Chimeric antigen receptor for treating acute myeloid leukemia, cell, nucleotide sequence of cell, recombinant expression vector and pharmaceutical composition
By designing chimeric antigen receptor T cells targeting LSD1 and CLL1, the problems of insufficient expansion and persistence in CAR-T cell therapy were solved, the therapeutic effect on acute myeloid leukemia was significantly improved, and the killing ability and immune memory function of CAR-T cells were enhanced.
Patent Information
- Application Number
- CN202510732520.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-04
- Publication Date
- 2025-09-23
AI Technical Summary
Existing CAR-T cell therapies have limited expansion and persistence issues in the treatment of relapsed/refractory acute myeloid leukemia (R/R-AML), resulting in poor therapeutic effects, and methods targeting the CLL1 antigen have not been fully developed.
A chimeric antigen receptor (CAR) containing binding domains targeting LSD1 and CLL1 is designed to recognize and kill AML cells through chimeric antigen receptor T cells (CAR-T cells). LSD1 inhibition and PD-1/PD-L1 blockade are combined to prolong the lifespan of CAR-T cells and improve therapeutic efficacy.
It significantly improved the therapeutic effect on acute myeloid leukemia, prolonged the lifespan of CAR-T cells, enhanced the killing power and immune memory function against tumor cells, and reduced the exhaustion level.
Smart Images

Figure CN120682374A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of cellular immunotherapy of tumors, and in particular to a chimeric antigen receptor, cells and nucleotide sequences thereof, a recombinant expression vector and a pharmaceutical composition for treating acute myeloid leukemia. Background Art
[0002] Acute myeloid leukemia (AML) is a heterogeneous clonal disease of myeloid progenitor cells and a malignancy affecting the blood and bone marrow. It is a type of acute leukemia that primarily affects myeloid cells—those that develop into red blood cells, white blood cells, and platelets. AML is characterized by abnormal myeloid precursor cells in the bone marrow that lose their ability to differentiate normally and respond to growth regulators. These cells rapidly expand clonally and then undergo differentiation arrest, failing to mature and perform their functions normally, resulting in impaired normal blood cell production. AML progresses rapidly. Without treatment, fatal infections, bleeding, or organ infiltration can occur within a year of diagnosis, leading to life-threatening anemia or severe transfusion dependence. Extramedullary infiltration of AML cells can lead to a variety of complications, including vascular obstruction caused by leukocytic stasis, metabolic abnormalities, increased intracranial pressure, and cranial nerve damage. AML can occur in people of all ages, but is most common in the elderly.
[0003] The treatment of AML requires comprehensive consideration of the patient's age, health status, disease characteristics, and genetic background. For the past three decades, the treatment regimen for patients aged 18 to 60 years has been anthracyclines (such as daunorubicin) and the cytotoxic drug cytarabine, achieving remission rates of 65% to 75%. Supportive care is often used for older patients with AML, but the median survival for these patients is only approximately 10 months, and there is a 15% to 20% risk of treatment-related mortality. The global 5-year disease-free survival (DFS) rate for children with AML ranges from 33.3% to 79.5%. Although 50% to 70% of children with primary AML can be cured with conventional intensive therapy, the introduction of new drugs has not improved cure rates. The relatively poor prognosis of pediatric AML is primarily attributed to the limited availability of targeted drugs or treatments for patients with relapsed / refractory AML (R / R-AML). Therefore, new treatments are urgently needed to further improve the treatment of R / R-AML. Currently, some new drugs have been introduced for the treatment of pediatric R / R-AML (i.e., sorafenib, gilteritinib, gemtuzumab ozogamicin (GO), and venetoclax); however, the response remains unsatisfactory, with a CR / CRi (complete remission / complete remission with incomplete hematologic recovery) rate of approximately 50%.
[0004] Advances in immunotherapy have provided clinicians with new strategies for treating patients with hematologic malignancies. In this regard, autologous chimeric antigen receptor (CAR) T cell therapy has been increasingly accepted as a highly effective treatment option for relapsed / refractory hematologic malignancies. A growing number of researchers are exploring the role of T cells in the treatment of AML, and the search for ideal therapeutic targets has become a crucial task. Bispecific antibodies targeting cell surface antigens restricted to the myeloid lineage (lineage-restricted antigens), including CD33, CD123, CLL1, and FLT3, are in early clinical trials. Currently, several therapies based on T cell target antigens are available. Bispecific antibodies recruit T cells through CD3 and, after binding to tumor-associated antigens, target tumor cells with high affinity. While this approach offers a relatively high safety profile, it suffers from a short half-life, requiring continuous infusion, and potentially dose-limiting toxicities. CAR-T cell therapy, which modifies T cells to specifically recognize and kill AML cells expressing the corresponding antigen, faces challenges such as heterogeneity in antigen expression, immunosuppression in the tumor microenvironment, and potential damage to normal hematopoietic stem cells.
[0005] C-type lectin-like molecule 1 (CLL1) has been identified as a novel AML stem cell-associated antigen. CLL1 is highly expressed on AML leukemic stem cells (LSCs), most AML progenitors, and normal bone marrow cells, but is absent on normal hematopoietic stem cells (HSCs) and lymphoid cells. This suggests that targeting CLL1 may be a novel therapeutic approach for AML while sparing normal hematopoietic and lymphocyte-directed immunity. LSCs are considered the root cause of leukemia relapse. The relapse process is complex, and LSCs possess the ability to self-renew and differentiate, allowing them to evade chemotherapy, leading to disease relapse. CLL1 belongs to the C-type lectin-like receptor family and is a type II transmembrane glycoprotein composed of an extracellular carbohydrate recognition domain, a transmembrane region, and an intracellular NH2-terminus. Ligands for CLL1 are generally believed to be uric acid crystals and some unknown cellular components. Binding of these ligands to CLL1 activates the ITAM-NK-kb inflammatory pathway, promoting immune activation and inflammatory infiltration. CLL1 is specifically expressed in AML and may contribute to the survival, proliferation, and drug resistance of AML cells, but its specific mechanisms remain to be determined. CLL1 is not expressed or expressed at low levels in normal cells, making it considered highly specific and an ideal target for the treatment of AML. Several studies have successfully developed novel CLL1-directed therapies (i.e., antibody- and cell-based therapies) with demonstrated efficacy in human AML, with promising in vitro and in vivo evidence. However, the potential of CAR-T cells for the treatment of R / R-AML remains uncertain.
[0006] CAR-T cell therapy has made impressive progress in the treatment of hematopoietic malignancies, particularly relapsed / refractory diffuse large B-cell lymphoma and relapsed / refractory B-cell acute lymphoblastic leukemia. However, some lymphoma patients relapse after CAR-T cell therapy. Therefore, the efficacy of CAR-T cell therapy for lymphoma needs to be further improved. One of the major obstacles to CAR-T cell therapy is the limited expansion and persistence of CAR-T cells, which may hinder patients' long-term anti-tumor responses. A major cause of this is T cell exhaustion. T cell exhaustion is a state of decreased function characterized by the gradual loss of T cell effector function and self-renewal capacity. CAR-T cells are impaired by exhaustion, and interrupting this dysfunctional state can improve therapeutic efficacy. Numerous strategies have been developed to extend the lifespan of CAR-T cells by regulating CAR-T cell differentiation and inhibiting CAR-T cell senescence, thereby enhancing the anti-tumor effects of CAR-T cells. Interruption of the CAR-T cell exhaustion program can be achieved by abrogating the canonical TOX and NR4A transcription factors or by antibody-mediated blockade of co-inhibitory receptors such as PD-1. ShRNA-mediated knockdown results in a partial reduction in expression, rather than a complete absence, and therefore does not completely disrupt molecules in the exhaustion pathway within T cells, which could impair T cell adaptability. At the same time, the important role of epigenetics in regulating T cell function and activity has been demonstrated. Lysine-specific demethylase 1 (LSD1, also known as KDM1A, AOF2, and BHC110) is a histone lysine-specific demethylase that removes monomethylation or dimethylation of H3K4 or H3K9 in the presence of xanthine dinucleotide. LSD1 plays an important role in tumorigenesis and is a potential target for anti-tumor immunity. Inhibition of LSD1 can improve tumor immunogenicity and promote T cell infiltration, so inhibition of LSD1 combined with PD-1 / PD-L1 blockade is considered a new cancer treatment strategy. Summary of the Invention
[0007] In order to solve the above problems, the present invention provides a chimeric antigen receptor for treating acute myeloid leukemia, wherein the extracellular domain of the chimeric antigen receptor comprises a LSD1-targeting antigen recognition and binding domain and a CLL1-targeting antigen recognition and binding domain, wherein the LSD1-targeting antigen recognition and binding domain is a short hairpin RNA, and the nucleotide sequence of the short hairpin RNA is shown in SEQ ID NO.1; and the ScFv sequence encoding the CLL1 antigen recognition and binding domain comprises a heavy chain variable region 27H4-H and a light chain variable region 27H4-L, wherein the nucleotide sequence encoding the heavy chain variable region 27H4-H is shown in SEQ ID NO.2, and the nucleotide sequence encoding the light chain variable region 27H4-L is shown in SEQ ID NO.3.
[0008] In one embodiment, the promoter of the LSD1 antigen recognition and binding domain is the U6 promoter, and the nucleotide sequence encoding the U6 promoter is shown in SEQ ID NO.4; the promoter of the CLL1 antigen recognition and binding domain is the EF-1-α promoter, and the nucleotide sequence encoding the U6 promoter is shown in SEQ ID NO.5.
[0009] In one embodiment, the chimeric antigen receptor further comprises a CD8 hinge region, a transmembrane domain of the CD8 α chain, a 41BB co-stimulatory domain, and a CD3 ζ activation domain.
[0010] In one embodiment, the present invention provides a polynucleotide sequence comprising a nucleotide sequence encoding the chimeric antigen receptor for treating acute myeloid leukemia.
[0011] In one embodiment, the present invention provides a recombinant expression vector comprising the polynucleotide sequence described above; the recombinant expression vector is a retroviral vector.
[0012] In one embodiment, the present invention provides a T cell comprising the aforementioned chimeric antigen receptor and / or the aforementioned recombinant expression vector.
[0013] In one embodiment, the present invention provides a pharmaceutical composition comprising the aforementioned T cells and a pharmaceutically acceptable carrier.
[0014] In one embodiment, the present invention provides use of the chimeric antigen receptor described above in the preparation of a drug for treating acute myeloid leukemia.
[0015] In one embodiment, the present invention provides use of the above-mentioned T cells in the preparation of a drug for treating acute myeloid leukemia.
[0016] In one embodiment, the present invention provides a method for inhibiting acute myeloid leukemia tumor cells in vitro, comprising co-incubating the above-mentioned T cells or the above-mentioned pharmaceutical composition with the tumor cells.
[0017] The present invention provides a chimeric antigen receptor, a cell, a nucleotide sequence thereof, a recombinant expression vector, and a pharmaceutical composition for treating acute myeloid leukemia. The present invention provides, for the first time, a T cell that simultaneously comprises a recognition and binding domain targeting an LSD1 antigen and a recognition and binding domain targeting a CLL1 antigen. The effect of the T cell in treating acute myeloid leukemia is significantly better than that of other T cells designed in the present invention, and the efficacy of CAR-T cell therapy can also be improved from the perspective of reversing T cell exhaustion. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.
[0019] Figure 1 This is a schematic diagram of the three CAR plasmid structures designed by the present invention. Figure 1 A is a schematic diagram of the CLL1 CAR plasmid structure, Figure 1 B is a schematic diagram of the shU6-CLL1 CAR plasmid structure, and Figure 1 C is a schematic diagram of the shLSD1-CLL1CAR plasmid structure;
[0020] Figure 2 This is a diagram showing the results of BaEV cell transfection prepared by transient transfection of the present invention;
[0021] Figure 3 This is a flow cytometry result diagram of the transfection efficiency of the plasmid of the present invention into Ampho cells;
[0022] Figure 4 This is a graph showing the results of testing the transfection efficiency of a BaEV-WT retroviral vector stably transfected cell line constructed in the present invention;
[0023] Figure 5 This is a graph showing the purity and transduction positive rate of CLL1-CAR-T cells of the present invention;
[0024] Figure 6 This is a graph showing the purity and transduction positive rate of shU6-CLL1-CAR-T cells of the present invention;
[0025] Figure 7 This is a graph showing the purity and transduction positive rate of shLSD1-CLL1-CAR-T cells of the present invention;
[0026] Figure 8 This is a graph showing the killing results of the cells of the present invention co-cultured with HL60 at different ratios;
[0027] Figure 9 1 is a graph showing the cell phenotype results at different times after the cells of the present invention are co-incubated with HL60;
[0028] Figure 10 Graph showing the expression levels of IFN-γ and TNF-α after the cells of the present invention were co-incubated with HL60 cells;
[0029] Figure 11 This is a graph showing the expression level of Ki67 after the cells of the present invention were co-incubated with HL60 cells;
[0030] Figure 12 This is a graph showing the expression of PD-1 after the cells of the present invention are incubated with tumor cells. DETAILED DESCRIPTION
[0031] In order to enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below with reference to embodiments. Obviously, the embodiments described are only part of the embodiments of this application, not all of them. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without creative work should fall within the scope of protection of this application.
[0032] Example 1 MFG-plasmid design and construction
[0033] like Figure 1 As shown, the present invention relates to the design of three structures of plasmids, namely CLL1 CAR ( Figure 1 A), shU6-CLL1 CAR ( Figure 1 B) and shLSD1-CLL1 CAR ( Figure 1 C), The ScFv sequence in the structure is derived from the 27H4 clone and connects the CD8 transmembrane domain, the 41BB costimulatory domain, and the CD3ζ activation domain. Figure 1 RNAU6 in B is highly conserved and is used as a control sequence, which is an inactive sequence; Figure 1 The extracellular domain of the chimeric antigen receptor in C comprises a LSD1-targeting antigen recognition and binding domain and a CLL1-targeting antigen recognition and binding domain, wherein the LSD1-targeting antigen recognition and binding domain is a short hairpin RNA, and the nucleotide sequence of the short hairpin RNA is shown in SEQ ID NO.1; and the ScFv sequence targeting the CLL1 antigen recognition and binding domain comprises a heavy chain variable region 27H4-H and a light chain variable region 27H4-L, the nucleotide sequence encoding the heavy chain variable region 27H4-H is shown in SEQ ID NO.2, and the nucleotide sequence encoding the light chain variable region 27H4-L is shown in SEQ ID NO.3; the promoter of the LSD1 antigen recognition and binding domain is the U6 promoter, and the nucleotide sequence encoding the U6 promoter is shown in SEQ ID NO.4; the promoter of the CLL1 antigen recognition and binding domain is the EF-1-α promoter, and the nucleotide sequence encoding the EF-1-α promoter is shown in SEQ ID NO.5; the nucleotide sequence encoding the signal peptide LP sequence is shown in SEQ ID NO.6. The LSD1 shRNA-2 sequence was seamlessly cloned from a recombinant antibody fragment and a linearized vector. The product was transformed into DH5α E. coli, shaken, plated, and cultured overnight. Single colonies were picked for shaken, sequencing, and double enzyme digestion verification. Sequencing results confirmed the correct plasmid and target gene sequences. Figure 1 The relevant nucleotide sequences are as follows.
[0034] (1)LSD1-SHRNA2:
[0035] GGGCTCCAATACTGTTGGCACTACTCGAGTAGTGCCAACAGTATTGGAGCTTTTTG(SEQ IDNO.1);
[0036] (2)27H4-H:
[0037] GAAGTACAGCTGCAGCAGAGCGGACCTGAACTGGTGAAGCCTGGTGCTTCTGTGAAGATCAGCTGCAAG
[0038] GCCTCTGGCTACAGCTTCACAGGTTATCACATGCACTGGGTGAAGCAGAGCCACGTGAAGTCTCTGGAG
[0039] TGGATTGGACGGATCAATCCATATAACGGTGCAGCAAGCCACAACCAGAAGTTCAAAGACAAGGCTACC
[0040] TTGACAGTGGACAAGTCCAGCTCAACCGCCTACATGGAGCTGCACAGCCTTACCAGCGAGGACTCAGCT
[0041] GTCTACTATTGCGCTAGAGGTTGGGACTACGATGGCGGTTACTACGCTATGGATTACTGGGGTCAGGGTACAAGCGTCACAGTGAGCAGC(SEQ ID NO.2)
[0042] (3)27H4-L:
[0043] GACATCGTGATGTCTCAGTCTCCAAGCTCTCTGGCTGTGTCAGTAGGCGAGAAGGTCACAATGTCTTGC
[0044] AAGTCTAGCCAGTCTCTGCTCTACAGCGATAACCAGAAGAACTACCTCGCATGGTATCAGCAGAAGCCA
[0045] GGTCAGTCCCCTAAGCTGCTGATCTACTGGGCATCCACAAGGGAAAGCGGTGTGCCTGACAGATTCACA
[0046] GGCTCCGGTTCAGGCACCGATTTCACACTGACAATCAGCAGCGTCAAGGCCGAAGATTTGGCCGTCTACTACTGCCAGCAGTACTACACCTATCCATACACATTCGGAGGTGGAACCAAGCTGGAGATCAAG(SEQ ID NO.3)
[0047] (4) U6 promoter:
[0048] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGA
[0049] ATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGG
[0050] TAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGAC(SEQ ID NO.4)
[0051] (5) EF-1-α promoter:
[0052] GGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTC
[0053] GGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTC
[0054] CGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGC
[0055] AACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGT
[0056] TATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGG
[0057] GTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAG
[0058] GCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTC
[0059] GATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTT
[0060] GTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGT
[0061] GCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAG
[0062] TCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCA
[0063] AGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGC
[0064] TCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTT
[0065] CCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTC
[0066] TCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACT
[0067] GAGTGGGTGGAGACTGAAGTTAGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTT
[0068] GAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTG
[0069] TCGTGA (SEQ ID NO. 5)
[0070] (6) LP sequence:
[0071] ATGGAGTGGTCTTGGGTCTTTCTGTTCTTTCTGAGCGTGACCACTGGCGTT CACTCCGACATC (SEQ ID NO. 6).
[0072] Example 2 Preparation of CLL1, shU6-CLL1, and shLSD1-CLL1 Retroviral Vectors
[0073] 1. Retroviral Vector-Transient Transfection Preparation
[0074] CLL1, shU6-CLL1, and shLSD1-CLL1 retroviral vectors were prepared using the BaEV retroviral vector packaging cell line. A retroviral vector packaging cell line (BaEV-WT) was selected and the plasmids were transfected into BaEV-WT cells using Lipomaster 2000 transfection reagent, as shown in Figure 2 . Figure 2 As shown in Figure 2, the transfection efficiencies were 49.9%, 36.3%, and 57.3% by flow cytometry. The supernatants were collected 48h, 72h, and 96h after transfection to obtain the final CLL1, shU6-CLL1, and shLSD1-CLL1 retroviral vectors.
[0075] 2. Retroviral Vector-Stable Transfection Preparation
[0076] CLL1, shU6-CLL1, and shLSD1-CLL1 retroviral vectors were prepared using the BaEV retroviral vector packaging cell line. Retroviral vector packaging cell lines (Ampho and BaEV-WT) were selected and the plasmids were transfected into Ampho cells using Lipomaster 2000 transfection reagent, as shown in Figure 2. Figure 3As shown in Figure 2, the transfection efficiency of flow cytometry was 68.1%, 64.3%, and 70.2%, respectively. The supernatants were collected 48h and 72h after transfection and transduced into BaEV-WT cells by horizontal centrifugation to construct a BaEV-WT retroviral vector stably transfected cell line. Figure 4 As shown, the positive rates of CLL1, shU6-CLL1, and shLSD1-CLL1 stably transfected cell lines by flow cytometry were 89%, 76.3%, and 39.5%, respectively. The culture supernatant of the cell lines stably transfected with the BaEV-WT retroviral vector was collected to obtain the final CLL1, shU6-CLL1, and shLSD1-CLL1 retroviral vectors.
[0077] 3. Retroviral vector titer detection
[0078] The viral vector biotiter in the supernatant of 293T cells was detected by transduction. The detection antibody was G4S-APC. The final titer result was selected when the 293T infection positive rate was 10%-20%.
[0079] Example 3 CAR-T cell preparation
[0080] 1. Preparation Method
[0081] T cells were isolated from human peripheral blood mononuclear cells (PBMCs) and activated, then transduced with BaEV-CLL1, BaEV-shU6-CLL1, or BaEV-shLSD1-CLL1 retroviral vectors to generate CLL1-CAR-T, shU6-CLL1-CAR-T, and shLSD1-CLL1-CAR-T cells. In brief, T cells were activated from PBMCs using an antibody-based activation method, and the activated T cells were transduced. This protocol used flow cytometry to determine the purity and transduction-positive rate of transduced T cells, and trypan blue staining to determine cell viability and cell number.
[0082] 2. Preparation Results
[0083] On the second day after transduction, the cell viability was 80%-90%. The flow cytometry antibody APC-G4S was used to detect the CAR-T transduction positive rate. The CD3+ percentage of CLL1-CAR-T cells was 96.5%, and the CAR positive rate reached 90.4%, as shown in the following figure. Figure 5 As shown in Figure 2, the CD3+ percentage of shU6-CLL1-CAR-T cells was 96.2%, and the CAR positive rate reached 75.5%. Figure 6 As shown in Figure 2, the CD3+ percentage of shLSD1-CLL1-CAR-T cells was 92.9%, and the CAR positive rate reached 28.9%. Figure 7 shown.
[0084] Example 4 In vitro functional verification (HL60)
[0085] 1. Flow cytometry detection of CAR-T cell killing activity in vitro
[0086] Effector T cells, CLL1-CAR-T, shU6-CLL1-CAR-T, and shLSD1-CLL1-CAR-T were co-cultured with target HL60 cells at ratios of 2:1, 1:1, 1:2, 1:4, 1:8, and 1:16, respectively. After 24 hours, all cells were harvested, target cells were stained with Annexin V / PI, and the level of target cell apoptosis was counted by flow cytometry to reflect the killing activity of CAR-T. The results are shown in Table 1 and Figure 8 It was shown that compared with T, CLL1-CAR-T and shU6-CLL1-CAR-T cells, shLSD1-CLL1-CAR-T had stronger killing activity against HL60 cells.
[0087] Table 1
[0088]
[0089] 2. Flow cytometry detection of CAR-T cell phenotype
[0090] Effector T cells, CLL1-CAR-T, shU6-CLL1-CAR-T, shLSD1-CLL1-CAR-T
[0091] The cells were co-cultured with target HL60 cells at a ratio of 1:1. At 48h, 96h, and 144h, the cells were harvested and stained with antibodies CD45RO-PE and CD62L-FITC for 30min. The central memory T cells (TCM) (CD45RO + CD62L + ) cell population to analyze the changes in CAR-T cell phenotype. Figure 9Table 2 shows that compared with T cells, CLL1-CAR-T cells, and shU6-CLL1-CAR-T cells, shLSD1-CLL1-CAR-T cells have a higher proportion of TCM cells after co-incubation with HL60. Central memory T cells (TCM) play an important role in CAR-T cell therapy. In CAR-T cell therapy, the role of TCM is mainly reflected in its ability to provide long-term immune memory and specific response. CAR-T cell therapy uses gene modification technology to enable T cells to recognize and attack tumor cells. In this process, the long-term memory of TCM enables it to respond quickly and effectively when encountering the same antigen again, thereby enhancing the anti-tumor effect of CAR-T cells. In addition, the high proportion of TCM also means that the therapeutic effect can be achieved with a very small infusion dose, showing good safety, which is crucial to the success of CAR-T cell therapy.
[0092] Table 2
[0093]
[0094] 3. Cytokine secretion level detection
[0095] Target HL60 cells were seeded in a 96-well plate and co-incubated with effector T cells, CLL1-CAR-T, shU6-CLL1-CAR-T, and shLSD1-CLL1-CAR-T at an E:T ratio of 1:1 for 24 hours. The culture supernatant was harvested and the cytokine detection of subsequent standards and samples was performed using a flow cytometer according to the CBA kit instructions. The results are shown in Figure 2. Figure 10 It was shown that compared with T, CLL1-CAR-T and shU6-CLL1-CAR-T cells, the expression levels of IFN-γ and TNF-α were significantly increased after shLSD1-CLL1-CAR-T was co-incubated with HL60 cells.
[0096] 4. Proliferation Assay
[0097] Target HL60 cells were seeded into a 12-well plate and co-incubated with effector T cells, CLL1-CAR-T, shU6-CLL1-CAR-T, and shLSD1-CLL1-CAR-T at an E:T ratio of 1:1. At 0h, 48h, and 96h, some cells were harvested, fixed with 70% anhydrous ethanol for 1-2h, then stained with Ki67-APC antibody for 30min, and detected by flow cytometry; KI67 is a cell proliferation marker, and its expression level by flow cytometry can reflect the proliferation rate and activity of cells. The results are shown in Figure 2. Figure 11As shown in Table 3 , after shLSD1-CLL1-CAR-T cells were co-incubated with HL60, the expression level of Ki67 gradually increased, and its growth trend was stronger than that of T, CLL1-CAR-T, and shU6-CLL1-CAR-T cells.
[0098] Table 3
[0099]
[0100] 5. Detection of CAR-T cell exhaustion markers
[0101] Target HL60 cells were seeded in a 12-well plate and co-incubated with effector T cells, CLL1-CAR-T, shU6-CLL1-CAR-T, and shLSD1-CLL1-CAR-T at an E:T ratio of 1:1. After 48 hours, a portion of the cells was taken for flow cytometry. To the remaining cells, an equal amount of HL60 cells as that of live cells was added for stimulation, and a total of three rounds of stimulation were performed. The results are shown in Figure 2. Figure 12 As shown in Table 4, after three rounds of tumor cell stimulation, the expression level of PD-1, an exhaustion marker of shLSD1-CLL1-CAR-T cells, was significantly reduced, indicating that the exhaustion level of CAR-T cells was significantly reduced after expressing shLSD1.
[0102] Table 4
[0103]
[0104] It should be understood that the present invention disclosed is not limited only to the specific method, scheme and material of description, because these all can change.It should also be understood that the term used herein is only for the purpose of describing specific embodiment scheme, rather than being intended to limit the scope of the present invention, and the scope of the present invention is only limited to the appended claims.
Claims
1. A chimeric antigen receptor for treating acute myeloid leukemia, characterized in that The extracellular domain of the chimeric antigen receptor comprises a LSD1-targeting antigen recognition and binding domain and a CLL1-targeting antigen recognition and binding domain, wherein the LSD1-targeting antigen recognition and binding domain is a short hairpin RNA, and the nucleotide sequence of the short hairpin RNA is shown in SEQ ID NO.1; and the ScFv sequence of the CLL1-targeting antigen recognition and binding domain comprises a heavy chain variable region 27H4-H and a light chain variable region 27H4-L, the nucleotide sequence encoding the heavy chain variable region 27H4-H is shown in SEQ ID NO.2, and the nucleotide sequence encoding the light chain variable region 27H4-L is shown in SEQ ID NO.
3.
2. The chimeric antigen receptor according to claim 1, wherein The promoter of the LSD1 antigen recognition and binding domain is the U6 promoter, and the nucleotide sequence encoding the U6 promoter is shown in SEQ ID NO.4; the promoter of the CLL1 antigen recognition and binding domain is the EF-1-α promoter, and the nucleotide sequence encoding the U6 promoter is shown in SEQ ID NO.
5.
3. The chimeric antigen receptor according to claim 1, wherein The chimeric antigen receptor also includes a CD8 hinge region, a transmembrane domain of the CD8 α chain, a 41BB costimulatory domain, and a CD3 ζ activation domain.
4. A polynucleotide sequence, characterized in that The invention comprises a nucleotide sequence encoding the chimeric antigen receptor for treating acute myeloid leukemia according to any one of claims 1 to 3.
5. A recombinant expression vector, characterized in that: The recombinant expression vector contains the polynucleotide sequence according to claim 4; the recombinant expression vector is a retroviral vector.
6. A T cell, characterized in that Comprising the chimeric antigen receptor according to any one of claims 1 to 3 and / or the recombinant expression vector according to claim 5.
7. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the T cell according to claim 6 and a pharmaceutically acceptable carrier.
8. Use of the chimeric antigen receptor according to any one of claims 1 to 3 in the preparation of a drug for treating acute myeloid leukemia.
9. Use of the T cell according to claim 6 in preparing a drug for treating acute myeloid leukemia.
10. A method for inhibiting acute myeloid leukemia tumor cells in vitro, comprising co-incubating the T cells according to claim 6 or the pharmaceutical composition according to claim 7 with the tumor cells.
Citation Information
Patent Citations
Anti-CLL1 antibody and application thereof
CN113045658A
Targeting CLL1 chimeric antigen receptor and application thereof
CN113234169A
Retroviral vector for expressing CAR and shRNA and application thereof
CN113462723A
CLL1-CAR-T cell as well as preparation method and application thereof
CN116515765A
Inhibitory chimeric antigen receptor and application thereof
CN117603363A