Efficient single-base editing tool for streptomyces as well as construction method and application of efficient single-base editing tool
Through the TnpB-mediated mini single-base editing system STAGE-CBEST, the problem of efficient and precise single-base editing in Streptomyces was solved, and efficient cytosine to thymine conversion without DNA double-strand breaks was achieved, which is suitable for Streptomyces genetic modification and metabolic engineering.
Patent Information
- Application Number
- CN202411951306.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-27
- Publication Date
- 2025-09-23
AI Technical Summary
Existing technologies make it difficult to achieve efficient, precise, and DNA double-strand break-free single-base editing in Streptomyces, and traditional methods damage genome stability, resulting in low editing efficiency and host survival risks.
The TnpB-mediated mini single-base editing system STAGE-CBEST is used, which contains a guide TnpB single-base editor, codon-optimized rat cytosine deaminase and uracil glycosylase inhibitor, to achieve efficient conversion of cytosine to thymine in Streptomyces through a recombinant expression plasmid vector.
Efficient and precise single-base editing of cytosine to thymine was achieved in Streptomyces without DNA double-strand breaks, with an editing efficiency of 39%-97%, reducing the impact on genome stability and making it suitable for genetic modification and metabolic engineering of Streptomyces.
Smart Images

Figure CN120683100A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering technology and relates to an efficient single-base editing tool for Streptomyces, a construction method thereof, and an application thereof; in particular, it relates to an efficient mini-cytosine single-base editing tool, a construction method thereof, and an application thereof in Streptomyces. Background Art
[0002] Streptomyces is the largest genus of actinomycetes. It is considered to be a group with great development value because it can produce a large number of valuable active secondary metabolites and its genome also contains rich silent biosynthetic gene clusters. Starting from genomic information, the "bottom-up" efficient and high-throughput development of new active secondary metabolites based on the concept of synthetic biology is the current mainstream idea of natural product drug research and development. Natural product mining, basic research and metabolic engineering of Streptomyces are very dependent on efficient, accurate and convenient genetic manipulation systems. However, due to its large genome (8-10Mb) and high GC content (generally GC content exceeds 70%), Streptomyces is very difficult to perform genetic manipulations such as gene editing compared to other microorganisms, and the means of genetic manipulation are very limited.
[0003] With the development of CRISPR-Cas gene editing system and its application in Streptomyces, the problem of time-consuming and inefficient gene editing of Streptomyces has been alleviated to a great extent. However, these current technologies all rely on the gaps produced by DNA double-strand breaks and the DNA repair system of the bacteria itself to introduce gene mutations. The mutation result can be random (through non-homologous end repair pathway, non-homologous end joining (NHEJ)), or accurate editing (through homologous recombination, homology-directed repair (HDR)) can be achieved according to the DNA repair template provided. However, due to the large damage caused to Streptomyces by the generation of DNA double-strand breaks, and the low DNA repair efficiency of the host itself, if DNA repair cannot be carried out in a timely and proper manner, the stability of the host's genome will be greatly affected, and even death will occur.
[0004] In 2016, scientist David Liu developed a single-base editing system by modifying the CRISPR-Cas9 system. This system successfully replaced cytosine with thymine (C·G to T·A) in target genes, achieving a gene editing method that does not rely on double-strand breaks in DNA. However, the large size of the CRISPR-Cas system has limited its widespread application in terms of delivery into organisms, plasmid construction, and further modification. Furthermore, different Cas proteins require different PAM sequences to function, which limits their targeting range. Furthermore, current single-base editing systems also suffer from off-target effects. To overcome these application limitations, researchers have conducted research and exploration in various directions, such as optimizing and modifying the Cas9 protein, optimizing guide RNAs, developing novel CRISPR systems, and discovering and developing compact CRISPR-Cas proteins. TnpB, a programmable, compact nuclease recently discovered in transposon systems, is considered the evolutionary ancestor of Cas12. The recognition sequence (TAM) of TnpB is 5'-TTGAT, and it can be guided by a 150-nt long non-coding RNA to cut the target gene carrying the corresponding TAM sequence. TnpB is called a compact or mini nuclease because its size is only 1 / 3 of the Cas9 protein (about 400 amino acids), and it has therefore received widespread attention from researchers at home and abroad. So far, Tn pB nuclease has been successfully used in human cells, mouse embryos, monocotyledonous and dicotyledonous plants and other species for gene editing. But in general, there are no reports of TnpB performing gene editing in Streptomyces. More importantly, there is no single-base editing system based on the modification and development of TnpB. Summary of the Invention
[0005] To address the challenges of the existing technology, the present invention provides an efficient and compact single-base editing tool for Streptomyces, as well as its construction method and application. This tool, named STAGE-CBEST (Streptomyces-compatible TnpB-assisted Genome Editing Toolkit-Cytosine Base Editing SysTem), (abbreviated as STAGE-CBEST), enables precise and efficient single-base editing from C·G to T·A, independent of DNA double-strand breaks.
[0006] The object of the present invention is achieved through the following technical solutions:
[0007] In the first aspect, the present invention provides a Streptomyces TnpB-mediated mini single-base editing system, named Streptomyces-compatible TnpB-Assisted Genome Editing-Cytosine Base Editing SysTem (abbreviated as STAGE-CBEST); the system mainly comprises the following elements:
[0008] a. reRNA that guides the TnpB single-base editor;
[0009] b. A fusion protein consisting of rAPOBEC1 rat cytosine deaminase, a dTnpB nuclease variant, and a codon-optimized UGI uracil glycosylase inhibitor, each of which has been codon-optimized for expression in Streptomyces, is responsible for achieving a single-base substitution from cytosine (C) to thymine (T).
[0010] As an embodiment, the reRNA guide cassette includes the following core elements in the 5'-3' direction:
[0011] 1. The reRNA backbone interacting with TnpB.
[0012] 2. A specific base sequence (15-25 nt) that can target the target DNA sequence (spacer sequence). The base sequence (spacer sequence) of the target DNA fragment must be selected so that the 5' end of the spacer sequence contains a TAM sequence (5'-TTGAT) recognized by TnpB.
[0013] 3. The hepatitis D virus (HDV) ribozyme sequence (which has self-cleavage activity, helping to form a complete and active reRNA unit in the bacteria, thereby successfully interacting with TnpB) guides TnpB to precisely target the target sequence.
[0014] As an embodiment, the reRNA backbone can be selected from one of the following to achieve single base editing:
[0015] a. reRNA-ZH, the nucleotide sequence of which is shown in SEQ ID NO. 1;
[0016] b. reRNA-ZJ, the nucleotide sequence of its backbone is shown in SEQ ID NO.2.
[0017] As an embodiment, the nucleotide sequence and amino acid sequence of the wild-type TnpB protein are shown as SEQ ID NO. 3 and SEQ ID NO. 4, respectively.
[0018] As one embodiment, the dTnpB nuclease variant is obtained by point mutation of one or more key active sites of wild-type TnpB. This TnpB nuclease variant is called dTnpB (catalytically "dead" TnpB), indicating that after the mutation, the variant loses its double-stranded DNA cleavage activity but can still interact with reRNA and bind to the targeted gene target under the guidance of reRNA to form a complex.
[0019] As an embodiment, the obtained dTnpB variant is at least one of the following, and the wild-type TnpB nucleotide sequence is shown in SEQ ID NO.3:
[0020] a.dTnpB-D191A, compared with wild-type TnpB, amino acid residue D at position 191 is replaced by A;
[0021] b.dTnpB-E278A, compared with wild-type TnpB, amino acid residue D at position 278 is replaced by A;
[0022] c. dTnpB-D361A, compared with wild-type TnpB, amino acid residue D at position 361 is replaced by A;
[0023] d.dTnpB-D191A-E278A, referred to as dTnpB-DE, compared to wild-type TnpB, the amino acid residues D at positions 191 and 278 were replaced by A;
[0024] e. dTnpB-D191A-D361A, referred to as dTnpB-DD, compared to wild-type TnpB, amino acid residues D at positions 191 and 361 were replaced by A;
[0025] f. dTnpB-E278A-D361A, referred to as dTnpB-ED, compared to wild-type TnpB, the amino acid residues D at positions 278 and 361 were replaced by A;
[0026] g.dTnpB-D191A-E278A-D361A, abbreviated as dTnpB-DED, compared with wild-type TnpB, the amino acid residues D at positions 191 and 278 are both replaced by A.
[0027] As an embodiment, the nucleotide sequence of the codon-optimized rAPOBEC1 rat cytosine deaminase that can be expressed in Streptomyces is shown as SEQ ID NO.5.
[0028] As an embodiment, the nucleotide sequence of the codon-optimized UGI uracil glycosylase inhibitor is shown as SEQ ID NO.6.
[0029] In a second aspect, the present invention provides a recombinant expression plasmid vector, which can encode or express the Streptomyces mini TnpB cytosine single-base editing system.
[0030] In a third aspect, the present invention provides a host cell containing the Streptomyces mini-TnpB cytosine single-base editing system.
[0031] In a fourth aspect, the present invention provides a method for constructing a Streptomyces mini-TnpB cytosine single-base editing system, comprising the following steps:
[0032] ① Construction of a TnpB-mediated gene knockout / knock-in plasmid containing an apramycin resistance selection marker; the gene knockout / knock-in plasmid is based on the Escherichia coli-Streptomyces shuttle plasmid, and the codon-optimized TnpB protein and its guide RNA expression cassette (reRNA-ZH or reRNA-Z) are inserted into the gene editing system plasmid (pTnpB-reRNA-ZH or pTnpB-reRNA-ZJ).
[0033] ② Based on the gene editing system plasmid, point mutations were performed on the key active sites (D191, E278, D361) of the TnpB nuclease to construct (7) dTnpB variants lacking nuclease activity.
[0034] As one embodiment, the dTnpB variant is at least one of the following:
[0035] a. dTnpB-D191A, compared to wild-type TnpB (SEQ ID NO. 3), amino acid residue D at position 191 is replaced by A;
[0036] b. dTnpB-E278A, compared to wild-type TnpB (SEQ ID NO. 3), amino acid residue D at position 278 is replaced by A;
[0037] c. dTnpB-D361A, compared to wild-type TnpB (SEQ ID NO. 3), amino acid residue D at position 361 is replaced by A;
[0038] d. dTnpB-D191A-E278A, referred to as dTnpB-DE, compared to wild-type TnpB (SEQ ID NO. 3), amino acid residues D at positions 191 and 278 are replaced by A;
[0039] e. dTnpB-D191A-D361A, abbreviated as dTnpB-DD, compared to wild-type TnpB (SEQ ID NO. 3), amino acid residues D at positions 191 and 361 are replaced by A;
[0040] f. dTnpB-E278A-D361A, abbreviated as dTnpB-ED, compared to wild-type TnpB (SEQ ID NO. 3), amino acid residues D at positions 278 and 361 are replaced by A;
[0041] g. dTnpB-D191A-E278A-D361A, abbreviated as dTnpB-DED, compared with wild-type TnpB (SEQ ID NO. 3), the amino acid residues D at positions 191 and 278 are both replaced by A.
[0042] The above dTnpB variant proteins do not have the ability to cut double-stranded DNA, but can still interact with reRNA and bind to the targeted gene site under the guidance of reRNA, forming a dTnpB-reRNA-DNA complex.
[0043] ③ Based on the dTnpB system plasmid obtained in the above steps, the codon-optimized rAPOBEC1 and UGI were connected to the N and C termini of dTnpB using (16-amino acid and 4-amino acid long connecting peptides), respectively, to obtain a series of cytosine single-base editing system plasmids.
[0044] The examples provided by the present invention demonstrate the construction of 7 different dTnpB proteins and the fusion proteases (rAPOBEC1-dTnpB-UGI) constructed based on them for single-base editing, and provide relevant proof of their individual single-base editing activity and efficiency. Therefore, the embodiment of the present invention includes dTnpB formed by single mutations, multiple mutations or protein truncation of other TnpB protein amino acid sites to construct a fusion protease (rAPOBEC1-dTnpB-UGI) for gene single-base editing.
[0045] In a fifth aspect, the present invention provides a method for gene editing a target gene in a recipient bacterium, Streptomyces, using the Streptomyces mini base editing system. The method comprises:
[0046] ① Selecting a target gene. In some embodiments, the target site is selected by including a TAM sequence (5'-TTGAT) recognized by TnpB at the 5' end of the base sequence (spacer) of the target DNA fragment, and the length of the spacer fragment is 16-25 nt.
[0047] ② Under non-induction conditions, the DNA single-base editing plasmid constructed using the above method is transformed into the target host. The rAPOBEC1 in the system converts cytosine (C) in the target gene to uracil (U), and then U is converted to thymine (T) during DNA replication, ultimately achieving a single-base conversion from C to T. Through antibiotic screening for plasmid-related resistance, transformants carrying the DNA single-base editing plasmid are obtained.
[0048] ③ The transformants from step ① were streaked onto a culture medium plate containing plasmid resistance antibiotics and promoter inducers, and cultured at 30 degrees Celsius until single colonies were visible.
[0049] ④ Randomly select the single clone from step ②, then perform colony PCR, and finally verify the effect and efficiency of cytosine single-base editing through Sanger sequencing results.
[0050] Compared with the prior art, the present invention has the following beneficial effects:
[0051] (1) The present invention obtains for the first time a compact single-base editor based on TnpB suitable for use in Streptomyces, and provides a construction method of the single-base editor of the present invention and its application.
[0052] (2) The core of the single-base editing tool of the present invention is a fusion protein (rAPOBEC1-dTnpB-UGI) composed of rat cytosine deaminase (rAPOBEC1), catalytically "dead" TnpB protein without nucleic acid cleavage activity (dTnpB), and uracil glycosylase inhibitor (UG I). It achieves efficient and precise single-base editing of genes in Streptomyces without introducing double-strand breaks (DSBs) in DNA, converting cytosine (C) to thymine (T).
[0053] (3) Various fusion proteins containing different dTnpB variants were obtained by the method of the present invention. Experiments have shown that they all have single base editing activity with a success rate of 100%, but the efficiency of base substitution from C·G to T·A in the target gene sequence varies (39%-97% editing efficiency, Figure 7 ).
[0054] (4) The single-base editing of the present invention is smaller in size and has diverse activities. Compared with gene editing technologies that rely on DSB to introduce random mutations, the present invention can achieve gene editing with single-base accuracy to achieve gene mutations, or mutate codons encoding specific amino acids into stop codons to achieve the purpose of inactivating target genes. Due to the GC content and linearization characteristics of the Streptomyces genome, traditional double-exchange-based and DSB-based gene editing tools, such as Cas9, are not effective in editing the Streptomyces genome and have large side effects. The gene editing tool of the present invention is not only highly accurate but also does not rely on DSB. Therefore, it has unique application value in the genetic modification, strain modification and metabolic engineering of Streptomyces and has great promotion and application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0055] Other features, objects and advantages of the present invention will become more apparent upon reading the detailed description of non-limiting embodiments with reference to the following drawings:
[0056] Figure 1 Plasmid map of the TnpB-mediated Streptomyces mini single-base editing system (STAGE-CBEST) constructed in the present invention; pdTnpB-ZH-D191A-cBEST and pdTnpB-ZJ-D191A-cBEST are used as examples.
[0057] Figure 2 Schematic diagram of the main components of the TnpB-mediated Streptomyces mini single-base editing system (STAGE-CBEST) of the present invention; taking pdTnpB-ZH-D191A-CBEST and pdTnpB-ZJ-D191A-CBEST as examples.
[0058] Figure 3 This is the PCR validation result of the TnpB-mediated Streptomyces mini single-base editing system (STAGE-CBEST) of the present invention in the Streptomyces host; since the substitution of a single base does not significantly affect the overall molecular weight, it will not show any difference from the wild-type band on the gel electrophoresis gel map. Since the bands of each sample in each group are consistent and cannot provide any directional information, Sanger sequencing is required for further analysis of the results. The figure shows the result graph using pdTnpB-ZH-D191A-CBEST as an example.
[0059] Figure 4This figure shows an alignment of Sanger sequencing results for the Streptomyces mini-base editing system (STAGE-CBEST) constructed in this invention, consisting of various protein combinations (rAPOBEC1-dTnpB-UGI). The results show that the system constructed in this invention successfully converts C to T at the target gene in the Streptomyces host.
[0060] Figure 5 It is the amino acid mutation result after single-base editing of the target gene.
[0061] Figure 6 Results and data generated using Beat online software (https: / / hanlab.cc / beat / ) to analyze Sanger sequencing peaks. Results are shown using pdTnpB-ZH-D191A-cBEST as an example.
[0062] Figure 7 These are the C·G to T·A editing efficiency results of the single-base editors composed of 7 dTnpB variants.
[0063] Figure 8 The C·G to T·A editing efficiency results for the pdTnpB-ZH-D191A-cBEST and pdTnpB-ZJ-D191A-cBEST systems. DETAILED DESCRIPTION
[0064] The present invention will be described in detail below with reference to the examples. The following examples will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that those skilled in the art may make several adjustments and improvements without departing from the scope of the present invention. These all fall within the scope of protection of the present invention.
[0065] The various culture media involved in each implementation are as follows:
[0066] LB medium: Dissolve 10 g of tryptone, 5 g of yeast extract, and 10 g of sodium chloride in 1 L of ddH2O. Sterilize at 115°C for 30 minutes and store at room temperature until ready to use. If preparing solid medium, add 2% agar powder.
[0067] MS medium: Weigh 10 g of soybean cake powder, 10 g of tryptone, and 10 g of agar powder, dissolve in 500 mL of tap water, and sterilize at 115°C for 30 min.
[0068] ISP2 medium: Weigh 10 g malt extract, 4 g yeast extract, and 4 g glucose, dissolve in 1 L ddH2O, adjust the pH to 7.4, sterilize at 115°C for 30 min, and store at 4°C until used. If preparing solid medium, add 2% agar powder.
[0069] 2×YT medium: Weigh 16 g tryptone, 10 g malt extract, and 5 g sodium chloride, dissolve in 1 L ddH2O, adjust the pH to 7.0, sterilize at 115°C for 30 min, and store at 4°C until use.
[0070] Example 1: Construction of an Efficient Mini-Gene Single-Base Editing Tool in Streptomyces
[0071] 1.1 Plasmid design and construction
[0072] The nucleotide sequence and amino acid sequence of the codon-optimized wild-type TnpB used in this example are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. The reRNA guide cassette that guides the wild-type TnpB nuclease to perform double-stranded cleavage near the endogenous target site of Streptomyces includes the following core elements in order from the 5' to 3' end: a reRNA backbone sequence that guides the TnpB protein, which can be selected from one of reRNA-ZH (SEQ ID NO.1) or reRNA-ZJ (SEQ ID NO.2), a base sequence of the target DNA fragment (spacer), and a hepatitis delta virus (HDV) ribozyme (SEQ ID NO.7). The base sequence (spacer) of the target DNA fragment must be selected so that the 5' end of the spacer sequence contains the TAM sequence (5'-TTGAT) recognized by TnpB, and the length of the spacer fragment is 16-25 nt.
[0073] The host used in the present invention is the model strain of Streptomyces coelicolor A3 (2) (genome sequence number: GeneBank: GCA_008931305.1). The target used in this example is a key gene actIorf1 (SCO5087) in the gene cluster of the strain that produces actinomycetoma rhodamine compounds, and the nucleotide sequence is shown in SE Q ID NO.8. The above fragments were synthesized by GenScript Biotech Co., Ltd.; and replaced the Cas9 and sgRNA fragments on the Streptomyces-Escherichia coli shuttle plasmid vector pCRISPR-Cas9 (Addgene: 125686) to obtain plasmids pTnpB-reRNA-ZH and pTnpB-reRNA-ZJ.
[0074] The TnpB nuclease used in the gene single-base editor technology of the present invention is a modified TnpB nuclease without DNA double-strand break activity (catalytically "dead" TnpB, abbreviated as dTnpB). The dTnpB is obtained by performing site-directed mutations on three key amino acid sites in the active center of the reported nuclease RuvC domain, namely D191, E278, and D361, and mutating them into alanine (Alanine, A) (as shown in Table 1). Seven different dTnpB variants were produced and used in the present invention (as shown in Table 2). The construction method of dTnpB is to use pTnpB-reRNA-ZH or pTnpB-reRNA-ZJ as a template, introduce mutations by reverse PCR (as shown in Table 3 and Table 4), and realize site-directed mutation of TnpB. The primers are shown in Table 5; the reverse PCR product is then purified (the kit was purchased from: Nanjing Novozymes Biotech Co., Ltd.; Gel DNA Extraction Mini Kit, DC301); the purified PCR product was then transformed into competent E. coli DH5α cells, where its inherent DNA recombination and repair system was utilized to achieve in vivo circularization of the linear DNA, thereby generating three dTnpB plasmid systems carrying single-site mutations. Using these plasmids containing single-site mutations as templates, the same methods and procedures as described above were used to generate dTnpB system plasmids containing two and three site mutations, completing the construction of all dTnpB systems shown in Table 2.
[0075] Based on the dTnpB system plasmid obtained above, codon-optimized rAPOBEC1 (SEQ ID NO.5) and UGI (SEQ ID NO.6) were connected to the N and C termini of dTnpB using 16 amino acids (SEQ ID NO.9) and 4 amino acids (SEQ ID NO.10) connecting peptides, respectively, to obtain a cytosine single-base editing system plasmid. The above rAPOBEC1, UGI, and two connecting peptides were obtained by PCR amplification from the pCRISPR-cBEST (Addgene, 125689) plasmid. The above fragments were connected to the dTnpB protein in Table 2 to obtain the rAPOBEC1-dTnpB-UGI fusion protein. The system and procedure of PCR amplification are basically the same as those shown in Tables 3 and 4, and the primers are shown in Tables 5 and 6.
[0076] When designing and assembling the rAPOBEC1-dTnpB-UGI fusion protein, the start codon of dTnpB (the first three nucleotide sequences in SEQ ID NO.1: ATG) and the stop codon (the last three nucleotide sequences in SEQ ID NO.1: TGA) were removed. Finally, through seamless cloning assembly (the kit was purchased from Vazyme, ClonExpress Ultra One Step Cloning Kit), seven plasmids for the single-base editing system were obtained, as shown in Table 2. Taking pdTnpB-D191A-cBE ST as an example, the nucleotide sequence and amino acid sequence of its fusion protein (rAPOBEC1-dTnpB-D191A-UGI) are shown in SEQ ID NO.11 and SEQ ID NO.12, respectively.
[0077] Preliminary studies of the present invention have shown that both reRNA skeletons, reRNA-ZH (SEQ ID NO.1) or reRNA-ZJ (SEQ ID NO.2), have the ability to guide TnpB to accurately identify target gene sequences. The reRNA skeleton used in the present invention to verify the single-base editor composed of the above-mentioned 7 different dTnpB variants is mainly reRNA-ZH. At the same time, in order to verify the adaptability of the reRNA-ZJ skeleton to the single-base editor of the present invention, pdTnpB-ZJ-D191A-cBEST was constructed (the construction method is similar to that described above), and then compared with the relative pdTnpB-ZH-D191A-cBEST. The plasmid spectrum is shown in Figure 2. Figure 1 and Figure 2 The present invention performed Sanger sequencing on the constructed plasmids to ensure that they were completely correct.
[0078] Table 1 TnpB nuclease mutation site sequence
[0079] mutation site codon mutation site codon mutation site codon D191A gac→gcc E278A gag→gcc D361A gac→gcc
[0080] Table 2 dTnpB composed of different mutation sites and the corresponding single base editor system plasmids
[0081]
[0082] *Systems using reRNA-ZH and reRNA-ZH are distinguished by pdTnpB-ZH-D191A-cBEST and pdTnpB-ZJ-cBE ST.
[0083] Table 3 Reverse PCR reaction system
[0084] system 25 μL <![CDATA[ddH2O]]> 9.5 μL Forward primer (10 μM) 1.0μL Reverse primer (10 μM) 1.0μL 2×MegaPfu Premix with dye 12.5μL DNA template* (5ng / μL pTnpB-reRNA-ZH or pTnpB-reRNA-ZJ) 1.0 μL
[0085] *Using the obtained single-site mutant system plasmid as a template, inverse PCR was performed again to mutate other sites in the TnpB protein, and finally a multi-site mutant dTnpB was obtained.
[0086] Table 4 Reverse PCR reaction program
[0087]
[0088]
[0089] Table 5 Reverse PCR primers and annealing temperature
[0090]
[0091] Table 6 Primers used for PCR fragment amplification and annealing temperature
[0092]
[0093]
[0094] Example 2: Application of the Streptomyces Efficient Ultra-mini Single-base Editing System
[0095] 2.1 Conversion
[0096] The target plasmid was transformed into E. coli ET12567 / pUZ8002 (https: / / doi.org / 10.1016 / 0378-1119(92)90549-5) as follows: 200 ng of plasmid pdTnpB-ZH-D191A-cBEST was added to 100 μL of thawed homemade competent cells E. coli ET12567 / pUZ8002, gently tap the tube wall to mix; after standing on ice for 30 minutes, in a 42°C water bath for 45 seconds, and then immediately place on ice for 2-3 minutes; then add antibiotic-free LB liquid medium, 200rpm, 37°C for 1 hour; then centrifuge at 5000rpm for 5 minutes, discard 900μL supernatant; resuspend the bacteria in the remaining medium, add to the LB solid plate containing 25μg / mL kanamycin, 12.5μg / mL chloramphenicol and 50μg / mL apramycin and gently spread it with a sterile coating stick; after overnight incubation at 37°C, pick a single colony and transfer it to 20mL LB liquid medium containing 25μg / mL kanamycin, 12.5μg / mL chloramphenicol and 50μg / mL apramycin and culture it in a 37°C shaker (200rpm) for OD 600 When the p-value is about 0.4, collect the bacteria by centrifugation at 5000 rpm for 5 minutes; add 20 mL of antibiotic-free LB liquid medium, centrifuge at 5000 rpm for 5 minutes, discard the supernatant, repeat this step twice; finally, resuspend the bacteria in 2 mL of LB liquid medium.
[0097] 2.2 Binding transfer and resistance screening
[0098] Under non-inducing conditions, the plasmid in step 2.1 was transferred into Streptomyces coelicolor A3(2) by conjugation. The specific method was as follows: the previously collected Streptomyces spores were centrifuged at 5000 rpm for 5 minutes, the supernatant was discarded, and the cells were resuspended in 2 mL of 2×YT liquid culture medium. The centrifuge tube containing the spores was placed in a 50°C water bath for heat shock for 10 minutes, followed by pre-germination in a shaker at 200 rpm and 30°C for 30 minutes; 500 μL of the E. coli culture collected in step 2.1 was placed in a 1.5 mL centrifuge tube containing 200 μL of the Streptomyces spore suspension, and vortexed to mix; 200 μL of the mixture was evenly spread on an MS plate; the MS plate was inverted and cultured in a 30°C incubator. After 18 hours, the surface of the culture medium was covered with 1 mg / mL apramycin and 1 mg / mL nalidixic acid. After the surface was dry, the MS plate was inverted and cultured at 30°C until conjugates grew (about 5 days).
[0099] Example 3 Evaluation of gene editing efficiency
[0100] Four single colonies from step 2.2 were picked and streaked onto ISP2 solid medium supplemented with 50 μg / mL apramycin, 50 μg / mL nalidixic acid, and 0.5 μg / mL thiostrepton. The cells were inverted and incubated at 30°C until visible cells were visible. A small amount of cells were transferred to a PCR tube containing 20 μL of DMSO and incubated at 100°C for 15 minutes, followed by refrigeration at -20°C for 30 minutes. This step was repeated twice to fully lyse the cells and release the cell lysate to obtain DNA. The target site fragment was then amplified using PCR using the Novozymes 2× Rapid Taq Master Mix (Cat. No. P222). The primer design, PCR reaction system, and protocol were shown in Table 7, Table 8, and Table 9, respectively. The above experiment was repeated three times.
[0101] Table 7 PCR amplification primers targeting act
[0102] serial number Primers Sequence (5'-3') SEQ ID NO.27 T-SCO5087-F gtcgcctgcttcgacgcgat SEQ ID NO.28 T-SCO5087-R cctccagcggaacgtagtcg
[0103] Table 8 PCR reaction system
[0104] system 15 μL ddH2O 5.50 μL Forward primer (10 μM, T-SCO5087-F) 0.75μL Reverse primer (10 μM, T-SCO5087-R) 0.75μL 2× Rapid Taq Master Mix 7.50 μL Cell lysis buffer (containing DMSO) 0.50μL
[0105] Table 9 PCR reaction program
[0106]
[0107] The PCR amplification products were subjected to 2% agarose gel electrophoresis. Taking the system composed of pdTnpB-ZH-D191A-CBEST as an example, the results were as follows: Figure 3 As shown. WT is the wild-type strain of S. coelicolor A3 (2) without any treatment, and 1-12 represent different monoclones randomly picked after the E. coli containing the pdTnpB-D191A-CBEST plasmid is combined with S. coelicolor A3 (2) and transferred. Since the result of the cytosine single-base editor of the present invention is to convert cytosine (C) in the target sequence into thymine (T), it will not theoretically cause gene insertion or deletion in the host's genomic sequence. The theoretical size of the PCR product of the experimental group is consistent with that of the wild type, that is, 556bp. In order to confirm the single-base editing effect of the present invention, the above-mentioned PCR product needs to be purified and recovered using the Weizan product purification kit (Cat. No.: DC201), and then sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for Sanger sequencing analysis.
[0108] Sequencing results further confirmed the gel electrophoresis results. Single-base substitutions from C to T were detected in samples from all experimental groups, achieving a 100% success rate for single-base editing ( Figure 4 ). After mutation, the sequence of the target gene changes, and eventually the aspartic acid (Asp) at positions 345 and 347 in the target gene mutates to asparagine (Asn), affecting the production of actinorhodin in the modified Streptomyces host. Figure 5 The sequencing results were analyzed by Beat online software (https: / / hanlab.cc / beat / ) Figure 6 ) found that the base substitution efficiency of C·G to T·A in each group was different, e.g. Figure 7 As shown. Taking the editing efficiency of the sixth C base (C6) in the target gene sequence (SEQ ID NO.8) from the direction of the TAM sequence (5'-TTGAT) as an example, the C·G to T·A editing efficiency of various single-base editors constructed in the present invention is as follows Figure 7 As shown, the details are as follows:
[0109] ·pdTnpB-ZH-D191A-cBEST-97.01±1.72%
[0110] ·pdTnpB-ZH-E278A-cBEST-84.96±6.48%
[0111] ·pdTnpB-ZH-D361A-cBEST-62.59±3.43%
[0112] ·pdTnpB-ZH-D191A-E278A-cBEST-83.38±5.36%
[0113] ·pdTnpB-ZH-D191A-D361A-cBEST-82.90±5.14%
[0114] ·pdTnpB-ZH-E278A-D361A-cBEST-79.23±5.69%
[0115] ·pdTnpB-ZH-D191A-E278A-D361A-cBEST-39.25±11.66%
[0116] The above results fully demonstrate that the series of new ultra-mini cytosine single-base editors obtained by this invention have a C·G to T·A editing efficiency of more than 75%, which can effectively mediate cytosine single-base editing in the Streptomyces genome. In addition, the reRNA-ZJ backbone has also been verified by experimental results to have a high C·G to T·A editing efficiency (98.85±0.87%). Figure 8 By comparing the editing efficiencies of the pdTnpB-ZH-D191A-cBEST and pdTnpB-ZJ-D191A-cBEST systems (the difference between the two is only in the reRNA backbone), the results showed that there was no significant difference between the two, so reRNA-ZH and reRNA-ZJ can be used interchangeably.
[0117] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various variations or modifications within the scope of the claims, which do not affect the essence of the present invention.
Claims
1. A TnpB-mediated Streptomyces mini-base editing system, comprising the following elements: a. reRNA guide cassette that guides the TnpB single-base editor; b. A fusion protein consisting of rAPOBEC1 rat cytosine deaminase, a dTnpB nuclease variant, and a codon-optimized UGI uracil glycosylase inhibitor, each of which has been codon-optimized for expression in Streptomyces, is responsible for achieving a single-base substitution from cytosine (C) to thymine (T).
2. The TnpB-mediated Streptomyces mini-base editing system according to claim 1, characterized in that The reRNA guide cassette includes the following core elements in the 5'-3' direction: a. The reRNA backbone interacting with TnpB; b. A specific base sequence that can target a DNA target sequence; c. Hepatitis D virus ribozyme sequence, guiding TnpB to precisely target the target sequence.
3. The TnpB-mediated Streptomyces mini-base editing system according to claim 2, characterized in that The reRNA backbone is selected from one of the following for use in achieving single base editing: a. reRNA-ZH, the nucleotide sequence of which is shown in SEQ ID NO. 1; b. reRNA-ZJ, the nucleotide sequence of its backbone is shown in SEQ ID NO.
2.
4. The TnpB-mediated Streptomyces mini-base editing system according to claim 1, characterized in that The nucleotide sequence and amino acid sequence of the wild-type TnpB protein are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.
5. The TnpB-mediated Streptomyces mini-base editing system according to claim 1 or 4, characterized in that The dTnpB nuclease variant is obtained by point mutation of one or more key active sites of wild-type TnpB.
6. The TnpB-mediated Streptomyces mini-base editing system according to claim 5, characterized in that The mutated key active sites include at least one of D191, E278, and D361 in the active center of the RuvC domain in the TnpB nuclease, which is mutated into Ala (A).
7. The TnpB-mediated Streptomyces mini-base editing system according to claim 6, characterized in that The obtained dTnpB variant is at least one of the following, and the wild-type TnpB nucleotide sequence is shown in SEQ ID NO.3: a.dTnpB-D191A, compared with wild-type TnpB, amino acid residue D at position 191 is replaced by A; b.dTnpB-E278A, compared with wild-type TnpB, amino acid residue D at position 278 is replaced by A; c. dTnpB-D361A, compared with wild-type TnpB, amino acid residue D at position 361 is replaced by A; d.dTnpB-D191A-E278A, referred to as dTnpB-DE, compared to wild-type TnpB, the amino acid residues D at positions 191 and 278 were replaced by A; e. dTnpB-D191A-D361A, referred to as dTnpB-DD, compared to wild-type TnpB, amino acid residues D at positions 191 and 361 were replaced by A; f. dTnpB-E278A-D361A, referred to as dTnpB-ED, compared to wild-type TnpB, the amino acid residues D at positions 278 and 361 were replaced by A; g.dTnpB-D191A-E278A-D361A, abbreviated as dTnpB-DED, compared with wild-type TnpB, the amino acid residues D at positions 191 and 278 are both replaced by A.
8. The TnpB-mediated Streptomyces mini-base editing system according to claim 1, characterized in that The nucleotide sequence of the codon-optimized rAPOBEC1 rat cytosine deaminase that can be expressed in Streptomyces is shown in SEQ ID NO.
5.
9. The TnpB-mediated Streptomyces mini-base editing system according to claim 1, characterized in that The nucleotide sequence of the codon-optimized UGI uracil glycosylase inhibitor is shown in SEQ ID NO.
6.
10. A recombinant expression plasmid vector, characterized in that: The recombinant plasmid vector can encode or express the Streptomyces mini TnpB cytosine single-base editing system according to any one of claims 1 to 9.
11. A host cell, characterized in that Contains the Streptomyces mini TnpB cytosine single-base editing system according to any one of claims 1 to 9.
12. A method for constructing a Streptomyces mini-TnpB cytosine single-base editing system, characterized in that: The method comprises the following steps: S1. Constructing a TnpB-mediated gene knock-in / knock-out plasmid containing an apramycin resistance selection marker. The gene knock-in / knock-out system plasmid is a gene editing system plasmid obtained by inserting a TnpB protein and a guide reRNA expression cassette into an Escherichia coli-Streptomyces shuttle plasmid. S2. Based on the gene editing system plasmid, point mutations were made at the key active sites of the TnpB nuclease to construct a dTnpB system plasmid with nuclease activity missing. This system does not have the ability to cut double-stranded DNA, but can still interact with reRNA and bind to the targeted gene site under the guidance of reRNA to form a dTnpB-reRNA-DNA complex; S3. Based on the dTnpB-reRNA-DNA complex obtained in step S2, the codon-optimized rAPOBEC1 and UGI were connected to the N and C termini of dTnpB using connecting peptides, thereby obtaining a cytosine single-base editing system plasmid.
13. A method for gene editing a target gene in a recipient bacterium Streptomyces using the Streptomyces mini base editing system according to any one of claims 1 to 10, characterized in that: The method comprises the following steps: A1. Under non-inducing conditions, the Streptomyces mini single-base editing system is transformed into the target host. The cytosine (C) base in the target gene is converted to uracil (U) base under the action of rAPOBEC1 in the system. The U base is then converted to thymine (T) during DNA replication, ultimately achieving a single-base conversion from C to T. Transformants carrying the DNA cytosine single-base editing system are obtained by screening for resistance genes carried in the plasmid. A2. Streak the transformant onto a plate containing the corresponding resistance medium containing the plasmid and the inducible promoter, and culture at a constant temperature until a single colony is visible; A3. Randomly select single clones, perform colony PCR, and finally verify the effect and efficiency of cytosine single-base editing through Sanger sequencing results.