Camellia oleifera acyl-coa synthetase and application thereof

Abstract

The application discloses an acyl-CoA synthetase in camellia oleifera and application thereof, relates to the technical field of enzyme engineering, and provides a coding gene, an amino acid sequence and a genetically engineered bacterium prepared by using the gene and application thereof. The acyl-CoA synthetase provided by the application is an enzyme rarely active to angelic acid, and can provide a direct substrate for cloning angelic acid acyltransferase of camellia oleifera. The acyl-CoA synthetase provided by the application is active to angelic acid, and can be used in the field of secondary metabolite biosynthesis.

Description

Technical Field

[0001] This invention relates to the field of enzyme engineering technology, and more specifically to an acyl-CoA synthase from camellia oleifera and its application. Background Technology

[0002] Camellia oleifera is a unique woody oilseed tree species in my country, possessing extremely high medicinal and economic value. The camellia oil cake, obtained after oil extraction from camellia seeds, contains various active substances, including camellia saponins. Camellia triterpenoid saponins exhibit significant biological activity; various camellia saponin monomers have been isolated and identified, demonstrating anti-inflammatory, anticancer, and antibacterial pharmacological activities. Most of the camellia triterpenoid saponins with anticancer activity are modified with an angelic acyl group. The angelic acyl modification donor is angelic acyl-CoA, whose synthesis depends on the catalysis of angelic acyl-CoA synthase. Currently, the biosynthesis of camellia triterpenoid saponins has not been reported, research on camellia acyl-CoA synthase is scarce, and research on camellia angelic acyl-CoA synthase is entirely lacking. Obtaining angelic acyl-CoA from other methods is also quite difficult.

[0003] Therefore, whether or not a synthase for acyl-CoA synthetase in camellia oleifera can be provided and its application is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0004] In view of this, the present invention provides an acyl-CoA synthase from Camellia oleifera and its application. Based on the Camellia oleifera genome, bioinformatics methods were used to screen for acyl-CoA synthase genes, the target gene was heterologously expressed using a prokaryotic expression system, and its function was verified by in vitro enzymatic reactions, ultimately synthesizing Angelica acyl-CoA.

[0005] Preservation information: Escherichia coli ZCB1, deposited at China Center for Type Culture Collection, Wuhan University, Wuhan, China; deposit date: July 2, 2025; accession number: CCTCC NO: M20251512.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A gene encoding an acyl-CoA synthase in Camellia oleifera, the gene sequence of which is shown in SEQ ID No. 1.

[0008] The present invention also provides the above-mentioned acyl-CoA synthase from Camellia oleifera, the amino acid sequence of which is shown in SEQ ID No. 2.

[0009] The present invention also provides an expression cassette, or recombinant vector, or genetically engineered bacteria containing the above-mentioned coding gene.

[0010] Preferred engineered bacteria: Escherichia coli ZCB1, preservation number: CCTCCNO: M20251512.

[0011] This invention also provides a method for constructing genetically engineered bacteria containing the above-mentioned encoding gene, comprising the following steps:

[0012] (1) Cloning of the gene encoding acyl-CoA synthase;

[0013] (2) The cloning product was ligated into the cloning vector pClone007 Versatile Simple Vector, transformed into Escherichia coli cloning strain DH 5α competent cells, and positive clones were obtained by screening.

[0014] (3) Design primers for the pGEX-4T-1-CCL expression vector:

[0015] Forward primer F- gatctggttccgcgtggatcc atggtggaagagagagacatagacg, as shown in SEQ ID No. 5;

[0016] Reverse primer R- gacccatggagtctagaattc ttataacctgctgacactgacagatcc, as shown in SEQ ID No. 6;

[0017] The target gene fragment was cloned using positive clone bacteria as a template; the expression vector pGEX-4T-1 was double-digested with EcoRI and BamHI; and the pGEX-4T-1-CCL recombinant vector was constructed by homologous recombination.

[0018] (4) Transform Escherichia coli expression strain RosettaDE3 competent cells to obtain genetically engineered bacteria.

[0019] The present invention also provides a protein induction method for the above-mentioned genetically engineered bacteria, wherein the induction expression conditions are: 20°C, final IPTG concentration of 0.25mM, and induction for 16h.

[0020] The present invention also provides the application of the above-mentioned encoding gene, or the above-mentioned synthase, or the above-mentioned expression cassette, or the recombinant vector, or the genetically engineered bacteria in fermentation.

[0021] Preferred application: Biosynthesis of triterpenoid saponins from Camellia oleifera.

[0022] Preferred enzyme reaction system: total volume 1 mL, 10 mM coenzyme A 125 μL, 20 mM ATP 125 μL, 50 mM angelic acid 125 μL, 100 mM magnesium chloride 125 μL, acyl-CoA synthetase 250 μL, PBS buffer 250 μL; reaction conditions: 30℃, 12 h.

[0023] As can be seen from the above technical solution, compared with the prior art, the present invention discloses an acyl-CoA synthase in camellia oil and its application, and the technical effects achieved are as follows:

[0024] The acyl-CoA synthase provided by this invention is a rare enzyme active to angelic acid, and can provide a direct substrate for cloning Camellia oleifera angelic acyltransferase. The acyl-CoA synthase provided by this invention, being active to angelic acid, can also be used in the field of secondary metabolite biosynthesis.

[0025] Specifically: This invention clones the target gene CoCCL1 from Camellia oleifera seed kernels by designing specific primers, performs homology modeling on the protein encoded by the gene, predicts its tertiary structure, predicts from the structure that it has acyl-CoA synthesis function, and predicts that the enzyme encoded by CoCCL1 does not have a transmembrane domain. The recombinant expression vector pGEX-4T-1-CCL, namely CoCCL1-4T1, is constructed using homologous recombination.

[0026] The Escherichia coli prokaryotic expression system was selected for protein expression. The induction temperature, induction time, and inducer concentration were screened, and the optimal induction conditions for expressing the target protein in the prokaryotic expression system were obtained: 20℃, final inducer concentration of 0.25mM, and induction for 16h. The target protein was expressed under the optimal induction conditions and purified by affinity chromatography.

[0027] A suitable enzymatic reaction system was established using purified enzyme as a catalyst: a total volume of 1 mL, 125 μL of 10 mM coenzyme A, 125 μL of 20 mM ATP, 125 μL of 50 mM angelic acid, 125 μL of 100 mM magnesium chloride, 250 μL of purified enzyme, and 250 μL of PBS buffer. An in vitro enzymatic reaction was then performed. A suitable liquid chromatography-mass spectrometry (LC-MS) method was established, and the target product was detected by LC-MS. This indicates that the purified enzyme can catalyze the synthesis of angelic acyl coenzyme A from angelic acid and coenzyme A in the system, and that 30 °C is the optimal temperature for the in vitro enzymatic reaction. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0029] Figure 1 The attached figure is a sequence alignment diagram of the CoCCL1 amino acid sequence provided by this invention.

[0030] Figure 2The attached figure is a map of the CoCCL1-4T1 recombinant plasmid provided by the present invention.

[0031] Figure 3 The attached figure is a diagram of the optimization of protein induction conditions provided by the present invention, wherein A: screening of optimal induction temperature; B: screening of optimal inducer concentration; and C: screening of optimal induction time.

[0032] Figure 4 The attached figure is an SDS-PAGE image of the purified target protein provided by the present invention, wherein M: protein label; a: bacterial supernatant before induction; b: bacterial supernatant before ultrasonic disruption; c: bacterial supernatant after ultrasonic disruption; dg: purified protein sample.

[0033] Figure 5 The attached figure is a detection chromatogram of the synthetic activity of CoCCL angelic acyl coenzyme A provided by the present invention, wherein A: HPLC chromatogram, 1: angelic acyl CoA, 2: CoA, 3: ATP, 4: angelic acid; B: mass spectrum of peak 1. Detailed Implementation

[0034] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0035] This invention discloses an acyl-CoA synthase from Camellia oleifera and its application.

[0036]

[0037] The amino acid sequence alignment of CoCCL1 with sequences of genes identified in the literature that possess angelic acyl-CoA synthesis function is shown below. Figure 1 The results show that the structures are highly similar and have the same conserved structural domains, and the functions of CoCCL1 can be preliminarily predicted.

[0038] Example 1

[0039] CoCCL1 gene cloning

[0040] RNA extraction:

[0041] RNA was extracted from different tissues of Camellia oleifera using liquid nitrogen grinding, and the steps are as follows:

[0042] (1) Grind fresh or frozen camellia oil material into fine powder in liquid nitrogen.

[0043] (2) Take about 200 mg of fine powder into 1 mL of preheated lysis buffer CLB (with added β-mercaptoethanol), and mix the lysis buffer and plant sample by pipetting with a pipette tip. The lysis buffer can cut DNA, reduce viscosity and increase yield.

[0044] (3) Place in a 65℃ metal bath for 10 minutes, and invert the centrifuge tube twice during the lysis process to help with the lysis.

[0045] (4) Centrifuge the lysate at 13000 rpm for 10 min to precipitate the fragments that cannot be lysed.

[0046] (5) Transfer the supernatant of the lysate to a new centrifuge tube, add half the volume of anhydrous ethanol to the supernatant and immediately mix by pipetting, do not centrifuge.

[0047] (6) Add the mixture to a genome clearance column, place the clearance column into a collection tube, centrifuge at 13000 rpm for 2 min, and discard the waste liquid.

[0048] (7) Place the genomic DNA removal column in a clean 2mL centrifuge tube, add 500μL of lysis buffer RLT Plus, centrifuge at 13000rpm for 30s, collect the filtrate (RNA is in the filtrate), accurately estimate the volume of the filtrate with a pipette, add 0.5 times the volume of anhydrous ethanol to the filtrate, mix immediately by pipetting, do not centrifuge.

[0049] (8) Add the mixture to an adsorption column RA, place the adsorption column in a collection tube, centrifuge at 13000 rpm for 2 min, and discard the waste liquid.

[0050] (9) Add 700 μL of protein removal solution RW1, place at room temperature for 1 min, centrifuge at 13000 rpm for 30 s, and discard the waste liquid.

[0051] (10) Add 500 μL of rinsing buffer RW containing anhydrous ethanol, centrifuge at 13000 rpm for 30 s, and discard the waste liquid. Add 500 μL of rinsing buffer RW and repeat once.

[0052] (11) Repeat centrifugation at 13000 rpm for 2 min to thoroughly remove the rinsing solution.

[0053] (12) Take out the adsorption column RA and put it into a new centrifuge tube without RNase. Add 50 μL of RNase-free water preheated at 70℃ to the middle of the adsorption membrane, let it stand at room temperature for 1 min, and centrifuge at 12000 rpm for 1 min.

[0054] (13) Use an ELISA reader to determine the RNA concentration. If the expected RNA yield is >30 μg, add 30-50 μL of RNase free water and repeat step (12). Combine the two liquids, or use the first elution buffer to add back to the adsorption column and repeat the step once.

[0055] RNA is reverse transcribed into cDNA:

[0056] cDNA synthesis was performed using a full-gold reverse transcription kit. The steps are as follows, and the reaction system is shown in Table 1.

[0057] Table 1. RNA reverse transcription to cDNA reaction system

[0058]

[0059] The reaction procedure was as follows: 42℃ for 30 min, 85℃ for 5 s, and stored at 12℃.

[0060] Using cDNA as a template, the target gene CoCCL1 was amplified by PCR. The reaction system is shown in Table 2.

[0061] Table 2. CoCCL1 gene cloning reaction system

[0062]

[0063] The reaction procedure was as follows: pre-denaturation at 95℃ for 3 min, denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 2:30 min (1 min / 1 kb), final extension at 72℃ for 5 min, storage at 12℃, and infinity.

[0064] Phanta Max MasterMix requires the addition of loading buffer; 20 μL of the product to be detected requires the addition of 4 μL of loading buffer. To increase product recovery efficiency, three replicate samples can be spotted together for easy gel cutting and recovery.

[0065] Among them, the primers in Table 2 are designed to be located in the uncoding regions (UTRs) at both ends of the gene, which can encode the full-length gene.

[0066] PCR products were detected by 1% agarose gel electrophoresis;

[0067] After PCR products were subjected to agarose gel electrophoresis, the target gene bands were detected in a gel imaging system, and the gel was recovered using the GeneJET gel recovery kit.

[0068] Example 2

[0069] Construction of engineered bacteria

[0070] The ligation vector pClone007 Versatile Simple Vector (purchased from Chintech Gene Co., Ltd. TSV-007VS) was used, and the ligation system is shown in Table 3.

[0071] Table 3. Target gene fragment ligation cloning vector system

[0072]

[0073] The ligation system was placed in a PCR instrument and reacted at 25°C for 10 min. Immediately after ligation, it was transformed into E. coli clone strain DH5α competent cells. The transformation steps are as follows:

[0074] (1) Take 100 μL of competent cells thawed on ice (only thaw on ice), add 10 μL of ligation product to the competent cells, mix gently with a pipette, and let stand on ice for 25 min. The vector and competent cells are usually divided into 2 or 3 portions, i.e., 33 or 50 μL each.

[0075] (2) Heat shock in a 42℃ water bath for 45-60 seconds, then quickly transfer to an ice bath and let stand for 2 minutes. Do not shake the sample during the standing process on ice. The temperature and time in this step must be very accurate, and the sample must not be shaken.

[0076] (3) Add 700 μL of antibiotic-free liquid LB medium to a centrifuge tube, mix well, and shake at 37°C and 200 rpm for 1 h to recover. After recovery, centrifuge at 4000 rpm to enrich the bacterial cells.

[0077] (4) Invert the centrifuge tube to discard the culture medium, leaving about 100 μL of culture medium and bacterial cells. Mix the bacterial cells by pipetting, and spread the bacterial solution evenly onto LB medium plates containing Amp antibiotic. Invert the plates and incubate them in a 37°C incubator for 12-16 hours.

[0078] After the strain grows on the plate, a positive clone test is required to ensure that the recombinant vector has been successfully transferred into the strain. The method is as follows:

[0079] PCR testing:

[0080] Bacterial PCR identification was performed using 2×T5 SuperPCRMix (Colony). A single colony was picked with a pipette tip and added to 1 mL of ampicillin-resistant LB medium. The culture was incubated at 37°C and 200 rpm for 6 h. 1 μL of the bacterial culture was used as a template for identification using the universal primers M13F / M13R.

[0081] The PCR reaction system is shown in Table 4:

[0082] Table 4. PCR system for detecting positive clones of clonal strains

[0083]

[0084] The reaction procedure was as follows: pre-denaturation at 98℃ for 1 min; denaturation at 98℃ for 10 s; annealing at 60℃ for 10 s; extension at 72℃ for 20 s; 35 cycles; final extension at 72℃ for 2 min; and storage at 12℃.

[0085] Agarose gel electrophoresis was used to detect the bands. Positive clones containing the target band were preserved and sent to the company for sequencing.

[0086] The sequencing results were compared with the Camellia oleifera genome screening results, and sequences that matched the comparison results were used for subsequent experiments.

[0087] After successful sequencing, primers for the pGEX-4T-1-CCL expression vector were designed, and the target gene fragment was cloned using the above-mentioned positive bacterial species as templates. PCR was performed according to the reaction conditions in Table 5.

[0088] The primer sequences are:

[0089] The forward primer F-gatctggttccgcgtggatccatggtggaagagagagacatagacg, as shown in SEQ ID No. 5;

[0090] The reverse primer R-gacccatggagtctagaattcttataacctgctgacactgacagatcc, as shown in SEQ ID No. 6.

[0091] (Among them, the gatctggttccgcgtggatcc part of the forward primer and the gacccatggagtctagaattc part of the reverse primer are the homologous arm parts of homologous recombination).

[0092] Table 5. Target gene cloning system

[0093]

[0094]

[0095] Place the sample in a PCR instrument and run the following reaction program: pre-denaturation at 94℃ for 5 min; 35 cycles: 94℃ for 30 s, 66℃ for 30 s, 72℃ for 2 min; final extension at 72℃ for 7 min; store at 12℃.

[0096] The expression vector pGEX-4T-1 was linearized by double enzyme digestion. The enzyme digestion system is shown in Table 6.

[0097] Table 6. Enzyme digestion system of expression vector pGEX-4T-1

[0098]

[0099] Enzyme digestion at 37℃ for 1 hour, followed by agarose gel electrophoresis of the PCR product and linearized vector. After obtaining the target band, the gel was recovered (using a gel recovery kit).

[0100] The pGEX-4T-1-CCL recombinant vector was constructed using homologous recombinase. The ligation system was incubated at 37°C for 30 min. The ligation system of the recombinant vector is shown in Table 7.

[0101] Table 7 Recombinant Vector Linkage System

[0102]

[0103] The reaction was carried out at 37℃ for 30 min, and immediately cooled on ice afterward to obtain a recombinant vector containing the target fragment. After cooling on ice, the recombinant product was transformed into competent *E. coli* cells. Single clones were selected from plate cultures for further culture, and positive clones were detected by PCR using primers for the pGEX-4T-1-CCL expression vector. Plasmids were extracted from the bacterial cultures containing the target band using the Tiangen plasmid extraction kit (see [link to Tiangen plasmid extraction kit]). Figure 2 ), and detect plasmid concentration.

[0104] Transform Escherichia coli expression strain Rosetta(DE3) competent cells (using the same method as transforming Escherichia coli clone strain DH 5α competent cells) to obtain protein expression strains, and preserve them using patent procedures.

[0105] Example 3

[0106] Protein expression induction and optimization of induction conditions

[0107] The steps for inducing protein expression are as follows:

[0108] (1) Take 20 μL of the protein expression strain into 6 mL of water and shake overnight;

[0109] (2) Inoculate 6 mL into 200 mL of LB liquid medium and incubate at 37°C with shaking for about 4-6 hours until OD. 600 Once the concentration reaches 0.6, 1 mL of bacterial culture is retained as a control sample before induction.

[0110] (3) During induction, set IPTG concentration gradients of 0.25 mM, 0.5 mM, 0.75 mM, and 1 mM; temperature gradients of 12℃, 16℃, 20℃, 25℃, and 37℃; and time gradients of 12 h, 16 h, and 20 h. Record OD after induction. 600 value;

[0111] (4) After induction, collect bacterial cells by centrifugation at 4000 rpm for 1 min at 4°C. Wash the cells with 5 mL of 50 mM PBS buffer (pH 7.3), centrifuge at 4000 rpm for 1 min at 4°C, remove the supernatant, and resuspend the cells in pre-cooled 1×PBS buffer until OD. 600 The value was 15. 200 μL of sample was taken as the pre-ultrasound sample and placed on ice for ultrasonic disruption for 20 min. The ultrasonication was stopped for 3 seconds every 3 seconds, and the power was set to 50%.

[0112] (5) After the ultrasound is completed, centrifuge at 4℃ and 12000rpm for 5min to separate the supernatant and precipitate. Transfer the supernatant to a new centrifuge tube.

[0113] The supernatant of the sample before induction and the supernatant of the sample before and after sonication were detected by SDS-PAGE polyacrylamide gel electrophoresis.

[0114] After protein electrophoresis, the bands were observed using Coomassie brilliant blue staining.

[0115] Experimental conclusion: The optimal induction conditions for *E. coli* are: induction temperature 20℃, IPTG concentration 0.25mM, and induction time 16h. (Appendix) Figure 3 )

[0116] Example 4

[0117] Protein purification

[0118] The target protein was purified using GST protein purification media, and the steps are as follows:

[0119] (1) Gravity column loading: Install a sieve plate at the bottom of the gravity column, rinse the gravity column and sieve plate with pure water, take 3 mL of the mixed medium and load it into the gravity column; add pure water to clean the medium, and then use equilibration solution to clean the medium. Repeat 3 times.

[0120] (2) After sonication, the sample was centrifuged at 12,000 rpm for 10 min. The supernatant was filtered through a 45 μm filter membrane and then added to a gravity column.

[0121] (3) Incubate at 4℃ and 30rpm for 3 hours on a shaker. After incubation, collect the flow-through liquid.

[0122] (4) Clean the medium with a washing solution of 5 times the volume of the medium, collect the washing solution, and repeat 3 times;

[0123] (5) Wash the medium with 3 times the volume of eluent, incubate at room temperature for 5 min, collect the eluent, and repeat three times.

[0124] The purified sample was analyzed by SDS-PAGE.

[0125] After obtaining the sample containing the target protein, the protein concentration was determined using the BCA protein concentration assay kit from Beyotime Biotechnology Co., Ltd.

[0126] Experimental conclusion: The purified target protein was obtained (see appendix). Figure 4 The purified enzyme concentration was 7.56 mg / mL.

[0127] Example 5

[0128] In vitro enzymatic reaction

[0129] The purified protein was used for in vitro enzymatic reactions, with a blank control without purified enzyme. Three biological replicates were performed in each group. The reaction system consisted of: 1 mL total volume, 125 μL of 10 mM coenzyme A, 125 μL of 20 mM ATP, 125 μL of 50 mM angelic acid, 125 μL of 100 mM magnesium chloride, 250 μL of acyl-CoA synthetase prepared in Example 4, and 250 μL of PBS buffer. The reaction mixture was incubated at 30 °C, 37 °C, and 45 °C for 12 h, respectively. The reaction was terminated by adding 1 mL of methanol after the reaction was complete. Protein was removed by filtration using a 10 kDa ultrafiltration tube. After centrifugation at 12000 rpm for 10 min, the supernatant was filtered through a 0.22 μm organic phase filter membrane for high-performance liquid chromatography-mass spectrometry (HPLC-MS) analysis.

[0130] High-performance liquid chromatography-mass spectrometry (HPLC-MS / MS) analysis: A Shimadzu GIST reversed-phase C18 column (5 μm particle size, 4.6 mm inner diameter, 25 mm length) was used for sample separation. The sample loading was 10 μL, the flow rate was set to 0.3 mL / min, and the column temperature was set to 40 °C. Mobile phase A was 10 mM ammonium acetate (NH₄OAc) aqueous solution, and mobile phase B was acetonitrile. The gradient elution program was as follows: 0-2 min, 5% B; 2-15 min, 5%-40% B; 15-20 min, 40%-95% B; 20-25 min, 100% B; and finally, a hold of 5% B for 30 min. Mass spectrometry signal acquisition was performed using a Shimadzu triple quadrupole, employing electrospray ionization (ESI) in positive ion mode for data acquisition (IDA). MS parameters are set as follows: ion spray voltage -5000V; gas temperature 400℃; collision energy 25V; mass-to-charge ratio detection range 50-1200m / z.

[0131] Experimental conclusion: At 30℃, acyl-CoA synthase can catalyze the synthesis of angelic acid and coenzyme A into angelic acyl-CoA, while the enzyme does not have catalytic function at 37℃ and 45℃. Therefore, the enzymatic reaction system in this invention has the highest efficiency at 30℃, achieving the highest synthesis rate of angelic acyl-CoA (see attached diagram). Figure 5 ).

[0132] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0133] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A gene encoding acyl-CoA synthetase in Camellia oleifera, characterized by, The gene sequence is shown in SEQ ID No.

1.

2. The acyl-CoA synthetase of Camellia oleifera according to claim 1, characterized in that, The amino acid sequence is shown in SEQ ID No.

2.

3. An expression cassette containing the encoding gene of claim 1, or a recombinant vector, or a genetically engineered bacterium.

4. The genetically engineered bacteria as described in claim 3, characterized in that, The engineered bacteria is: *Escherichia coli* (… Escherichia coli ZCB1, accession number: CCTCC NO: M 20251512.

5. A method for constructing a genetically engineered bacterium containing the encoding gene of claim 1, characterized in that, Includes the following steps: (1) Cloning of the gene encoding acyl-CoA synthase; (2) The cloning product was ligated into the cloning vector pClone007 Versatile Simple Vector and transformed into Escherichia coli cloning strain DH 5α competent cells. Positive clones were obtained through screening; (3) Design primers for the pGEX-4T-1-CCL expression vector: The forward primer F-gatctggttccgcgtggatccatggtggaagagagagacatagacg, as shown in SEQ ID No. 5; The reverse primer R-gacccatggagtctagaattcttataacctgctgacactgacagatcc is shown in SEQ ID No. 6; The target gene fragment was cloned using the positive clone bacteria as a template; the expression vector pGEX-4T-1 was digested with EcoRI and BamHI; homologous recombination was performed. Construct the pGEX-4T-1-CCL recombinant vector; (4) Transform Escherichia coli expression strain Rosetta DE3 competent cells to obtain genetically engineered bacteria.

6. The method for protein induction of genetically engineered bacteria according to claim 5, characterized in that, Induction conditions: 20℃, final IPTG concentration 0.25 mM, induction for 16 h.

7. The use of the encoding gene of claim 1, or the synthase of claim 2, or the expression cassette of claim 3, or the recombinant vector, or the genetically engineered bacteria in the synthesis of angelic acyl coenzyme A.

8. The application as described in claim 7, characterized in that, Enzymatic reaction system: total volume 1 mL, 10 mM coenzyme A 125 μL, 20 mM ATP 125 μL, 50 mM angelic acid 125 μL, 100 mM magnesium chloride 125 μL, acyl-CoA synthetase 250 μL, PBS buffer 250 μL; reaction conditions: 30 ℃, 12 h.

Images