mL total volume, 125 μL of 10 mM Coenzyme A, 125 μL of 20 mM ATP, 125 μL of 50 mM angelic acid, 125 μL of 100 mM magnesium chloride, 250 μL of acyl-CoA synthetase prepared in Example 4, and 250 μL of PBS buffer. The reaction mixture was incubated at 30°C, 37°C, and 45°C for 12 h. After completion of the reaction, 1 mL of methanol was added to terminate the reaction. Protein was removed by filtration using a 10 kDa ultrafiltration tube. After centrifugation at 12,000 rpm for 10 min, the supernatant was filtered through a 0.22 μm organic phase filter and sampled for analysis by high-performance liquid chromatography-mass spectrometry.
[0130] High-performance liquid chromatography-mass spectrometry analysis: Samples were separated using a Shimadzu GIST reversed-phase C18 column with a 5 μm particle size, 4.6 mm inner diameter, and 25 mm column length. A 10 μL sample was loaded at a flow rate of 0.3 mL / min and a column temperature of 40°C. Mobile phase A consisted of 10 mM ammonium acetate (NH4OAc) in water, and mobile phase B consisted of acetonitrile. The gradient elution program was as follows: 5% B from 0 to 2 min; 5% to 40% B from 2 to 15 min; 40% to 95% B from 15 to 20 min; 100% B from 20 to 25 min; and finally, 5% B for 30 min. Mass spectrometry signals were acquired using a Shimadzu triple quadrupole with electrospray ionization (ESI) in positive ion mode for information data acquisition (IDA). The MS parameters were set as ion spray voltage, -5000 V; gas temperature, 400°C; collision energy, 25 V; and mass-to-charge ratio detection range, 50-1200 m / z.
[0131] Experimental conclusion: At 30°C, acyl-CoA synthetase can catalyze the synthesis of angelic acid and coenzyme A into angelic acid-CoA, while at 37°C and 45°C, the enzyme has no catalytic function. Therefore, at 30°C, the enzymatic reaction system of the present invention has the highest efficiency and can synthesize angelic acid-CoA (attached Figure 5 ).
[0132] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.
[0133] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A gene encoding acyl-CoA synthetase in Camellia oleifera, characterized in that: The gene sequence is shown in SEQ ID No.
1.
2. The acyl-CoA synthetase in Camellia oleifera according to claim 1, characterized in that The amino acid sequence is shown in SEQ ID No.
2.
3. An expression cassette, recombinant vector, or genetically engineered bacterium containing the coding gene according to claim 1.
4. The genetically engineered bacterium according to claim 3, wherein The engineered bacteria is: Escherichia coli ZCB1, with a preservation number of CCTCC NO: M 20251512.
5. A method for constructing a genetically engineered bacterium containing the coding gene according to claim 1, characterized in that: The following steps are involved: (1) Cloning of the gene encoding acyl-CoA synthetase; (2) The cloned product was connected to the cloning vector pClone007 Versatile Simple Vector and transformed into competent cells of Escherichia coli cloning strain DH5α to screen for positive clones; (3) Design primers for pGEX-4T-1-CCL expression vector: Forward primer F- gatctggttccgcgtggatcc atggtggaagagagagacatagacg, as shown in SEQ ID No. 5; Reverse primer R- gacccatggagtctagaattc ttataacctgctgacactgacagatcc, as shown in SEQ ID No. 6; The positive cloned bacteria were used as templates to clone the target gene fragment; the expression vector pGEX-4T-1 was double-digested with EcoRI and BamHI; and the pGEX-4T-1-CCL recombinant vector was constructed by homologous recombination; (4) Transform the competent cells of Escherichia coli expression strain RosettaDE3 to obtain genetically engineered bacteria.
6. The protein induction method of genetically engineered bacteria according to claim 5, characterized in that: Induction expression conditions: 20°C, final IPTG concentration 0.25 mM, induction 16 h.
7. Use of the encoding gene according to claim 1, or the synthetase according to claim 2, or the expression cassette according to claim 3, or the recombinant vector, or the genetically engineered bacteria in fermentation.
8. The use according to claim 7, characterized in that The application is used for the biosynthesis of camellia oleifera triterpenoid saponins.
9. The use according to claim 8, characterized in that Enzymatic reaction system: total volume 1 mL, 10 mM Coenzyme A 125 μL, 20 mM ATP 125 μL, 50 mM angelic acid 125 μL, 100 mM magnesium chloride 125 μL, acyl-CoA synthetase 250 μL, PBS buffer 250 μL; reaction conditions: 30°C, 12 h.
Citation Information
Patent Citations
Acyl-coenzyme A synthetase and application thereof
CN103725652A
Flavone 3-O-monooxygenase coding gene of rhus chinensis
CN107058347A
Acyl-coenzyme A synthetase mutant as well as coding gene, expression strain and application thereof
CN116064427A
Isolated polynucleotides and polypeptides, and methods of using same for improving plant properties
US20200017872A1