Strain for synthesizing high-proportion 4-hydroxybutyric acid polyhydroxyalkanoate and construction method thereof
By overexpressing specific enzyme genes and gene knockout in Halomonas, combining glucose as the sole carbon source, and constructing a recombinant microbial strain, the problem of efficiently synthesizing high-proportion P34HB copolymers was solved, low-cost, high-yield industrial production was achieved, and the uniformity and stability of material properties were improved.
Patent Information
- Application Number
- CN202510650163.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2025-09-26
AI Technical Summary
Existing technologies make it difficult to efficiently synthesize high-proportion P34HB copolymers in Halomonas, and traditional methods rely on precursors with similar structures to 4HB, which leads to microbial growth inhibition and material performance heterogeneity, making it impossible to achieve low-cost, open, and high-yield large-scale industrial production.
By overexpressing 4-hydroxybutyryl-CoA transferase, PHA polymerase, 4-hydroxybutyrate dehydrogenase, succinate semialdehyde dehydrogenase and α-ketoglutarate decarboxylase genes in Halomonas, combined with gene knockout and outer membrane engineering, and using glucose as the sole carbon source, a recombinant microbial strain was constructed to achieve the production of high-proportion 4HB copolymers.
It breaks through the bottleneck of the 4HB monomer ratio in the existing technology, realizes the high-yield, low-cost production of high-ratio P34HB copolymers, is suitable for open fermentation processes, and improves the uniformity and stability of material properties.
Smart Images

Figure BDA0005410883810000161 
Figure BDA0005410883810000171 
Figure BDA0005410883810000181
Abstract
Description
Technical Field
[0001] The present invention relates to the field of metabolic engineering biotechnology. More specifically, the present invention relates to a method for constructing a strain producing poly(3-hydroxybutyrate-4-hydroxybutyrate) containing a high proportion of 4-hydroxybutyrate (4HB) monomers, and to the optimization of fermentation conditions for industrial scale-up production. Background Art
[0002] Biodegradable plastics, polyhydroxyalkanoates (PHAs), are polymer materials synthesized by microorganisms through natural or artificial metabolic pathways. Based on the differences in monomer composition, they can be divided into single-component homopolymers and multi-component copolymers. Due to their excellent biocompatibility, biodegradability, and recyclability, they are considered excellent alternatives to petroleum-based materials. Based on the number of carbon atoms in the monomers, PHAs can be divided into short-chain (scl-) PHAs and medium-chain (mcl-) PHAs. Scl-PHAs have monomers containing 3-5 carbon atoms, while mcl-PHAs have monomers containing 6 or more carbon atoms. Generally speaking, scl-PHAs have higher rigidity and brittleness, while mcl-PHAs exhibit greater elasticity and lower tensile strength and melting point (Obruca et al., 2022). PHA materials can be used in industries such as plastic packaging, textiles, 3D printing materials, and biomedicine. Poly(3-hydroxybutyrate) (PHB) is a typical short-chain PHA, which can be naturally synthesized by various microorganisms, including Halomonas sp. However, due to its crystalline structure, PHB exhibits brittle and easily fractured material properties. Mixing or copolymerizing it with other monomers can expand the physical and mechanical properties of PHA materials and meet a wider range of application scenarios (Chen et al., 2021).
[0003] Poly(3-hydroxybutyrate-4-hydroxybutyrate) (P(3HB-co-4HB) or P34HB), as the fourth-generation commercial PHA material, is a copolyester that combines flexibility with excellent thermal stability. As the proportion of 4HB monomer in the copolymer increases, its crystallinity and melting point decrease, and its elongation at break increases, transforming it from a rigid plastic to a soft, highly elastic rubber state, giving the material diverse processing potential. At the same time, it has good biocompatibility and biodegradability, which broadens the temperature range in which the material can be processed. This material can be made into transparent films and high-strength fibers, and through process control, it can form an elastomeric material with biodegradable properties. It can also be prepared into tissue engineering materials through electrospinning (Fu et al., 2014a), and can be mixed with other materials to form composite materials as a substitute for heat-sensitive adhesives (Jo et al., 2022). It has important application value in medical materials, food packaging, textile fibers and other fields.
[0004] However, existing production technologies have numerous limitations. Traditional hosts (such as E. coli or Cupriavidus necator) can produce high-proportion P34HB copolymers or P4HB homopolymers (reference patent: US6316262). However, as industrial strains, these strains require strict sterilization of fermentation equipment, making them unsuitable for open fermentation processes, significantly limiting the economic benefits of large-scale production. Halomonas naturally thrives in environments with high salt concentrations (3%-10% NaCl) and high pH (pH 8.0-9.0) and exhibits high resistance to contamination, making it suitable for large-scale production under open, non-sterile fermentation conditions. These properties make it an ideal platform for "next-generation industrial biotechnology" (NGIB) (Fu et al., 2014b, Tan et al., 2011). However, existing research and patented technologies for synthesizing P34HB using Halomonas (patent publication numbers: CN118995776A, CN110079489A, CN114134096A) generally fail to break through the bottleneck of 20% molar ratio of 4HB monomer in the synthesized copolymers (Zhang et al., 2022, Yan et al., 2022, Ye et al., 2020, Ye et al., 2018b, Ye et al., 2018a, Shen et al., 2018, He et al., 2025), which seriously restricts the further optimization of P34HB material performance and the expansion of downstream application scenarios. Existing studies to synthesize copolymers with a molar ratio exceeding 20% 4HB in Halomonas bacteria typically rely on the addition of feeds such as γ-butyrolactone (Wang et al., 2022b, Ye et al., 2018b) and 1,4-butanediol (Yan et al., 2022, Zhang et al., 2022) as structurally similar 4HB precursors. γ-Butyrolactone is toxic, and excessive addition can inhibit microbial growth. 1,4-Butanediol, as a chain transfer agent in PHA polymerization, can prematurely terminate the reaction and significantly limit the molecular weight of the copolymer (Tsuge et al., 2013). Furthermore, in scaled-up fermentation production processes, feeds containing structurally similar 4HB precursors are typically added during the second stage of fermentation to minimize disruption to the growth of the initial strain. This not only prevents real-time measurement of the residual precursor and the precise control of feed dosage, but also poses a critical challenge: the resulting P34HB is typically a block copolymer, rather than a random copolymer, significantly impacting the uniformity and stability of the material's properties.
[0005] Therefore, developing a recombinant microorganism that can efficiently synthesize high-proportion 4HB copolymers, improve the conversion rate of cheap carbon sources, enrich the available precursor carbon sources, without relying on the addition of 4HB structure-related precursors, and achieve low-cost, open, high-yield large-scale industrial production has become a key issue that needs to be urgently addressed in this field. Summary of the Invention
[0006] To address these issues, the inventors, after in-depth research, have developed a recombinant microbial strain based on Halomonas for the production of PHA copolymers containing 20-60% 4HB monomer by molar ratio. This, combined with the addition of low-4HB-related structural precursors and no 4HB-related precursors, such as glucose as the sole carbon source, allows for a greener and more environmentally friendly industrial production of PHA. Furthermore, this recombinant strain can be used to synthesize P34HB using more environmentally friendly bio-based precursors (e.g., glucose, sodium acetate, acetic acid, 1,4-butanediol, γ-aminobutyric acid, etc.).
[0007] Specifically, the present inventors unexpectedly discovered that by overexpressing 4-hydroxybutyryl-CoA transferase and PHA polymerase in the P34HB production microorganism, particularly by simultaneously overexpressing one or more (preferably all) of the 4-hydroxybutyrate dehydrogenase gene (4hbD), succinate semialdehyde dehydrogenase gene (sucD), and α-ketoglutarate decarboxylase gene (ogdA), a high-proportion 4HB copolymer can be produced using glucose as the sole carbon source (Example 10, the molar ratio of 4HB in the produced P34HB copolymer can reach 38.8%), breaking through the bottleneck of the prior art in which the 4HB monomer ratio in copolymers synthesized using glucose as the sole carbon source is generally difficult to exceed a molar ratio of 20%.
[0008] Therefore, according to one aspect of the present invention, a recombinant microorganism for producing P34HB (poly-3-hydroxybutyrate (3HB)-4-hydroxybutyrate (4HB) ester) is provided, which comprises a metabolic pathway for producing P34HB and overexpresses 4-hydroxybutyryl-CoA transferase and PHA polymerase.
[0009] In one embodiment, the microorganism is selected from Halomonas, Pseudomonas, Escherichia coli, Ralstonia eutropha, Aeromonas, Bacilllus, Alcaligenes latus and Alcaligenes eutropus, preferably the microorganism is Halomonas, more preferably the Halomonas is Halomonas bluephagenesis, Halomonas aydingkolgenesis, Halomonas campaniensis, Halomonas lutescens, Halomonas hydrothermalis, Halomonas sp.KM1, Halomonasaselongata and Halomonas smyrnensis, still more preferably Halomonas bluephagenesis TD1.0, Halomonas bluephagenesis TD01 (culture deposit number CGMCC No.4353), Halomonasaydingkolgenesis M1 (strain deposit number CGMCC No.19880), Halomonas campaniensis LS21 (strain deposit number CGMCC No.6593), Halomonas bluephagenesis TD27, Halomonasbluephagenesis TDB141, Halomonas bluephagenesis TDB141ΔAC, Halomonas bluephagenesis WZY254, Halomonas bluephagenesis WZY278 or Halomonas bluephagenesis CYL0307.
[0010] In another embodiment, the recombinant microorganism is Halomonas, and wherein: 1) the recombinant microorganism also overexpresses one or more (preferably all) of the 4-hydroxybutyrate dehydrogenase gene (4hbD), the succinate semialdehyde dehydrogenase gene (sucD) and the α-ketoglutarate decarboxylase gene (ogdA), preferably expressing one or more (preferably all) of 4hbD, sucD and ogdA through a toxin-antitoxin system plasmid; and / or 2) the succinate semialdehyde dehydrogenase gene has been knocked out or knocked down in the recombinant microorganism.
[0011] In another embodiment, the endogenous plasmid has been knocked out in the recombinant microorganism.
[0012] In another embodiment, the 4-hydroxybutyryl-CoA transferase and / or the PHA polymerase are overexpressed on a plasmid and / or genome in the recombinant microorganism, preferably the plasmid is a (exogenous) toxin-antitoxin system plasmid.
[0013] In another embodiment, one or more of the endogenous β-ketothiolase gene phaA, the endogenous acetoacetyl-CoA reductase gene phaB, and the endogenous PHA polymerase gene phaC have been knocked out or knocked down in the recombinant microorganism, preferably the endogenous β-ketothiolase gene phaA and the acetoacetyl-CoA reductase gene phaB have been knocked out or knocked down, and more preferably the endogenous β-ketothiolase gene phaA has been knocked out or knocked down.
[0014] In another embodiment, an ssrA degradation tag sequence is inserted before the stop codon of the endogenous phaA, phaB and / or phaC gene (preferably phaB) in the recombinant microorganism.
[0015] In another embodiment, one or more (preferably all) of the genes 3-hydroxybutyryl-CoA dehydrogenase (3hbD), enoyl-CoA hydratase (fadB), 2,3-dehydroadipyl-CoA dehydratase (paaF), and enoyl-CoA hydratase (paaG) in the recombinant microorganism have been knocked out or knocked down.
[0016] In another embodiment, the recombinant microorganism further overexpresses a PHA particle binding protein;
[0017] In another embodiment, the recombinant microorganism further has the genes encoding exopolysaccharide synthesis knocked out or knocked down by outer membrane engineering, so that the outer membrane permeability is increased. Preferably, the outer membrane PS4 gene cluster has been knocked out or knocked down in the recombinant microorganism.
[0018] In another embodiment, the recombinant microorganism further has the sspB gene knocked out or knocked down and an ssrA degradation tag sequence inserted before the stop codon of the cytoskeleton mreB gene, and / or the endogenous PHA particle binding protein gene is knocked out.
[0019] In another embodiment, the recombinant microorganism also overexpresses endogenous or exogenous genes encoding α-ketoglutarate transaminase (gdhA), glutamate decarboxylase (gadB), γ-aminobutyrate transaminase (gabT), glutamate-succinate semialdehyde transaminase (gadA) and / or glutamate dehydrogenase (gdhA) and metabolic pathway genes (including speA, speB, pat, prr, gltBD, putA) that degrade amino acids (including arginine, glutamine and proline) into γ-aminobutyric acid.
[0020] In another embodiment, the recombinant microorganism further overexpresses an alcohol dehydrogenase gene and / or an aldehyde dehydrogenase gene, preferably the aldehyde dehydrogenase is selected from aldD1, aldD2, aldH and ydcW, the alcohol dehydrogenase is adhp or dhaT, and / or preferably the alcohol dehydrogenase gene and / or the aldehyde dehydrogenase gene is overexpressed on a plasmid or genome in the recombinant microorganism, more preferably the recombinant microorganism overexpresses adhp and aldD.
[0021] In another embodiment, the recombinant microorganism is further deleted for 3-hydroxypropionate dehydrogenase gene (dddA), methylmalonate semialdehyde dehydrogenase gene (dddC), or a combination thereof.
[0022] In another embodiment, the overexpression is constitutive expression under the control of a constitutive promoter or inducible expression under the control of an inducible promoter, preferably the inducible promoter is selected from Mmp1 promoter, lux promoter, lac promoter, trp promoter, tac promoter, hypoxia-inducible promoter, bacterial quorum sensing-inducible promoter, temperature-sensitive promoter or a combination thereof, preferably the constitutive promoter is selected from wild-type porin gene Pporin promoter or a mutant thereof, wild-type PHA particle binding protein phaP1 gene promoter or essential gene promoter, wherein the mutant is selected from Pporin1, Pporin42, Pporin51, Pporin58, Pporin68, Pporin140, Pporin141, Pporin192, Pporin194, Pporin221, Pporin226, Pporin259 and Pporin278. These Pporin promoters and mutants thereof are disclosed in, for example, CN117143793B.
[0023] In another embodiment, the plasmid is a pSEVA plasmid (preferably pSEVA321), and / or the toxin-antitoxin system plasmid is pHbPBC.
[0024] In another embodiment, the 4-hydroxybutyryl-CoA transferase is selected from 4-hydroxybutyryl-CoA transferase (orfZ) derived from Clostridium klyveri, 4-hydroxybutyryl-CoA transferase (abfT) derived from Clostridium aminobutyricum, 4-hydroxybutyryl-CoA transferase (catfT) derived from Cupriavidus necator, Cn ) and 4-hydroxybutyryl-CoA transferase from Nitrosopumilus maritimus (cat Nm ), preferably orfZ.
[0025] In another embodiment, the PHA polymerase is an exogenous PHA polymerase, preferably selected from phaC from Cupriavidus necator. Cn gene, phaC from Burkholderia contaminans Kad1 Bc gene and phaC from Burkholderia sp.USM (JCM15050) Bs .
[0026] In a preferred embodiment, the starting strain of the recombinant microorganism is Halomonas TD27, TD141, TD163 or TD163LCP.
[0027] In a preferred embodiment, the phaC from Cupriavidus necator is included. Cn gene (SEQ ID No. 1), or phaC from Burkholderia contaminans Kad1 Bc gene (SEQ ID No. 2) or phaC from Burkholderia sp. USM (JCM15050) Bs The genes (SEQ ID No. 3) were combined with orfZ (SEQ ID No. 5) and overexpressed by the pSEVA321 plasmid under the drive of the wild-type porin promoter (SEQ ID No. 4).
[0028] In a preferred embodiment, the orfZ gene (SEQ ID No. 5) from Clostridium klyveri, the abfT gene (SEQ ID No. 6) from Clostridium aminobutyricum, the cat gene (SEQ ID No. 7) from Cupriavidus necator Cngene (SEQ ID No.7), and cat from the archaeon Nitrosopumilusmaritimus Nm gene (SEQ ID No.8), respectively with phaC Cn (SEQ ID No. 1) combination was overexpressed on the pSEVA321 plasmid driven by the wild-type porin promoter (SEQ ID No. 4).
[0029] In a preferred embodiment, the recombinant microorganism is Halomonas (preferably TD141), and five orthologous succinate semialdehyde dehydrogenase gabD1-5 genes (sequences shown in SEQ ID Nos. 44-48, respectively) on the genome of the recombinant Halomonas are knocked out.
[0030] In a preferred embodiment, the recombinant microorganism is Halomonas (preferably TD163), and the endogenous plasmid is knocked out to obtain TD163LCP, and the toxin-antitoxin system plasmid pHbPBC is used to simultaneously overexpress phaC in the TD163LCP strain. Cn and orfZ (SEQ ID No.9: pW01 plasmid sequence), or overexpression of phaC alone Cn (SEQ ID No. 10: pW02 plasmid sequence) or orfZ (SEQ ID No. 11: pW03 plasmid sequence).
[0031] In a preferred embodiment, the recombinant microorganism is Halomonas (preferably TD163), and the endogenous 3HB metabolic pathway genes, including the endogenous β-ketothiolase genes phaA2 (SEQ ID No. 13), phaA3 (SEQ ID No. 14), acetoacetyl-CoA reductase gene phaB (SEQ ID No. 15), and endogenous PHA polymerase gene phaC (SEQ ID No. 16), are knocked out respectively by CRISPR / Cas9 gene editing method.
[0032] In a preferred embodiment, targeted protein degradation is also used to reduce PhaB protein expression. In a preferred embodiment, different ssrA degradation tags are inserted before the stop codon of the phaB gene to degrade PhaB protein at different stages of bacterial growth, thereby reducing 3HB anabolic flux.
[0033] In a preferred embodiment, the recombinant microorganism is Halomonas (preferably TD163), and the endogenous 3hbD (SEQ ID No. 17), fadB (SEQ ID No. 18), paaF (SEQ ID No. 19) and paaG (SEQ ID No. 20) are knocked out respectively by CRISPR / Cas9 gene editing method.
[0034] In a preferred embodiment, the recombinant microorganism is Halomonas sp. (preferably TD163), and a series of endogenous PhaP1 of Halomonas sp. TD01 are overexpressed on the pSEVA321 plasmid. Hb (nucleotide sequence SEQ ID No.21), PhaP2 Hb (nucleotide sequence SEQ ID No. 22), PhaP3 Hb Protein (nucleotide sequence SEQ ID No. 23) or PhaP1 from Cupriavidus necator Cn (nucleotide sequence SEQ ID No. 24), PhaP2 Cn (nucleotide sequence SEQ ID No. 25), PhaP3 Cn (nucleotide sequence SEQ ID No. 26), PhaP4 Cn (nucleotide sequence SEQ ID No. 27), PhaP5 Cn protein (nucleotide sequence SEQ ID No.28).
[0035] In a preferred embodiment, the recombinant microorganism is Halomonas (preferably TD163), and the outer membrane PS4 gene cluster (SEQ ID No. 12) is knocked out by CRISPR / Cas9 gene editing method.
[0036] In a preferred embodiment, the recombinant microorganism is Halomonas (preferably TD163 or TD163BG), and the sspB gene is knocked out using CRISPR / Cas9 (sspB gRNA sequence: gttaacgccttatgtggtgg). Simultaneously, an ssrA21 degradation tag sequence is inserted before the stop codon of the cytoskeletal mreB gene, resulting in reduced cytoskeletal protein expression, rounded cell morphology, and increased cell volume in the later stages of cell growth. In a preferred embodiment, CRISPR / Cas9 is further used to knock out the endogenous PHA granule-binding protein phaP1 gene.
[0037] In a preferred embodiment, the recombinant microorganism is Halomonas (preferably TD163 or TD163LCP), which contains the metabolic pathway genes 4hbD (SEQID No.33), sucD (SEQ ID No.34) and ogdA (SEQ ID No.35) of glucose synthesis 4HB expressed on the toxin antitoxin system pHbPBC plasmid vector. Preferably, the genes 4hbD, sucD and ogdA are expressed under the control of the wild-type porin gene Pporin promoter or its mutant. The mutant is selected from Pporin1, Pporin42, Pporin51, Pporin58, Pporin68, Pporin140, Pporin141, Pporin192, Pporin194, Pporin221, Pporin226, Pporin259 and Pporin278. Most preferably, the plasmid pHbPBC-P is introduced (conjugated) into the TD163LCP strain with the endogenous plasmid knocked out. porin194 -4hbD-sucD-ogdA (SEQ ID No. 36: pW08 plasmid sequence), and the recombinant strain was named WR3. Also preferably, the genes 4hbD, sucD, and ogdA are expressed under the control of the porin192 promoter (SEQ ID No. 37) on the toxin-antitoxin system pHbPBC plasmid vector. Also preferably, the genes 4hbD, sucD, and ogdA are expressed under the control of the porin259 promoter (SEQ ID No. 38) on the toxin-antitoxin system pHbPBC plasmid vector. Also preferably, the genes 4hbD, sucD, and ogdA are expressed under the control of the porin194 promoter (SEQ ID No. 39) on the toxin-antitoxin system pHbPBC plasmid vector. Also preferably, the genes 4hbD, sucD, and ogdA are expressed under the control of the porin68 promoter (SEQ ID No. 40) on the toxin-antitoxin system pHbPBC plasmid vector. It is also preferred that the genes 4hbD, sucD and ogdA are expressed under the control of the porin141 promoter (SEQ ID No. 41) on the toxin antitoxin system pHbPBC plasmid vector. It is also preferred that the genes 4hbD, sucD and ogdA are expressed under the control of the porin1 promoter (SEQ ID No. 42) on the toxin antitoxin system pHbPBC plasmid vector. It is also preferred that the genes 4hbD, sucD and ogdA are expressed under the control of the phaP1 endogenous promoter (SEQ ID No. 43) on the toxin antitoxin system pHbPBC plasmid vector. It is also preferred that the genes 4hbD, sucD and ogdA are expressed under the control of the phaP1 endogenous promoter (SEQ ID No. 44) on the toxin antitoxin system pHbPBC plasmid vector. porin194-4hbD-sucD-ogdA (SEQ ID No. 36: pW08 plasmid sequence) and pHbPBC-P porin68 -4hbD-sucD-ogdA plasmid has one copy of 4-hydroxybutyryl-CoA gene orfZ or abfT inserted downstream of ogdA gene.
[0038] According to another aspect of the present invention, a method for producing P34HB (poly-3-hydroxybutyrate (3HB)-4-hydroxybutyrate (4HB)) is provided, which comprises fermenting and culturing the recombinant microorganism according to the present invention.
[0039] In one embodiment, the fermentation culture utilizes glucose as the sole carbon source to synthesize the P34HB.
[0040] In one embodiment, the fermentation culture utilizes glucose and a 4HB structurally related precursor or a 4HB structurally unrelated precursor to synthesize the P34HB, wherein the 4HB structurally related precursor includes 1,4-butanediol, γ-butyrolactone or sodium 4-hydroxybutyrate, and / or the 4HB structurally unrelated precursor includes sodium acetate, α-ketoglutarate, citric acid, γ-aminobutyric acid, glutamate, glutamine, proline or arginine.
[0041] In another embodiment, the fermentation culture utilizes urea, yeast extract, corn steep liquor or wool hydrolyzate as a nitrogen source; and / or the fermentation culture is an open fermentation. Preferably, the culture medium used in the fermentation culture does not need to be sterilized.
[0042] Through a series of innovative genetic engineering and metabolic engineering strategies, the present invention successfully constructed one or more recombinant Halomonas bacteria capable of efficiently producing copolymers containing a high molar ratio of 4HB. Combined with the optimized fermentation strategy, high-yield synthesis of P34HB copolymers with a high proportion of 4HB was achieved in open fermentation, providing rich strain resources and a solid fermentation process foundation for the industrial application of P34HB. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] The above features and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the accompanying drawings, in which:
[0044] Figure 1: Poly (3-hydroxybutyrate-4-hydroxybutyrate) (P34HB) metabolic pathway; the 3HB synthesis pathway mainly uses glucose as the precursor carbon source, which is converted into acetyl-CoA through glycolysis, and synthesized into 3-hydroxybutyryl-CoA (3HB-CoA) under the catalysis of β-ketothiolase (phaA) and acetoacetyl-CoA reductase (phaB); in the 4HB synthesis pathway, acetyl-CoA is converted into α-ketoglutarate and succinyl-CoA through the tricarboxylic acid cycle, and succinic semialdehyde is generated under the catalysis of α-ketoglutarate decarboxylase (ogdA) and succinic semialdehyde dehydrogenase (sucD); the amino acid metabolic pathway can also generate succinic semialdehyde. Specifically, α-ketoglutarate is converted into glutamate under the catalysis of α-ketoglutarate transaminase (gdhA), and γ-aminobutyric acid is generated under the catalysis of glutamate decarboxylase (gadB), and then γ-aminobutyric acid is transaminated in γ-aminobutyric acid. Succinic semialdehyde is generated under the catalysis of enzyme (gabT); glutamate can also be derived from the degradation of glutamine and proline; arginine can also be metabolized as a precursor to γ-aminobutyric acid, further increasing the content of γ-aminobutyric acid intermediates; the above-mentioned succinic semialdehyde intermediate metabolites are catalyzed by 4-hydroxybutyrate dehydrogenase (4hbD) to generate 4HB; in order to increase the metabolic flux of 4HB, 1,4-butanediol and γ-butyrolactone are added as structurally similar precursors, among which γ-butyrolactone is hydrolyzed to 4-hydroxybutyric acid sodium salt under alkaline conditions, and 1,4-butanediol is converted into 4HB under the catalysis of alcohol dehydrogenase (adhP) and aldehyde dehydrogenase (aldD); 4-hydroxybutyryl-CoA transferase (orfZ) converts 4HB into 4-hydroxybutyryl-CoA (4HB-CoA); finally 3HB-CoA and 4HB-CoA are converted into 4HB-CoA by PHA polymerase (phaC Cn ) catalyzed by polymerization to form P34HB.
[0045] Figure 2 :Combination expression plasmids of PHA polymerase PhaC and OrfZ from different species; driven by the wild-type porin promoter (SEQ ID No. 4), phaC Cn gene (SEQ ID No. 1), phaC Bc gene (SEQ ID No. 2) and phaC Bs The gene (SEQ ID No. 3) was combined with orfZ (SEQ ID No. 5) and constructed into the pSEVA321 high-copy plasmid.
[0046] Figure 3 : Overexpression of PHA polymerases PhaC and OrfZ from different sources to produce P34HB; Recombinant Halomonas TD27 carrying the pSEVA321 plasmid overexpresses phaC Cn -orfZ, phaC Bc -orfZ or phaC Bs-orfZ shake flask results.
[0047] Figure 4 :4-Hydroxybutyryl-CoA transferase genes and phaC from different species Cn Combined expression plasmid; under the drive of wild-type porin promoter (SEQ ID No.4), orfZ gene (SEQ ID No.5), abfT gene (SEQ ID No.6), cat Cn gene (SEQ ID No.7) and cat Nm (SEQ ID No.8) and phaC Cn (SEQ ID No. 1) combination, constructed in the pSEVA321 plasmid backbone for overexpression.
[0048] Figure 5 :4-Hydroxybutyryl-CoA transferase genes and phaC from different species Cn Combined expression production of P34HB; recombinant Halomonas TD27 carrying pSEVA321 plasmid overexpressing phaC Cn -orfZ, phaC Cn -abfT、phaC Cn -cat Cn or phaC Bs -cat Nm The shake flask results.
[0049] Figure 6 : Overexpression of PhaC Cn The effect of OrfZ on the ratio of 4HB in the P34HB copolymer; the recombinant Halomonas TD163LCP with the endogenous plasmid knocked out carries the toxin-resistant plasmid pHbPBC and overexpresses phaC Cn -orfZ (SEQ ID No. 9: pW01 plasmid) and overexpression of phaC alone Cn (SEQ ID No. 10: pW02 plasmid) or orfZ (SEQ ID No. 11: pW03 plasmid) shake flask results.
[0050] Figure 7: Shake flask results of P34HB production by recombinant strains modified by morphological engineering and outer membrane engineering; growth, PHA production and 4HB molar ratio results of a series of TD163 derivatives TD163BG (genotype is TD163 knocked out ΔsspB, and the ssrA21 degradation tag is inserted before the stop codon of the mreB gene), TD163BGΔphaP1 (TD163BG strain knocked out phaP1 gene), TD163ΔphaP1 (TD163 strain knocked out phaP1 gene), TD163ΔPS4 (TD163 strain knocked out PS4 gene cluster (SEQ ID No.12)) in shake flask experiments.
[0051] Figure 8 : Self-flocculation effect of the recombinant strain with PS4 knocked out; comparison of the sedimentation effects of TD163 strain and TD163ΔPS4 strain after standing in a centrifuge tube for 0 min, 5 min, 10 min, 15 min, and 30 min.
[0052] Figure 9 : Shake flask results of recombinant strains with knockout of endogenous 3HB-CoA synthesis pathway genes producing high-proportion 4HB copolymers; (A) Shake flask dry weight, PHA content, 4HB ratio and (B) the proportion of synthesized 4HB in cell dry weight of recombinant strains with knockout of endogenous phaA2 (SEQ ID No.13), phaA3 (SEQ ID No.14), phaB (SEQ ID No.15), and phaC (SEQ ID No.16) genes based on the TD163 strain.
[0053] Figure 10 : The effect of degrading PhaB protein on the improvement of the 4HB ratio of the copolymer; using the TD163BG strain as the chassis, the strain with ssrA7, ssrA17, ssrA5, ssrA21, and ssrA16 protein degradation tags (gene sequences SEQ ID Nos.49-53) inserted before the stop codon of the phaB gene (SEQ ID No.15) produced P34HB containing a high ratio of 4HB monomers.
[0054] Figure 11 :NMR examination of fermentation products of TD163ΔphaA3 strain (A) NMR 1 H spectroscopy and (B) NMR 13 C verified that the obtained copolymer was P(52% 3HB-co-48% 4HB).
[0055] Figure 12: The effect of knocking out the bypass gene on the improvement of the 4HB ratio of the copolymer; the shake flask dry weight, PHA content, and 4HB ratio results of the TD163 strain after knocking out the 3hbD gene (SEQ ID No.17), fadB gene (SEQ ID No.18), and paaFG gene (SEQ ID No.19-20).
[0056] Figure 13 :Overexpression of PHA binding protein PhaP further increased cell dry weight and 4HB ratio; TD163 strain carrying pSEVA321 plasmid overexpressed protein PhaP1 Hb 、PhaP2 Hb 、PhaP3 Hb (Gene sequence SEQ ID Nos. 21-23), PhaP1 Cn 、PhaP2 Cn 、PhaP3 Cn 、PhaP4 Cn or PhaP5 Cn (Gene sequence SEQ ID Nos.24-28) shake flask experiment results.
[0057] Figure 14 : Combinatorial overexpression of phaC Cn with phaP Cn Further increase the cell dry weight and 4HB ratio; TD163LCP strain carries toxin antitoxin plasmid pHbPBC vector to overexpress phaP1 Hb (SEQ ID No. 29: pW04 plasmid), phaP5 Cn (SEQ ID No.30: pW05 plasmid), phaC Cn -phaP1 Hb (SEQ ID No.31: pW06), phaC Cn -phaP5 Cn (SEQ ID No. 32: pW07) shake flask results.
[0058] Figure 15 : Results of shake flask experiments using glucose as the sole carbon source and adding 1,4-butanediol precursor to synthesize P34HB; (A) Cell dry weight, PHA content, 4HB molar ratio, and (B) molecular weight results of the TD163LCP strain carrying the pW08 plasmid (SEQ ID No. 36) in shake flask experiments with the addition of glucose alone or glucose and 1,4-butanediol simultaneously.
[0059] Figure 16: Promoters of different strengths drive the expression of 4hbD, sucD, and ogdA genes to achieve controllable increase in the proportion of 4HB monomer in the copolymer; using glucose as the sole carbon source, the TD163LCP strain carrying the pHbPBC plasmid overexpresses the 4hbD (SEQ ID No.33), sucD (SEQ ID No.34), and ogdA (SEQ ID No.35) genes, and their upstream expression is driven by the porin192 (SEQ ID No.37), porin259 (SEQ ID No.38), porin194 (SEQ ID No.39), porin68 (SEQ ID No.40), porin141 (SEQ ID No.41), porin1 (SEQ ID No.42), or phaP1 promoter (SEQ ID No.43), respectively.
[0060] Figure 17 : Map of plasmids overexpressing the 4hbD, sucD, and ogdA genes driven by promoters of different strengths and in combination with the 4-hydroxybutyryl-CoA transferase gene (orfZ or abfT); The pHbPBC plasmid vector drives the tandem expression of the 4hbD-sucD-ogdA gene with the orfZ (SEQ ID No. 5) or abfT (SEQ ID No. 6) gene via porin68 (SEQ ID No. 40) or porin194 (SEQ ID No. 39).
[0061] Figure 18 : Shake flask results of pHbPBC plasmid overexpressing 4hbD, sucD, ogdA genes and 4-hydroxybutyryl-CoA transferase gene (orfZ or abfT) driven by different promoter strengths; 4so: abbreviation of 4hbD-sucD-ogdA gene.
[0062] Figure 19 : WR3 strain synthesized P34HB in a 7L fermenter using glucose as the sole carbon source; OD 600 , cell dry weight, PHA content, and 4HB molar ratio results.
[0063] Figure 20 : WR3 strain synthesized P34HB in a 100L fermenter using glucose as the sole carbon source; OD 600 , cell dry weight, PHA content, and 4HB molar ratio results.
[0064] Figure 21 : WR3 strain synthesized P34HB in a 5000L fermenter using glucose as the sole carbon source; OD 600, cell dry weight, PHA content, and 4HB molar ratio results.
[0065] Figure 22 : WR3 strain synthesized P34HB in a 7L fermentor using glucose and sodium acetate as carbon sources; cell dry weight (CDW), PHA content, and 4HB molar ratio during the 48-h fermentation process.
[0066] Description of sequence listing (the following sequences are preferred sequences and used in the examples) SEQ ID No. 1: phaC Cn Sequence (1770 bp)
[0067] SEQ ID No. 2: phaC Bc Sequence (1866 bp)
[0068] SEQ ID No. 3: phaC Bs Sequence (1875bp)
[0069] SEQ ID No. 4: Wild-type porin promoter sequence (218 bp) SEQ ID No. 5: orfZ sequence (1290 bp)
[0070] SEQ ID No. 6: abfT sequence (1317 bp)
[0071] SEQ ID No.7: cat Cn Sequence (1311 bp)
[0072] SEQ ID No.8: cat Nm Sequence (2097 bp)
[0073] SEQ ID No. 9: pW01 plasmid sequence (8891 bp)
[0074] SEQ ID No. 10: pW02 plasmid sequence (7541 bp) SEQ ID No. 11: pW03 plasmid sequence (7073 bp) SEQ ID No. 12: PS4 sequence (14851 bp)
[0075] SEQ ID No. 13: phaA2 sequence (1188 bp)
[0076] SEQ ID No. 14: phaA3 sequence (1179 bp)
[0077] SEQ ID No. 15: phaB sequence (747 bp)
[0078] SEQ ID No. 16: phaC sequence (1851 bp)
[0079] SEQ ID No. 17: 3hbD sequence (849 bp)
[0080] SEQ ID No. 18: fadB sequence (2175 bp)
[0081] SEQ ID No. 19: paaF sequence (774 bp)
[0082] SEQ ID No.20: paaG sequence (792bp)
[0083] SEQ ID No. 21: phaP1 Hb Sequence (357 bp)
[0084] SEQ ID No. 22: phaP2 Hb Sequence (375bp)
[0085] SEQ ID No. 23: phaP3 Hb Sequence (411 bp)
[0086] SEQ ID No. 24: phaP1 Cn Sequence (579 bp)
[0087] SEQ ID No. 25: phaP2 Cn Sequence (567 bp)
[0088] SEQ ID No. 26: phaP3 Cn Sequence (558 bp)
[0089] SEQ ID No. 27: phaP4 Cn Sequence (570 bp)
[0090] SEQ ID No. 28: phaP5 Cn Sequence (429 bp)
[0091] SEQ ID No. 29: pW04 plasmid sequence (6128 bp) SEQ ID No. 30: pW05 plasmid sequence (6200 bp) SEQ ID No. 31: pW06 plasmid sequence (7946 bp) SEQ ID No. 32: pW07 plasmid sequence (8018 bp) SEQ ID No. 33: 4hbD sequence (1116 bp)
[0092] SEQ ID No. 34: sucD sequence (1350 bp)
[0093] SEQ ID No. 35: ogdA sequence (1638 bp)
[0094] SEQ ID No.36: pW08 plasmid sequence (9833 bp) SEQ ID No.37: porin192 promoter sequence (146 bp) SEQ ID No.38: porin259 promoter sequence (146 bp) SEQ ID No.39: porin194 promoter (146 bp)
[0095] SEQ ID No.40: porin68 promoter sequence (146 bp) SEQ ID No.41: porin141 promoter sequence (146 bp) SEQ ID No.42: porin1 promoter sequence (146 bp) SEQ ID No.43: endogenous phaP1 promoter sequence (237 bp)
[0096] SEQ ID No. 44: gabD1 sequence (1497 bp)
[0097] SEQ ID No. 45: gabD2 sequence (1446 bp)
[0098] SEQ ID No. 46: gabD3 sequence (1452 bp)
[0099] SEQ ID No. 47: gabD4 sequence (1449 bp)
[0100] SEQ ID No. 48: gabD5 sequence (1458 bp)
[0101] SEQ ID No.49: ssrA7 tag sequence
[0102] SEQ ID No.50: ssrA17 tag sequence
[0103] SEQ ID No.51: ssrA5 tag sequence
[0104] SEQ ID No.52: ssrA21 tag sequence
[0105] SEQ ID No.53: ssrA16 tag sequence DETAILED DESCRIPTION
[0106] Unless otherwise indicated, the terms used herein have their ordinary technical meanings as understood by those skilled in the art. For definitions and terms in the art, it is particularly recommended that the skilled person refer to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999).
[0107] In the present invention, the singular articles "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. All references cited herein are hereby incorporated by reference in their entirety.
[0108] In the present invention, the terms "comprising" or "including" are open-ended expressions, referring to the specific components or steps being described, while not excluding other components or steps that have no substantial impact. When describing a protein or nucleic acid sequence, the sequence may constitute the target molecule in isolation, or may have additional amino acids or nucleotides appended to one or both ends, or undergo protein engineering, while retaining the functional activity described herein.
[0109] The term "and / or" as used herein includes all combinations of the items connected by the term, and each combination should be deemed to have been listed separately herein. For example, "A and / or B" includes "A," "A and B," and "B." For another example, "A, B, and / or C" includes "A," "B," "C," "A and B," "A and C," "B and C," and "A and B and C."
[0110] In the present invention, the term "Halophiles" refers to a type of archaea that lives in a high-salinity environment. In a preferred embodiment of the present invention, the halophiles include but are not limited to the genus Halomonas. Preferably, the genus Halomonas includes but is not limited to Halomonas bluephagenesis, Halomonasaydingkolgenesis, Halomonas campaniensis, Halomonas lutescens, Halomonashydrothermalis, Halomonas sp.KM1, Halomonas elongata and Halomonas smyrnensis, and more preferably Halomonas bluephagenesis TD1.0, Halomonas bluephagenesis TD01 (culture collection number CGMCC No.4353), Halomonas aydingkolgenesis M1 (culture collection number CGMCC No.19880), Halomonas campaniensis LS21 (culture collection number CGMCC No.6593) (the above strains have been registered in the China General Microbiological Culture Collection Center (China General Microbiological Culture Collection Center) The invention relates to a novel 3-hydroxypropionate monoclonal antibody, a 3-hydroxypropionate monoclonal antibody, and a 3-hydroxypropionate monoclonal antibody, which has been deposited with the CGMCC under the Budapest Treaty and has been disclosed in previous patent applications. For example, CGMCC No. 4353 has been disclosed in CN102120973A, CGMCC No. 19880 has been disclosed in CN111593006A, and CGMCC No. 6593 has been disclosed in CN102925382A), Halomonas bluephagenesis TD27 (described in JIANG XR, YAN X, YU LP, et al. 2021. Hyperproduction of 3-hydroxypropionate by Halomonas bluephagenesis. Nat Commun [J], 12: 1513.), Halomonas bluephagenesis TDB141 (described in Yan X, Liu X, Yu LP, et al. 2022.Biosynthesis of diverse alpha,omega-diol-derived polyhydroxyalkanoates by engineered Halomonas bluephagenesis. Metab Eng[J], 72:275-288.”), Halomonas bluephagenesis TDB141ΔAC (described in “Lizhan Zhang et al., 2022. Effective production of Poly(3-hydroxybutyrate-co-4-hydroxybutyrate) by engineered Halomonas bluephagenesis grown on glucose and 1,4-Butanediol[J]. Bioresource Technology”), Halomonas bluephagenesis WZY254 (described in “Wang Z, Zheng Y, Ji M, et al. 2022b. Hyperproduction of PHA copolymers containing high fractions of 4-hydroxybutyrate (4HB) by outer membrane-defected Halomonas bluephagenesis grown in bioreactors. Microb Biotechnol[J], 15:1586-1597.”), Halomonas bluephagenesis WZY278 (described in “Ji M K, Zheng T R, Wang Z Y, et al. 2023. PHB production from food waste hydrolysates by harboring PHB operon linked with an essential gene. Metabolic Engineering[J], 77:12-20.”) or Halomonas bluephagenesis CYL0307 (described in “Chen Y L, Liu X, Zhang L Z, et al. 2025. Cell Sizes Matter for Industrial Bioproduction, a Case of Polyhydroxybutyrate. Advanced Science[J].”).
[0111] In the present invention, the term "overexpression" is defined as a gene expression level higher than the natural state, which may be achieved by increasing the transcription level (producing more messenger mRNA) or improving the translation efficiency (producing more functional protein). In a specific embodiment, preferably, overexpression of the exogenous gene can be achieved by inserting the target gene into a genomic non-translated site, or by plasmid overexpression. Preferably, the gene insertion adopts the CRISPR / Cas9 method (Qin et al., 2018). Preferably, the plasmid overexpression is introduced into the chassis strain by electroporation or conjugation transformation. More preferably, the plasmid vector adopts the pSEVA series vector (Martinez-Garcia et al., 2015) or the toxin antitoxin plasmid pHbPBC vector (Ren et al., 2023), etc.
[0112] In the present invention, the term "downregulating" gene expression is defined as weakening the gene expression level by gene editing methods such as "knockout" and "knockdown". In a specific embodiment, preferably, the strategy of "knockout" and "knockdown" gene expression includes CRISPR / Cas9 gene knockout or replacement of the endogenous promoter of the target gene with a weaker promoter (Qin et al., 2018), CRISPRi gene transcriptional downregulation (Tao et al., 2017), sRNA gene translation inhibition (Wang et al., 2022a), and targeted regulation of protein degradation (Chen et al., 2025) can also inhibit gene function.
[0113] In the present invention, the term "metabolic pathway comprising the production of P34HB" refers to a biochemical reaction system comprising the synthesis of monomer 3HB, the synthesis of monomer 4HB, and the synthesis of P34HB from 3HB and 4HB. Figure 1 .
[0114] In the present invention, the term "toxin-antitoxin system" (i.e., Toxin-Antitoxin, TA system) refers to a system that can maintain the stability of the plasmid by post-segregation lethal effect (PSK, Postsegregational killing). In a preferred embodiment, the recombinant microorganism of the present invention contains a suitable toxin-antitoxin system / plasmid, so that the plasmid can be stably maintained naturally (i.e., in the absence of selective pressure such as antibiotics). Eight types of TA systems are known, and the TA system - hok / sok system has been widely used in industrial fermentation to stabilize the plasmid pMJR1750 (Lin et al., EngineeringMicrobiology 3 (2023) 100069). WO1999025870 discloses a plasmid pMUT2 containing a TA system that is stably maintained in Escherichia coli. Chinese Patent Application No. 2023112420281, entitled “A Recombinant Plasmid Expressing Toxins and Antitoxins, and Its Construction Method and Application” discloses a TA system derived from a halophilic microorganism and a recombinant plasmid comprising the TA system, and discloses that the recombinant plasmid comprising the TA system can be naturally and stably maintained in halophilic microorganisms and the like. A typical TA system includes the following gene families: ccdAB, mazEF, vapBC, phdd / doc, parDE, higBA, and relBE (Gerdes K et al., Toxin-antitoxin loci are highly abundant in free-living but lost from host-associated prokaryotes, Nucleic Acids Res., 2005, 33(3): 966-976). In one embodiment, the host cell is a prokaryotic microorganism or a eukaryotic microbial cell, and the toxin-antitoxin is a TA system suitable for prokaryotic microorganisms or eukaryotic microbial cells. In one embodiment, the microorganism is a Gram-negative bacterium or a Gram-positive bacterium. In a preferred embodiment, the recombinant microorganism of the present invention is Halomonas, and / or the toxin-antitoxin system plasmid used therein is pHbPBC (Ren K, Zhao YQ, Chen GQ, et al. 2023. Construction of aStable Expression System Based on the Endogenous hbpB / hbpC Toxin-AntitoxinSystem of Halomonas bluephagenesis. Acs Synthetic Biology[J], 13: 61-67).
[0115] The present invention may be based on the following inventive concepts:
[0116] Using Halomonas as the starting strain, the preparation of PHA copolymers with a high proportion of 4HB is achieved by overexpressing 4-hydroxybutyryl-CoA transferase and PHA polymerase; further, by using toxin antitoxin plasmids to construct exogenous genes, the expression of related genes is further increased to prepare PHA copolymers with a higher proportion of 4HB; the 4HB proportion can also be further increased by knocking out the outer membrane gene to facilitate the absorption of carbon sources and precursors; the expression of endogenous 3HB pathway genes in recombinant Halomonas can also be reduced; the metabolic bypass genes of the intermediate products of the 4HB synthesis pathway can also be reduced or knocked out, and the PHA particle binding protein can be overexpressed to increase the 4HB proportion.
[0117] Based on the above modifications to increase the 4HB ratio, further modifications can be implemented to facilitate the use of low-4HB-related structural precursors and the addition of no-4HB-related precursors; or to broaden the types of precursors used by inserting corresponding genomes, including the following:
[0118] 1. Insert the full sugar pathway gene sucD-4hbD-ogd to achieve the preparation of P34HB without adding related 4HB precursors.
[0119] 2. Introduce amino acid metabolic pathway genes to expand the types of precursors that can be used by the above strains to efficiently synthesize 4HB;
[0120] Based on the above-mentioned transformation to increase the 4HB ratio, further transformations that are conducive to industrial scale-up and production can be implemented, including:
[0121] Morphological engineering can be performed on the recombinant strain to reduce downstream extraction and processing costs in industrial production; or the fermentation process can be optimized to use the recombinant strain to efficiently produce high-proportion 4HB copolymers in industrial scale-up production.
[0122] The overexpression of 4-hydroxybutyryl-CoA transferase and PHA polymerase comprises inserting exogenous phaC and orfZ at multiple sites in the genome of Halomonas sp. More preferably, the exogenous phaC is phaC Cn .
[0123] Overexpression of the exogenous gene can be achieved through gene insertion or plasmid overexpression. Preferably, gene insertion utilizes the CRISPR / Cas9 method (Qin et al., 2018). Preferably, the plasmid overexpression is introduced into the chassis strain via electroporation or conjugation with Escherichia coli S17-1. More preferably, the plasmid vector is selected from the pSEVA series of vectors (Martinez-Garcia et al., 2015), the toxin-resistant plasmid pHbPBC (Ren et al., 2023), and the like.
[0124] The PHA polymerase gene and 4-hydroxybutyryl-CoA transferase gene are expressed under the control of a constitutive or inducible promoter. Preferably, the gene sequence is preceded by an optimal ribosome binding site (RBS) to regulate translation strength. Preferably, the inducible promoter is selected from the IPTG-inducible Mmp1 promoter, the lux promoter, the lac promoter, the trp promoter, the tac promoter, the hypoxia-inducible promoter, the bacterial quorum sensing-inducible promoter, or the temperature-sensitive promoter. More preferably, the constitutive promoter is selected from the wild-type porin gene promoter or a mutant thereof (Shen et al., 2018), the wild-type phaP1 gene promoter (Zheng et al., 2024), or an essential gene promoter (Ji et al., 2023).
[0125] The phaC may be derived from phaC of Cupriavidus necator Cn gene, or phaC of Burkholderiacontaminans Kad1 Bc gene and phaC of Burkholderia sp.USM (JCM15050) Bs The overexpressed 4-hydroxybutyryl-CoA transferase gene may be the orfZ gene from Clostridium klyveri, the abfT gene from Clostridium aminobutyricum, the cat gene from Cupriavidus necator Cn Gene, cat from Nitrosopumilus maritimus Nm Gene; phaC in the embodiment Bc , phaC Bs 、abfT、cat Nm The nucleotide sequence of the phaC Cn 、cat Cn , orfZ is a wild-type gene; further preferably, the PHA polymerase gene and 4-hydroxybutyryl-CoA transferase gene of the above different species can be expressed as a chimera, for example, constructing phaC Cn Protein N-terminus and phaC Bc Combinatorial expression of protein C-terminal sequence truncations.
[0126] The method of broadening the range of precursors available to the recombinant strain includes inserting constitutively expressed endogenous alcohol dehydrogenase genes adhP and aldehyde dehydrogenase genes aldD into the genome. The recombinant strain after the above modification can convert diol substrates into hydroxy acids and further convert them into P34HB; more preferably, the addition of 1,4-butanediol substrate can increase the molar ratio of 4HB in the copolymer.
[0127] The method further improves the expression level of related genes by constructing exogenous genes using toxin-resistant plasmids, including introducing the toxin-resistant plasmid pHbPBC vector into a chassis strain with endogenous plasmids knocked out to overexpress the 4-hydroxybutyrate dehydrogenase gene 4hbD from Clostridium klyveri, the succinate semialdehyde dehydrogenase gene sucD from Clostridium klyveri, and the α-ketoglutarate decarboxylase gene ogdA from Synechococcus sp., thereby achieving efficient synthesis of high-ratio 4HB copolymers using glucose as the sole carbon source, and maintaining stable expression of the plasmid without the need to add additional antibiotics during scaled-up fermentation production.
[0128] Strategies for downregulating gene expression include CRISPR / Cas9 gene knockout or replacement of the endogenous promoter of the target gene with a weaker promoter (Qin et al., 2018), CRISPRi gene transcriptional downregulation (Tao et al., 2017), and sRNA gene translation inhibition (Wang et al., 2022a). More preferably, gene function can also be inhibited by targeted regulation of protein degradation (Chen et al., 2025).
[0129] The insertion of the full sugar pathway gene sucD-4hbD-ogd is to use glucose as the sole carbon source to synthesize a copolymer containing a high proportion of 4HB. Preferably, the expression of the endogenous succinate semialdehyde dehydrogenase gene in the recombinant Halomonas is downregulated by gene editing. Specifically, the five orthologous succinate semialdehyde dehydrogenase gabD coding regions on the recombinant Halomonas genome are knocked out.
[0130] The reduction of the expression of endogenous 3HB pathway genes in the recombinant Halomonas includes reducing one or more combinations of endogenous PHA polymerase (phaC), β-ketothiolase gene (phaA), or acetoacetyl-CoA reductase gene (phaB). More preferably, by inserting a protein degradation tag before the gene stop codon, the expression levels of endogenous PHA polymerase PhaC protein, β-ketothiolase PhaA, and acetoacetyl-CoA reductase PhaB protein can be downregulated in the late stage of bacterial growth.
[0131] The reduction or knockout of metabolic bypass genes of intermediates in the 4HB synthesis pathway includes reducing or knocking out the expression of one or more metabolic bypass genes other than the 4HB synthesis pathway to reduce the loss of intermediate metabolites or their conversion into 3-hydroxybutyrate; specifically, the succinate hemiacetal dehydrogenase gene, succinate dehydrogenase gene, succinyl-CoA synthetase gene, enoyl-CoA hydratase gene (fadB), 2,3-dehydroadipyl-CoA dehydratase gene (paaF), enoyl-CoA hydratase gene (paaG), 3-hydroxybutyryl-CoA dehydrogenase gene (3hbD), etc. are down-regulated through gene editing.
[0132] In a specific embodiment, the present invention further comprises knocking out the 3-hydroxypropionate dehydrogenase gene dddA.
[0133] The overexpression of PHA particle binding proteins, including overexpression of endogenous or exogenous PHA particle surface proteins, can increase the proportion of 4HB in the copolymer and the yield of the total copolymer; preferably, the endogenous PHA particle binding proteins PhaP1, PhaP2, PhaP3 of Halomonas bluephagenesis and the PHA particle regulatory protein PhaR are overexpressed individually or simultaneously; preferably, the exogenous PHA particle surface proteins are derived from PhaR and multiple orthologous PhaPs of the natural scl-PHA producing bacterium Cupriavidus necator; preferably, the exogenous PHA particle surface proteins are derived from PhaI of the mcl-PHA producing bacterium Pseudomonas putida. Pp and PhaF Pp , PhaI from Pseudomonas oleovorans Po and PhaF Po More preferably, the PHA granule proteins from the same species can be overexpressed individually or simultaneously (eg, PhaP1 and PhaR of H. bluephagenesis are co-expressed, and PhaI and PhaF of Pseudomonas putida are co-expressed).
[0134] The expansion of precursor utilization types includes the introduction of amino acid metabolic pathway genes, including overexpression of host endogenous or exogenous α-ketoglutarate transaminase, glutamate decarboxylase, γ-aminobutyrate transaminase, glutamate-succinate semialdehyde transaminase, and glutamate dehydrogenase genes in the Halomonas bacteria, and the introduction of metabolic pathway genes that degrade amino acids (including but not limited to arginine, glutamine, proline, etc.) into γ-aminobutyric acid. More preferably, one or more of the above amino acid precursors can be added to increase the proportion of 4HB in the copolymer. γ-Aminobutyric acid can be used as a bio-based precursor with a similar structure to 4HB. γ-Aminobutyric acid is converted to succinic semialdehyde under the catalysis of γ-aminobutyric acid aminotransferase, and then 4HB is generated under the catalysis of succinic semialdehyde dehydrogenase.
[0135] The expanded precursor utilization types also include the insertion of P porin -adhP-aldD gene cluster.
[0136] The knockout of outer membrane genes, including the knockout of the outer membrane PS4 gene cluster, can increase the permeability of the outer membrane, facilitate the diffusion of substrates into cells, and increase the 4HB ratio. At the same time, it can also enable the strain to acquire the characteristics of self-flocculation, reduce the time of centrifugation separation, and greatly save the downstream separation and extraction costs of industrial scale-up production (Park et al., 2024).
[0137] The recombinant strain was morphologically engineered, including to increase the cell volume, further increasing copolymer production and facilitating downstream processing for centrifugal separation of cells and culture supernatant (Chen et al., 2025).
[0138] The recombinant strains obtained by one or more strain construction methods of the present invention, combined with one or more preferred fermentation strategies, can have a 4HB ratio of 20% to 60%, for example, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60%.
[0139] Therefore, in one embodiment, the present invention relates to a recombinant microorganism comprising a metabolic pathway for producing the synthesis of poly(3-hydroxybutyrate-4-hydroxybutyrate) (P34HB), characterized in that 4-hydroxybutyrate copolymers of various molar ratios can be efficiently synthesized, preferably, the 4HB molar ratio can reach 15%, 20%, 30%, 40%, 50% and above.
[0140] In a preferred embodiment, the chassis microorganism is of the genus Halomonas, preferably Halomonas bluephagenesis, Halomonas campaniensis, Halomonas campaniensis, Halomonas aydingkolgenesis, H.hydrothermalis, Halomonas sp.KM1, Halomonaselongata and Halomonas smyrnensis and their derivatives.
[0141] In a preferred embodiment, the genetic engineering modification of the recombinant microorganism comprises overexpressing exogenous 4-hydroxybutyryl-CoA transferase and PHA polymerase genes (phaC), and simultaneously deleting multiple endogenous succinate semialdehyde dehydrogenase genes (gabD) in the recombinant strain.
[0142] In a preferred embodiment, the recombinant microbial genome is inserted with the constitutively expressed alcohol dehydrogenase gene adhP and aldehyde dehydrogenase gene aldD.
[0143] In a preferred embodiment, the recombinant microorganism introduces the 4-hydroxybutyrate dehydrogenase gene (4hbD), succinate semialdehyde dehydrogenase gene (sucD), and α-ketoglutarate decarboxylase gene (ogdA) through a toxin-antitoxin system plasmid (pHbPBC), so that stable expression can be maintained in the bacteria without the need to add antibiotics during the culture process.
[0144] In a preferred embodiment, the recombinant microorganism utilizes morphological engineering and outer membrane knockout modification to obtain characteristics such as increased cell volume, increased outer membrane permeability, and cell self-flocculation, further increasing copolymer production and facilitating downstream separation and extraction for industrial scale-up production.
[0145] In a preferred embodiment, the recombinant microorganism overexpresses exogenous 4-hydroxybutyryl-CoA transferase using one or more methods of genomic insertion, pSEVA plasmid or toxin-antitoxin plasmid vector, including but not limited to 4-hydroxybutyryl-CoA transferase (orfZ) from Clostridium klyveri, 4-hydroxybutyryl-CoA transferase (abfT) from Clostridium aminobutyricum, 4-hydroxybutyryl-CoA transferase (catfT) from Cupriavidus necator, Cn ), 4-hydroxybutyryl-CoA transferase from Nitrosopumilus maritimus (cat Nm) can further increase the content of 4HB in the copolymer.
[0146] In a preferred embodiment, the recombinant microorganism overexpresses exogenous PHA polymerase (PhaC), including but not limited to phaC from Cupriavidus necator, by one or more methods including genome insertion, pSEVA plasmid or toxin-antitoxin plasmid vector. Cn gene, phaC from Burkholderia contaminans Kad1 Bc gene and phaC from Burkholderia sp.USM (JCM15050) Bs , to increase the content of 4HB in the copolymer or the molecular weight of the copolymer.
[0147] In a preferred embodiment, the recombinant microorganism uses strategies such as gene knockout, gene knockdown, endogenous promoter replacement, and protein degradation tag insertion to weaken the expression intensity of one or more endogenous 3HB synthesis pathway genes, including PHA polymerase phaC, β-ketothiolase gene phaA, and acetoacetyl-CoA reductase gene phaB, thereby further increasing the 4HB ratio in the copolymer.
[0148] In a preferred embodiment, the gene overexpressed by the recombinant microorganism is expressed under a constitutive porin (porin gene) promoter or phaP1 (PHA particle binding protein) promoter or an inducible promoter of different expression strengths, preferably, the expression of 4-hydroxybutyryl-CoA transferase gene (orfZ), PHA polymerase gene (phaC Cn ), alcohol dehydrogenase gene (adhP), aldehyde dehydrogenase gene (aldD), 4-hydroxybutyrate dehydrogenase gene (4hbD), succinate semialdehyde dehydrogenase gene (sucD), and α-ketoglutarate decarboxylase gene (ogdA), which can increase the component ratio of 4HB in poly (3-hydroxybutyrate-4-hydroxybutyrate) copolymer, including but not limited to.
[0149] In a preferred embodiment, the recombinant microorganism reduces the expression of one or more potential endogenous metabolic bypass genes, including but not limited to succinate hemiacetal dehydrogenase, succinate dehydrogenase, succinyl-CoA synthetase, enoyl-CoA hydratase (fadB), 2,3-dehydroadipyl-CoA dehydratase (paaF), enoyl-CoA hydratase (paaG), 3-hydroxybutyryl-CoA dehydrogenase (3hbD), etc. In addition, overexpression of endogenous or exogenous PHA particle surface proteins can increase the proportion of 4HB in the copolymer and the total yield of the total copolymer.
[0150] In a preferred embodiment, the recombinant microorganism overexpresses host endogenous or exogenous genes encoding α-ketoglutarate transaminase (gdhA), glutamate decarboxylase (gadB), γ-aminobutyrate transaminase (gabT), glutamate-succinate semialdehyde transaminase (gadA) and glutamate dehydrogenase (gdhA), and introduces metabolic pathway genes (including speA, speB, pat, prr, gltBD, putA) that degrade amino acids (including but not limited to arginine, glutamine, proline, etc.) into γ-aminobutyric acid. Preferably, one or more of the above amino acid precursors can be added to increase the proportion of 4HB in the copolymer.
[0151] In a preferred embodiment, a method for producing copolyester using the recombinant microorganism is provided, which is an open fermentation; preferably, the culture medium does not need to be sterilized; preferably, the nitrogen source of the fermentation culture medium is urea, yeast extract, corn steep liquor waste, or wool hydrolyzate, etc.; preferably, glucose can be used as the sole carbon source to synthesize poly(3-hydroxybutyric acid-4-hydroxybutyric acid); 4HB structure-related precursors 1,4-butanediol, γ-butyrolactone, sodium 4-hydroxybutyrate, etc., or 4HB structure-unrelated precursors, including but not limited to sodium acetate, α-ketoglutaric acid, citric acid, γ-aminobutyric acid, glutamic acid, glutamine, proline, arginine, etc., can be added to achieve a controllable increase in the proportion of 4-hydroxybutyric acid monomers in the copolymer synthesized by the recombinant bacteria.
[0152] The following examples are intended to aid understanding of the present invention but should not be construed as limiting the present invention. Unless otherwise noted, all experimental methods are routine molecular biology and microbiology experiments, performed according to standard procedures. Experimental materials are all conventional biochemical reagents. All quantitative experiments were repeated three times, and the results were averaged.
[0153] Some chemical reagent information is as follows:
[0154] Standards:
[0155] Poly (3-hydroxybutyrate) (Sigma-Aldrich, USA, Catalog No.: BCBQ3366V)
[0156] γ-Butyrolactone (TCI, Japan, Product No.: B0767)
[0157] Culture medium formula:
[0158] LB medium: containing 10 g / L NaCl, 10 g / L peptone (OXIOD, LP0042), and 5 g / L yeast extract (OXIOD, LP0021), add water to the volume, and sterilize by autoclaving at 120°C.
[0159] LB20 medium: contains 20 g / L NaCl, and the rest of the ingredients are the same as LB medium.
[0160] LB60 medium: contains 60 g / L NaCl, and the rest of the ingredients are the same as LB medium.
[0161] MM60 medium (pH 8.0-8.5): Contains 60 g / L NaCl, 1 g / L yeast extract, 0.5 g / L urea, 0.2 g / L MgSO4; 9.65 g / L Na2HPO4·12H2O, 1.5 g / L KH2PO4 (preferably 14 g / L K2HPO4·3H2O, 5.2% KH2PO4 for stronger buffering). Trace element solution I and trace element solution II are added at a volume ratio of 1:100 and 1:1000, respectively. Trace element solution I contains 5 g / L ammonium ferric citrate and 2 g / L CaCl2 (prepared in 1 M HCl). Trace element solution II contains 100 mg / L ZnSO4·7H2O, 30 mg / L MnCl2·4H2O, 300 mg / L H3BO3, 200 mg / L CoCl2·6H2O, 10 mg / L CuSO4·5H2O, 20 mg / L NiCl2·6H2O, and 30 mg / L NaMoO4·2H2O (prepared in 1M HCl). Preferably, the final pH is adjusted to 8.5 with 5M NaOH solution. All reagents were purchased from the reagent purchasing platform of Tsinghua University, preferably from Sinopharm Chemical Reagent Company.
[0162] Preparation of solid culture medium: Add 1.5-2.0% agar to liquid culture medium, sterilize and cool to 60℃, add antibiotics as needed, mix well and pour into plates.
[0163] The stock concentrations and solvents for the antibiotics were as follows: chloramphenicol (25 mg / ml) in anhydrous ethanol, kanamycin (50 mg / ml) in double-distilled water, and spectinomycin (100 mg / ml) in double-distilled water. All antibiotic stock solutions were stored at a concentration of 1000× in a dark place and at low temperature.
[0164] Conjugative transformation method: Electroporate or chemically transform the target plasmid into E. coli S17-1 (λpir). Grow the donor E. coli S17-1 overnight in LB medium; grow the recipient Halomonas bacteria overnight in LB60 medium. Transfer 2% of the donor and recipient bacteria to 20 ml of culture medium and incubate for 4-6 hours. Remove 1 ml of each suspension by centrifugation, remove the supernatant, resuspend in antibiotic-free LB20, and spread on antibiotic-free LB20 plates. Incubate at 37°C for 6-8 hours. Scrape the bacterial lawn, resuspend, and spread on antibiotic-containing plates. Incubate at 37°C for 24-48 hours. Screen for positive clones for subsequent manipulations.
[0165] Seed solution preparation: Inoculate a glycerol tube stored at -80°C onto an LB60 plate and incubate at 37°C for 24 hours. Pick a single colony and inoculate it into 20 mL of liquid LB60. Incubate at 37°C, 200 rpm for 24 hours to prepare the primary seed solution. Transfer a 1% inoculum to 20 mL of liquid LB60 and incubate at 37°C, 200 rpm for 8-10 hours to prepare the secondary seed solution for subsequent shake flask or fermentation experiments.
[0166] Shake flask experiment:
[0167] 1. Seed solution: Prepare according to the above method.
[0168] 2. Shake flask medium: MM60, supplemented with 30 g / L and 35 g / L glucose as needed, 5 g / L and 10 g / L γ-butyrolactone as needed, and 5 g / L and 10 g / L 1,4-butyrolactone as needed.
[0169] 3. Shake flask sample processing: After 48 hours, collect 40 ml of culture medium and centrifuge at 10,000 g for 10 minutes to harvest the cells. Wash with water and then centrifuge again to harvest the cells. Prefreeze the cells at -80°C for 1 hour and freeze-dry them under vacuum for 12 hours. Calculate cell dry weight: CDW (g / L) = (weight of the centrifuge tube after lyophilization – weight of the empty tube) ÷ 0.04.
[0170] 4. PHA Content Assay: 30-40 mg of lyophilized product was added to 2 mL of chloroform and 2 mL of esterification solution (containing 1 g / L benzoic acid as an internal reference and 3% concentrated sulfuric acid in methanol) and reacted at 100°C for 4 h. After cooling, 1 mL of water was added, and the chloroform phase was analyzed by GC. Standards P3HB and γ-butyrolactone were esterified using the same method as above and used as controls. Gas chromatography was performed using a Shimadzu GC-2014 HP-5 column. The GC program was set as follows: 80°C for 1.5 min, then heated at 30°C / min to 140°C; then heated at 40°C / min to 140°C and held for 2 min; the inlet temperature was 240°C; and the detector temperature was 250°C. Using the internal standard method, a standard curve is drawn by comparing the actual mass of the standard with the ratio of the methyl ester peak area to the benzoic acid peak area of the PHA monomer standard sample measured by gas chromatography. The ratio of the measured sample methyl ester peak area to the internal standard peak area is substituted into the standard curve to determine the actual mass of the PHA monomer.
[0171] 5. Calculate PHA content:
[0172] PHA content (wt%) = (mass of 3HB + 4HB) ÷ mass of freeze-dried product × 100%
[0173] 4HB content (mol%) = 4HB moles ÷ total moles × 100%
[0174] Fermentation experiment:
[0175] 1. Seed solution: Prepare according to the above method.
[0176] 2. Fermentation medium: The base feed contained 60 g / L NaCl, 20 g / L glucose monohydrate, 3.5 g / L yeast extract, 4 g / L urea, 0.2 g / L MgSO4, 6.8 g / L Na2HPO4·12H2O, and 3.3 g / L K2HPO4, with trace element solution I added at a volume ratio of 1:100 and trace element solution II added at a volume ratio of 1:1000; feed I was a 250 ml solution containing 30.4 g / L urea, 3.16 g / L K2HPO4, 4.24 g / L Na2HPO4·12H2O, and 560 g / L glucose monohydrate; feed II was a 250 ml solution containing 30.4 g / L urea and 560 g / L glucose monohydrate; feed III was 800 g / L glucose monohydrate.
[0177] 3. Fermentation conditions: Secondary seeds were inoculated at 10% to a 7 L fermentor (initial volume 3 L) and fermented at 37°C. Dissolved oxygen was controlled at 30% ± 5% by combining agitation speed (200-800 rpm) and aeration (maximum 3.0 vvm). Feed I was added when the residual sugar in the base material decreased to approximately 10 g / L. After the addition of 250 ml of feed I, feed II was switched. Feed II was added until the OD value reached 0. 600 When the pH reaches approximately 150, feed III is switched. The feed flow rate is adjusted to maintain a sugar concentration of 10-15 g / L. The pH is adjusted to 8.5 by supplementing with 5 M NaOH or 30% acetic acid. Parameters are monitored in real time. Small samples (1 ml) are taken every 2 hours to measure OD and residual glucose content, and large samples (30 ml) are taken every 4 hours to determine PHA content.
[0178] 4. Post-fermentation sample processing: Centrifuge 40 ml of culture medium at 10,000 g for 10 minutes to harvest the cells. Wash with water by shaking, then centrifuge again to harvest the cells. Prefreeze the cells at -80°C for 30 minutes and freeze-dry them under vacuum for 12–24 hours. Calculate cell dry weight: CDW (g / L) = (weight of the centrifuge tube after freeze-drying – weight of the empty tube) ÷ 0.04.
[0179] 5. The detection and calculation of PHA content are the same as those described in the shake flask experiment above.
[0180] 6. Soxhlet extraction of PHA material: Grind the freeze-dried bacterial sample into a powder, weigh 3-5g of the sample and place it in a filter paper tube, then cover it with absorbent cotton. Add an appropriate amount of chloroform to the extraction bottle, place the filter paper tube containing the sample into a Soxhlet extractor (Soxtec 2050, Foss, Denmark), and run the Soxhlet extraction program: 110°C for 3 hours, rinse for 2 hours, and recover for 1 hour. After the program is completed, dissolve the product in no more than 50ml of chloroform and stir for 30 minutes. After filtering through gauze, add 6-8 times the volume of anhydrous ethanol and stir to precipitate for 30 minutes. Centrifuge the above turbid solution at 1000rpm for 10 minutes, and air-dry the precipitate to obtain the PHA material.
[0181] The recombinant Halomonas bluephagenesis TD27 (Jiang et al., 2021) used in the examples is a strain obtained by transforming Halomonas bluephagenesis TD01 (reference: JIANG XR, YAN X, YU LP, et al. 2021. Hyperproduction of 3-hydroxypropionate by Halomonas bluephagenesis. Nat Commun [J], 12: 1513.) The recombinant Halomonas bluephagenesis TD141 (Yan et al., 2022) used in the examples is a strain obtained by transforming Halomonas bluephagenesis TD01 (reference: YAN X, LIU X, YU LP, et al. 2022. Biosynthesis of diverse alpha, omegadiold derived polyhydroxyalkanoates by engineered Halomonas bluephagenesis. Metab Eng [J], 72: 275288.). The above-mentioned strain is a moderately halophilic bacterium, with an optimal growth salt concentration of 30-60 g / L and an optimal pH of 8-9.
[0182] The gene editing method used in the embodiment is the CRISPR-Cas9 method, see the document CRISPR / Cas9 editing genome of extremophile Halomonas spp. [J]. Metabolic Engineering, 2018, 47: 219-229. (Qin Q et al. 2018).
[0183] Table 1. Chinese and English correspondence of important English abbreviations
[0184]
[0185]
[0186]
[0187] Example 1: Overexpression of 4-hydroxybutyryl-CoA transferase and PHA polymerase by pSEVA321 plasmid
[0188] The recombinant Halomonas TD27 was used as the starting strain (the 3-hydroxypropionate dehydrogenase gene dddA was knocked out and P was inserted at the G4 site). porin -adhP-aldD gene cluster, recorded in JIANG XR, YAN X, YU LP, et al. 2021. Hyperproduction of 3-hydroxypropionate by Halomonas blue phagenesis. Nat Commun [J], 12: 1513.), and introduced the pSEVA321 plasmid carrying a combination of 4-hydroxybutyryl-CoA transferase and PHA polymerase from different species by conjugation transformation (pSEVA321 plasmid is recorded in the following document: "Qin Qin, Ling Chen, Zhao Yiqing, Yang Tian, Yin Jin, Guo Yingying, Chen GQ. CRISPR / Cas9 editing genome of extremophile Halomonas spp. Metabolic Engineering 47 (2018) 219-229") to screen out the enzyme combination that is most suitable for the production of high-ratio 4HB copolymers in Halomonas strains.
[0189] Including phaC from Cupriavidus necator Cn gene (SEQ ID No. 1), or phaC from Burkholderia contaminans Kad1 Bc gene (SEQ ID No. 2) or phaC from Burkholderia sp. USM (JCM15050) Bs gene (SEQ ID No.3), respectively, and orfZ (SEQ ID No.5) were combined and overexpressed by pSEVA321 plasmid under the drive of wild-type porin promoter (SEQ ID No.4) Figure 2The TD27 strain was introduced with the three plasmids mentioned above. In shake flask experiments, MM60 medium was supplemented with 35 g / L glucose as a carbon source and 10 g / L 1,4-butanediol as a precursor. Fermentation conditions were 37°C and 200 rpm. After 48 hours of fermentation, cell samples from each group were collected for subsequent freeze-drying, esterification, and gas chromatography analysis. The cell dry weight and the proportion of PHA in the dry weight of different combinations, as well as the molar ratio of 4HB in PHA monomers ( Figure 3 There was no significant difference in the proportion of 4HB synthesized by the three PHA polymerases, which were 29.5%, 31.2%, and 31.5%, respectively. Cn PHA production is the largest, so phaC is selected Cn Proceed to the next step of combination.
[0190] orfZ gene from Clostridium klyveri (SEQ ID No. 5), abfT gene from Clostridium aminobutyricum (SEQ ID No. 6), cat from Cupriavidus necator Cn gene (SEQID No.7), and cat from the archaeon Nitrosopumilus maritimus Nm gene (SEQ ID No.8), respectively with phaC Cn (SEQ ID No.1) was overexpressed on the pSEVA321 plasmid driven by the wild-type porin promoter (SEQ ID No.4) Figure 4 The TD27 strain was introduced with the above four plasmids respectively. In the shake flask experiment, MM60 medium was supplemented with 35g / L glucose as a carbon source and 10g / L 1,4-butanediol as a precursor. The fermentation conditions were 37°C and 200rpm. After 48h of fermentation, the bacterial samples of each group were collected for subsequent freeze-drying, esterification and gas chromatography detection. The results showed that orfZ, abfT, cat Nm All of them can synthesize 4HB with a molar ratio of more than 40%, among which the molar ratio of 4HB in the copolymer synthesized by orfZ is the highest (44.7%), followed by the molar ratio of 4HB in the copolymer synthesized by abfT (44.5%), and cat Cn The effect is poor, and only 25% molar ratio of 4HB ( Figure 5 ). Based on the above results, the optimal phaC is finally selected. Cn Combined with orfZ.
[0191] Example 2: Genomic overexpression of 4-hydroxybutyryl-CoA transferase orfZ and PHA polymerase phaC Cn
[0192] Recombinant Halomonas TD141 was based on TD27 and integrated with the wild-type porin promoter-driven phaC at the G49 site of the genome. cn -orfZ, phaC driven by the wild-type porin promoter was integrated into genomes G57, G58, G61, GY5, and GY6. Cn The wild-type porin promoter-driven orfZ was integrated into the G43, G51, and GY4 genomic loci, the porin58 promoter-driven orfZ was integrated into the G52 and GY2 genomic loci, and the porin68 promoter-driven orfZ was integrated into the G7 genomic locus (reference: YAN X, LIU X, YU LP, et al. 2022. Biosynthesis of diverse alpha, omega diolderived polyhydroxyalkanoates by engineered Halomonas bluephagenesis. Metab Eng [J], 72: 275-288). Based on the TD141 strain, five orthologous gabD1-5 genes (sequences shown in SEQ ID Nos. 44-48, respectively) were knocked out and named TD163. This strain is conducive to the synthesis of P34HB using glucose as a carbon source. The gRNA sequences used to knock out gadD1-5 are as follows: gabD1 gRNA: gaccacgctcactaagcgct; gabD2 gRNA: gcggtcactaaccctgcaaa; gabD3 gRNA: acaacgatgcagtacccaccc; gabD4 gRNA: acaacgcgatgcttgtcttg; gabD5 gRNA: aacagagcgcgctattgatg.
[0193] In a shake flask experiment, the TD163 strain was cultured in MM60 medium supplemented with 35 g / L glucose as a carbon source. The fermentation conditions were 37°C and 200 rpm. After 48 hours of fermentation, cell samples from each group were collected for subsequent freeze-drying, esterification, and gas chromatography. The results showed that the dry weight of TD163 cells was 9.3 g / L, the PHB content was 80.2%, and it did not contain 4HB monomers. Without the introduction of the metabolic pathway for synthesizing 4HB from glucose, TD163 cannot use glucose as the sole carbon source to synthesize P34HB.
[0194] In a shake flask experiment, the TD163 strain used MM60 medium supplemented with 35 g / L glucose as a carbon source and 10 g / L 1,4-butanediol as a precursor. The fermentation conditions were 37°C and 200 rpm. After 48 hours of fermentation, each group of bacterial samples were collected for subsequent freeze-drying, esterification and gas chromatography detection. The results showed that the dry weight of TD163 cells was 8.1 g / L, the PHA content was 76.2%, and the 4HB molar ratio was 36.3%.
[0195] Table 2. Shake flask fermentation results of TD163 strain producing PHB and P34HB
[0196] Glucose (g / L) 1,4-Butanediol (g / L) CDW(g / L) PHA (wt%) 4HB (mol%) 35 0 9.3 80.2 0 35 10 8.1 76.2 36.3
[0197] Example 3: Toxin-antitoxin system plasmid overexpressing phaC Cn and orfZ to further enhance PHA production and 4HB ratio.
[0198] To further improve phaC Cn In order to control the expression of orfZ, a TD163 strain (named TD163LCP) was constructed by knocking out the endogenous plasmid (for the knockout method, please refer to the article: Ren K, Zhao YQ, Chen GQ, et al. 2023. Construction of a Stable Expression System Based on the Endogenous hbpB / hbpC Toxin-Antitoxin System of Halomonas blue phagenesis. Acs Synthetic Biology[J], 13: 61-67.). On this basis, the toxin-antitoxin system plasmid pHbPBC was used to simultaneously overexpress phaC in the TD163LCP strain. Cn and orfZ (SEQ ID No.9: pW01 plasmid sequence), or overexpression of phaC alone Cn (SEQ ID No. 10: pW02 plasmid sequence) or orfZ (SEQ ID No. 11: pW03 plasmid sequence). The construction process of pW01-pW03 plasmids is as follows:
[0199] The backbone of the pW01-pW03 plasmids is pHbPBC (for plasmids, see Ren K, Zhao YQ, Chen GQ, et al. 2023. Construction of a Stable Expression System Based on the Endogenous hbpB / hbpC Toxin-Antitoxin System of Halomonas blue phagenesis. Acs Synthetic Biology [J], 13: 61-67.)
[0200] Plasmid pW01 was prepared by the Gibson seamless cloning method. As shown in the sequence ID No. 9 of the sequence listing, nucleotides 2573-2790 are the wild-type porin promoter, nucleotides 2791-2838 are the ribosome binding site (RBS1) sequence, and nucleotides 2839-4608 are the phaC Cn gene, nucleotides 4609-4668 are the ribosome binding site (RBS2) sequence, and nucleotides 4669-5958 are the orfZ gene.
[0201] Plasmid pW02 was prepared by the Gibson seamless cloning method. As shown in the sequence ID No. 10 of the sequence listing, nucleotides 2573-2790 are the wild-type porin promoter, nucleotides 2791-2838 are the ribosome binding site (RBS1) sequence, and nucleotides 2839-4608 are the phaC Cn Gene.
[0202] Plasmid pW03 was prepared by the Gibson seamless cloning method. As shown in SEQ ID No. 11 in the sequence listing, nucleotides 2573-2790 are the wild-type porin promoter, nucleotides 2791-2850 are the ribosome binding site (RBS2) sequence, and nucleotides 2851-4140 are the orfZ gene.
[0203] The TD163LCP strain carries pW01, pW02, and pW03 plasmids. In the shake flask experiment, MM60 medium was supplemented with 35 g / L glucose as a carbon source and 10 g / L 1,4-butanediol as a precursor. The fermentation conditions were 37 ° C and 200 rpm. After 48 hours of fermentation, each group of bacterial samples were collected for subsequent freeze-drying, esterification, and gas chromatography detection. The shake flask results showed that compared with the empty plasmid control (Empty) that does not carry any exogenous genes, the introduction of pW01, pW02, and pW03 can further increase the cell dry weight and PHA mass ratio. At the same time, overexpression of phaC Cnand orfZ, compared with overexpression of phaC alone Cn Both can increase the 4HB molar ratio to 44.7% and 44.6%, respectively. Cn The improvement of CDW and PHA mass ratio is even greater, CDW reaches 10.2g / L, and PHA content reaches 74.0% ( Figure 6 ). Therefore, this example demonstrates that multiple copies of phaC are integrated into the genome. Cn The recombinant Halomonas TD141 with orfZ still has phaC for the synthesis of copolymers with high 4HB ratio. Cn and insufficient expression of orfZ. Cn By adjusting the expression level of orfZ, the recombinant strain constructed achieved further improvement in the yield of P34HB and the molar ratio of 4HB.
[0204] Example 4: Reducing endogenous 3-hydroxybutyrate (3HB) pathway genes to increase the proportion of 4-hydroxybutyrate (4HB) in the copolymer
[0205] In the natural PHB-producing strain Halomonas, the excessive 3HB metabolic flow is one of the main factors limiting the increase in the 4HB ratio. Therefore, in this example, the endogenous 3HB metabolic pathway genes in the TD163 recombinant Halomonas were knocked out by CRISPR / Cas9 gene editing (reference: Qin Q, Ling C, Zhao Y, et al. 2018. CRISPR / Cas9 editing genome of extremophile Halomonas spp. Metab Eng [J], 47: 219-229.), including the endogenous β-ketothiolase genes phaA2 (SEQ ID No. 13), phaA3 (SEQ ID No. 14), acetoacetyl-CoA reductase gene phaB (SEQ ID No. 15), and endogenous PHA polymerase gene phaC (SEQ ID No. 16). phaA2 gRNA sequence: gcatgggcccggcactgttta; phaA3 gRNA sequence: atcgcacgtgatgccaagaa; phaB gRNA sequence: gtttgggcaggtgaactatg; phaC gRNA sequence: tgaggatttgctgtcacgga).
[0206] The knockout strains were named TD163ΔphaA2, TD163ΔphaA3, TD163ΔphaB, and TD163ΔphaC. According to the results of shake flask experiments, the phaA3 and phaB knockout strains increased the 4HB molar ratio to more than 50% compared to the original TD163 ( Figure 9 , A), indicating that phaA3 and phaB are key genes for the endogenous synthesis of 3HB-CoA, while endogenous phaC also contributes to the synthesis of 4HB-CoA and is not recommended for knockout. Knocking out phaA3 has the least effect on the mass ratio of 4HB to dry weight ( Figure 9 , B). Therefore, TD163ΔphaA3 is preferred as the chassis strain for synthesizing high-ratio 4HB copolymers.
[0207] Preferably, the method of protein targeted degradation can also be used to weaken the expression level of PhaB protein. Based on the recombinant strain TD163BG constructed in Example 6, different ssrA degradation tags (gene sequences SEQ ID Nos.49-53) were inserted before the termination codon of the phaB gene to degrade the PhaB protein at different stages of bacterial growth, thereby weakening the 3HB anabolic flux. In the results of MM60, 35 g / L glucose, 10 g / L 1,4-butanediol, and 48h shake flasks, the 4HB molar ratio of the strains that degraded PhaB was improved. Among them, the 4HB molar ratio obtained by degrading PhaB with the ssrA16 tag (SEQ ID No.53) reached a maximum of 55.7%, the PHA ratio was 40.2%, and the dry weight was 3.8 g / L, which was better than the TD163ΔphaB strain ( Figure 10 ).
[0208] Example 5: Knockout of 4HB degradation bypass gene to increase 4HB ratio
[0209] 4-Hydroxybutyryl-CoA dehydratase from Clostridium aminobutyricum catalyzes the reversible dehydration reaction between 4-hydroxybutyryl-CoA and crotonyl-CoA. Crotonyl-CoA is reversibly catalyzed by 3-hydroxybutyryl-CoA dehydratase to produce (S)-3-hydroxybutyryl-CoA. (S)-3-Hydroxybutyryl-CoA is then catalyzed by 3-hydroxybutyryl-CoA dehydrogenase to produce acetoacetyl-CoA (ZHANG J, FRIEDRICH P, PIERIK AJ, et al. 2015. Substrate-induced radical formation in 4-hydroxybutyryl coenzyme Adehydratase from Clostridium aminobutyricum. Appl Environ Microbiol[J], 81: 1071-1084.). This reaction may then be catalyzed by acetoacetyl-CoA reductase PhaB to produce 3HB-CoA. We speculate that there may be potential metabolic bypass genes in the recombinant Halomonas, and knocking out these genes can reduce the conversion of 4HB to 3HB, resulting in the loss of 4HB metabolic flux.
[0210] Sequence alignment of 3-hydroxybutyryl-CoA dehydratase (EC4.2.1.17) with endogenous proteins from Halomonas sp. TD01 revealed several genes with significant similarity: 3hbD (SEQ ID No. 17), fadB (SEQ ID No. 18), paaF (SEQ ID No. 19), and paaG (SEQ ID No. 20). Because paaF and paaG are located within the same operon in the genome, a simultaneous double knockout strategy was employed. Gene knockout was achieved using CRISPR / Cas9, with the following gRNA sequences: 3hbD gRNA sequence: gttggcgcttgcagacttgat; fadB gRNA sequence: agtgctgttgtggcagagtt; paaFG gRNA sequence: gttcgcgccgtagtgattac. The resulting knockout strains were named TD163Δ3hbD, TD163ΔfadB, and TD163ΔpaaFG, respectively. The above strains were fermented in shake flasks in MM60 with the addition of 35 g / L glucose and 5 g / L 1,4-butanediol. The results showed that the 4HB molar ratio of the copolymers synthesized by the strains with single knockout of 3hbD, fadB and double knockout of paaFG was higher than that of TD163 ( Figure 12Preferably, TD163ΔfadB can synthesize PHA containing 54.1% by mole of 4HB, and TD163ΔpaaFG can synthesize PHA containing 38.7% by mole of 4HB, which are higher than those of the original TD163 strain.
[0211] Example 6: Overexpression of PHA particle binding protein further increases cell dry weight and 4HB ratio
[0212] Since TD163 integrates multiple phaC from Cupriavidus necator Cn We speculate that PHA granule-associated proteins (phasins) from Cupriavidus necator may be related to phaC Cn Therefore, this example overexpressed a series of endogenous PhaP1 of Halomonas Halomonas sp.TD01 on the pSEVA321 plasmid. Hb (nucleotide sequence SEQ ID No.21), PhaP2 Hb (nucleotide sequence SEQ ID No. 22), PhaP3 Hb protein (nucleotide sequence SEQ ID No. 23) or PhaP1 from Cupriavidus necator Cn (nucleotide sequence SEQ ID No. 24), PhaP2 Cn (nucleotide sequence SEQ ID No. 25), PhaP3 Cn (nucleotide sequence SEQ ID No. 26), PhaP4 Cn (nucleotide sequence SEQ ID No. 27), PhaP5 Cn Protein (nucleotide sequence SEQ ID No.28). The shake flask results of the above strains in MM60 with the addition of 35g / L glucose and 10g / L 1,4-butanediol showed that compared with the empty plasmid control group (Empty), overexpression of any PhaP protein promoted the yield of P34HB and the molar ratio of 4HB in the copolymer. Among them, overexpression of PhaP1 Hb and PhaP5 Cn The improvement of 4HB ratio is the largest, reaching 49mol% and 47mol% 4HB ( Figure 13 ).
[0213] Combined with the method of using toxin antitoxin plasmid to overexpress phaC in Example 1 Cn As a result, we will phaP1 Hb and phaP5 CnThey were expressed separately on pHbPBC plasmid vectors (corresponding to plasmids pW04 (SEQ ID No.29) and pW05 (SEQID No.30)), or were expressed separately with phaC Cn The pW04-pW07 plasmids were constructed as follows:
[0214] The backbone of the pW04-pW07 plasmid is pHbPBC (for plasmids, see Ren K, Zhao YQ, Chen GQ, et al. 2023. Construction of a Stable Expression System Based on the Endogenous hbpB / hbpC Toxin-Antitoxin System of Halomonas blue phagenesis. Acs Synthetic Biology [J], 13: 61-67.)
[0215] Plasmid pW04 was prepared by the Gibson seamless cloning method, as shown in the sequence ID No. 29 of the sequence listing, nucleotides 2573-2790 are the wild-type porin promoter, nucleotides 2791-2838 are the ribosome binding site (RBS1) sequence, and nucleotides 2839-3195 are phaP1 Hb Gene.
[0216] Plasmid pW05 was prepared by the Gibson seamless cloning method. As shown in the sequence SEQ ID No. 30 in the sequence listing, nucleotides 2573-2790 are the wild-type porin promoter, nucleotides 2791-2838 are the ribosome binding site (RBS1) sequence, and nucleotides 2839-3267 are phaP5 Cn Gene.
[0217] Plasmid pW06 was prepared by the Gibson seamless cloning method. As shown in the sequence ID No. 31 of the sequence listing, nucleotides 2573-2790 are the wild-type porin promoter, nucleotides 2791-2838 are the ribosome binding site (RBS1) sequence, and nucleotides 2839-4608 are the phaC Cn gene, nucleotides 4609-4656 are the ribosome binding site (RBS1) sequence, and nucleotides 4657-5013 are phaP1 Hb Gene.
[0218] Plasmid pW07 was prepared by the Gibson seamless cloning method. As shown in the sequence ID No. 32 of the sequence listing, nucleotides 2573-2790 are the wild-type porin promoter, nucleotides 2791-2838 are the ribosome binding site (RBS1) sequence, and nucleotides 2839-4608 are the phaC Cn gene, nucleotides 4609-4656 are the ribosome binding site (RBS1) sequence, and nucleotides 4657-5085 are phaP5 Cn Gene.
[0219] The TD163LCP strain carrying the aforementioned plasmids (pW02, pW04, pW05, pW06, and pW07) was fermented in shake flasks using MM60 medium supplemented with 35 g / L glucose as a carbon source and 10 g / L 1,4-butanediol as a precursor at 37°C and 200 rpm. After 48 h of fermentation, cell samples from each group were collected for subsequent freeze-drying, esterification, and gas chromatography analysis. Co-overexpression of phaC Cn with phaP5 Cn The strain (SEQ ID No.32: pW07 plasmid) had the highest CDW to PHA mass ratio, and the 4HB molar ratio was the same as that of the strain expressing phaC alone. Cn There is almost no difference compared with the control. Specifically, the cell dry weight of the strain is 11.1 g / L, the mass ratio of P34HB reaches 77.9% of the cell dry weight, and the molar ratio of 4HB reaches 46.4% ( Figure 14 ).
[0220] Example 7: Outer membrane engineering
[0221] By engineering the outer membrane to knock out genes encoding exopolysaccharide synthesis, the researchers increased outer membrane permeability, improving the efficiency of substrate and glucose entry into the cell. This increased outer membrane hydrophobicity also led to cell self-flocculation, facilitating cell sedimentation and separation of the fermentation supernatant. Using CRISPR / Cas9, two targeting gRNAs (PS4 gRNA1 sequence: gagcagcttttaaatcggca; PS4 gRNA2 sequence: taaacattcccttccactgt) were designed at either end of the PS4 gene cluster (SEQ ID No. 12). Homology arms were located 1000 bp upstream and downstream of the knockout fragment, enabling efficient large-scale gene knockout (reference article: Xu T, Chen J, Mitra R, et al. 2022. Deficiency of exopolysaccharides and O-antigen makes Halomonas bluephagenesis self-flocculating and amenable to electrotransformation. Commun Biol [J], 5:623). Compared with TD163, the strain with the outer membrane PS4 gene cluster (SEQ ID No. 12) knocked out had a 4HB molar ratio increased from 38.2% to 44.4% ( Figure 7 At the same time, the strain TD163 with the PS4 gene cluster knocked out can achieve rapid self-flocculation within 10 minutes ( Figure 8 ), there is no need to collect bacteria by centrifugation, which is convenient for collecting bacteria in industrial production and greatly reduces the time and energy consumption cost of centrifugation.
[0222] Example 8: Morphological engineering facilitates downstream separation and extraction
[0223] In traditional industrial fermentation production, downstream separation and purification rely on energy-intensive centrifugation equipment and filtration systems to effectively separate the bacteria from the product, accounting for 30%-60% of overall production costs. Furthermore, the bacterial wastewater produced after centrifugation requires complex pretreatment before recycling, further exacerbating energy consumption and operational complexity, becoming a core technical bottleneck hindering large-scale industrial production.
[0224] Morphological engineering of the TD163 recombinant strain increases bacterial cell size, facilitating the accumulation of intracellular products. The increased weight of individual cells facilitates separation by static or low-speed centrifugation. The TD163 large-cell strain (designated TD163BG) utilizes CRISPR / Cas9 to knock out the sspB gene (sspB gRNA sequence: gttaacgccttatgtggtgg) and insert an ssrA21 degradation tag sequence before the stop codon of the cytoskeletal mreB gene. This reduces cytoskeletal protein expression in the later stages of cell growth, resulting in rounded cell morphology and increased cell size (reference article: Chen YL, Liu X, Zhang LZ, et al. 2025. Cell Sizes Matter for Industrial Bioproduction, a Case of Polyhydroxybutyrate. Advanced Science[J].). On this basis, the PHA particle morphology of TD163 and TD163BG strains was modified, and the endogenous PHA particle binding protein phaP1 gene was knocked out using the CRISPR / Cas9 method (phaP1 gRNA sequence: ctattgcccaggcacgtaca), recorded as TD163BGΔphaP1, which can reduce the number of PHA particles in the cells and increase the volume of single PHA particles. The shake flask results showed that the CDW of TD163BGΔphaP1 was significantly improved compared with TD163BG, and the PHA content reached 74.5%, which was higher than that of TD163 and TD163BG strains. The 4HB molar ratio was 37.4%, which was basically the same as TD163 and TD163BG ( Figure 7 ).
[0225] Example 9: Nuclear Magnetic Resonance Verification of the Ratio of 4HB in P34HB Copolymer
[0226] The TD163ΔphaA3 strain constructed in Example 4 was fermented for 48 h, and the obtained product was extracted by Soxhlet to obtain high-purity P34HB material. Approximately 20 mg of the sample was dissolved in deuterated chloroform and subjected to nuclear magnetic resonance (NMR) analysis using a JNM-ECA600, JEOL Ltd. 1 H and 13 C spectral analysis. The signal of 0.03% v / v tetramethylsilane (TMS) reference standard was used as a calibration reference. After NMR verification, the copolymer was obtained with a 4HB molar ratio of 48% ( Figure 11 ). Specifically, by nuclear magnetic resonance 1According to the H spectrum peak area, the molar percentage composition of the material is 52% 3HB-co-48% 4HB ( Figure 11 , A), by nuclear magnetic resonance 13 The C spectrum verified that the four CC bond connection modes of the obtained P(52%3HB-co-48%4HB) copolymer were close to 1:1:1:1, which was a random copolymer ( Figure 11 This finding also suggests that the PHA polymerase in the recombinant bacteria has no selectivity for 3HB-CoA and 4HB-CoA, and thus randomly polymerizes these two monomers into copolymers, which is also the key to limiting the proportion of 4HB in the recombinant bacteria.
[0227] Example 10: Construction of a toxin-antitoxin system to synthesize a high-proportion 4HB strain using glucose as the sole carbon source
[0228] We constructed and expressed the metabolic pathway genes 4hbD (SEQ ID No. 33), sucD (SEQ ID No. 34), and ogdA (SEQ ID No. 35), which synthesize 4HB from glucose, on the toxin-antitoxin system pHbPBC plasmid vector. Specifically, plasmid pW08 was prepared by the Gibson seamless cloning method. As shown in the sequence SEQ ID No. 36 in the sequence listing, nucleotides 2544-2725 contain the porin194 promoter and the endogenous ribosome binding site (RBS) sequence of 4hbD, nucleotides 2726-3841 contain the 4hbD gene, nucleotides 3842-3905 contain the ribosome binding site (RBS) sequence of the sucD gene, nucleotides 3906-5267 contain the sucD gene, nucleotides 5268-5294 contain the ribosome binding site (RBS) sequence of the ogdA gene, and nucleotides 5295-6932 contain the ogdA gene.
[0229] The plasmid pHbPBC-P was introduced into the TD163LCP strain with the endogenous plasmid knocked out by conjugation. porin194 -4hbD-sucD-ogdA (SEQ ID No.36: pW08 plasmid sequence), the recombinant strain named WR3 can achieve the stable expression of 4hbD-sucD-ogdA gene during fermentation without the addition of antibiotics. The WR3 strain was subjected to shake flask fermentation experiments in MM60 medium with only 35g / L glucose added and no precursors added. The results showed that the molar ratio of 4HB in the produced P34HB copolymer reached 28.6%, the cell dry weight reached 10.7g / L, and the P34HB content accounted for 76.8% of the dry weight. This is the highest 4HB molar ratio that can be achieved in the synthesis of 4HB copolymers by Halomonas using glucose as the sole carbon source ( Figure 15 , A).
[0230] The molecular weight and dispersion index (PDI) of the P34HB copolymer samples synthesized from different precursors were determined by gel permeation chromatography (GPC). Specifically, the sample was extracted with chromatographically pure chloroform, and the sample concentration after dissolution was about 2 mg / ml. The solution was filtered using a 0.22 μm nylon filter membrane to remove undissolved particles. The filtered sample was analyzed using a SHIMADZU GPC-804C column, and the mobile phase was chromatographically pure chloroform at a temperature of 40 ° C with a flow rate of 1 ml / min. The sample injection volume was 40 μl. A 1×10 4 Da,2×10 4 Da,3×10 4 Da,7×10 4 Da, 1.5×10 5 Da,3×10 5 Da,7×10 5 Da, and 1×10 6 The standard curve was generated using polystyrene with a number average molar mass of Da (Sigma-Aldrich, USA). The molecular weight test results showed that the molecular weight of P34HB synthesized with pure glucose was 3 times higher than that produced by adding 1,4-butanediol as a precursor ( Figure 15 , B), indicating that 1,4-butanediol has a negative effect on the molecular weight of microbially synthesized polymers.
[0231] By adjusting the promoter strength to regulate the expression level of the 4hbD-sucD-ogdA gene, copolymers with different 4HB ratios can be synthesized using pure glucose. In this example, plasmids driving the expression of the 4hbD-sucD-ogdA gene using the porin192 promoter (SEQ ID No. 37), porin259 promoter (SEQ ID No. 38), porin194 promoter (SEQ ID No. 39), porin68 promoter (SEQ ID No. 40), porin141 promoter (SEQ ID No. 41), porin1 promoter (SEQ ID No. 42), and phaP1 endogenous promoter (SEQ ID No. 43) were constructed on the toxin-antitoxin system and introduced into TD163LCP by conjugation. Shake flask fermentation experiments were conducted in MM60 medium supplemented with only 35g / L glucose and no other precursors. The results showed that the group without the addition of promoter elements (none) could synthesize 18mol% 4HB relying solely on the transcription element band on the plasmid, and 35mol% 4HB could be synthesized using the strongest porin1 and phaP1 promoters. As the promoter strength increases, the 4HB ratio can be controlled and adjusted within the range of 18%-35% ( Figure 16 ).
[0232] In order to further increase the ratio of 4HB monomers in the 4HB copolymer synthesized by all-sugar, porin194 -4hbD-sucD-ogdA (SEQ ID No. 36: pW08 plasmid sequence) and pHbPBC-P porin68 -4hbD-sucD-ogdA plasmid inserts a 4-hydroxybutyryl-CoA gene orfZ or abfT downstream of the ogdA gene ( Figure 17 ), the shake flask results showed that the 4HB ratio could be increased. Specifically, TD163LCP carries pHbPBC-P porin194 -4hbD-sucD-ogdA-abfT plasmid can synthesize copolymers containing 34.2 mol% 4HB monomers; TD163LCP carries pHbPBC-P porin194 -4hbD-sucD-ogdA-orfZ plasmid can synthesize copolymers containing 33.5 mol% 4HB monomers; TD163LCP carries pHbPBC-P porin68 -4hbD-sucD-ogdA-abfT plasmid can synthesize copolymers containing 35.4 mol% 4HB monomers; TD163LCP carries pHbPBC-P porin68The -4hbD-sucD-ogdA-orfZ plasmid can synthesize a copolymer containing 38.8 mol% 4HB monomer. In summary, the current production of P34HB copolymers by Halomonas holosugar can reach a maximum 4HB content of 38.8% molar ratio, although an increase in the 4HB molar ratio will result in a slight decrease in dry weight and PHA content ( Figure 18 ).
[0233] Example 11: Scaled-up fermentation to produce high-ratio 4HB copolymers using glucose as the sole carbon source
[0234] WR3 strain (TD163LCP carrying toxin-antitoxin system plasmid overexpression pW08: pHbPBC-P porin194 -4hbD-sucD-ogdA), maintaining stable plasmid gene expression in an open fermentation system without the addition of antibiotics. Fermentation in 7L, 100L, and 5000L fermentors demonstrated that this recombinant strain can synthesize 30±2 mol% 4HB copolymers using glucose as the sole carbon source without the addition of structurally related 4HB precursors (Table 3).
[0235] Table 3. P34HB production by WR3 strain using glucose as the sole carbon source in different scale fermentation tanks
[0236] scale <![CDATA[Inoculation OD 600 > <![CDATA[Lower tank OD 600 > CDW(g / L) PHA (wt%) 4HB (mol%) 7L 5.68 315 71.98 83.63 29.78 100L 4.90 301 68.61 73.66 28.59 5000L 5.77 273 70.90 61.10 29.05
[0237] The WR3 strain was grown in a 7L fermenter with 3.5g / L yeast extract added to the fermentation medium and glucose as the sole carbon source. 600 It reached more than 300 in 36 hours, and after 48 hours of fermentation, 71.98 g / L CDW containing 83.63% P (72% 3HB-co-30% 4HB) was synthesized. Figure 19 ).
[0238] WR3 was fermented in a 100L fermenter with 3.5g / L yeast extract added to the fermentation medium and glucose as the sole carbon source. After 48h, the OD600 reached above 300, the CDW reached 68.61g / L, the PHA ratio reached 73.66%, and the 4HB molar ratio reached 28.59% ( Figure 20 ), with a molecular weight of 5.4x10 5 Da.
[0239] In a 5000L fermenter, 3.5g / L yeast extract was added to the fermentation medium. With glucose as the sole carbon source, the WR3 strain fermented all sugars for 48h to reach a CDW of 70.9g / L, with PHA accounting for 61.1% of the dry weight and a 4HB molar ratio of 29.05% in P34HB. Figure 21 ).
[0240] Example 12: WR3 strain can synthesize 4HB using multiple precursors
[0241] WR3 strain was fermented in a 7L fermentor with 10g / L glucose and 20g / L sodium acetate as carbon sources, 30g / L sodium acetate as carbon source, and 30% acetic acid as pH regulator. After 40h of fermentation, it synthesized P(60% 3HB-co-40% 4HB)( Figure 22 The molecular weight test results of the 48-hour fermentation samples showed that the molecular weight of P34HB produced by fermentation for 48 hours was slightly higher than that of P34HB produced by pure glucose carbon source (20 g / L glucose in the base and 10 g / L glucose in the feed), with the molecular weights of 5.5x10 5 Da and 5.2x10 5 Da.
[0242] The WR3 strain was grown in a 7-L fermentor with 20 g / L glucose as the carbon source as the base feed, and 50 g / L γ-aminobutyric acid and 560 g / L glucose monohydrate were added as the supplementary feed to maintain the glucose concentration at around 10 g / L. After 40 h of fermentation, P (65% 3HB-co-35% 4HB) was synthesized.
[0243] This example demonstrates that the constructed recombinant strain can utilize abundant bio-based carbon sources.
[0244] Those skilled in the art will appreciate that, although the present invention has been specifically described with reference to the above embodiments, the present invention is not limited to these specific embodiments. Based on the methods and technical solutions taught by the present invention, those skilled in the art can make appropriate modifications or improvements without departing from the spirit of the present invention, and the equivalent embodiments obtained therefrom are within the scope of the present invention.
[0245] References
[0246] Chen Xinyu, Li Mengyi, Chen Guoqiang. 2021. 30 years of research on metabolic engineering of polyhydroxyalkanoates (PHA). Chinese Journal of Biotechnology, 37:1794-1811.
[0247] Chen YL, Liu X, Zhang LZ, et al. 2025. Cell Sizes Matter for Industrial Bioproduction, a Case of Polyhydroxybutyrate. Advanced Science [J].
[0248] Fu N,Deng S,Fu Y,et al.2014a.Electrospun P34HB fibres:a scaffold fortissue engineering.Cell Prolif[J],47:465-475.
[0249] Fu X Z,Tan D,Aibaidula G,et al.2014b.Development of Halomonas TD01 asa host for open production of chemicals.Metab Eng[J],23:78-91.
[0250] He H T,Jer N W,Hu Q T,et al.2025.Engineering Halomonas bluephagenesisfor pilot production of terpolymers containing 3-hydroxybutyrate,4-hydroxybutyrate and 3-hydroxyvalerate from glucose.Metabolic Engineering[J],90:117-128.
[0251] Ji M K,Zheng T R,Wang Z Y,et al.2023.PHB production from food wastehydrolysates by harboring PHB operon linked with an essential gene.MetabolicEngineering[J],77:12-20.
[0252] Jiang X R,Yan X,Yu L P,et al.2021.Hyperproduction of 3-hydroxypropionate by Halomonas bluephagenesis.Nat Commun[J],12:1513.
[0253] Jo J,Jeong S Y,Lee J H Y,et al.2022.Green and Sustainable Hot MeltAdhesive(HMA)Based on Polyhydroxyalkanoate(PHA)and Silanized CelluloseNanofibers(SCNFs).Polymers[J],14.
[0254] Martinez-Garcia E,Aparicio T,Goni-Moreno A,et al.2015.SEVA 2.0:anupdate of the Standard European Vector Architecture for de- / re-constructionof bacterial functionalities.Nucleic Acids Res[J],43:D1183-1189.
[0255] Obruca S,Dvorak P,Sedlacek P,et al.2022.Polyhydroxyalkanoatessynthesis by halophiles and thermophiles:towards sustainable production ofmicrobial bioplastics.Biotechnol Adv[J],58:107906.
[0256] Park H,Zhang L Z,He H T,et al.2024.Engineering EPS in Halomonasbluephagenesis leads to self-flocculation and filamentation for convenientdownstream processing.Chemical Engineering Journal[J],495.
[0257] Qin Q,Ling C,Zhao Y,et al.2018.CRISPR / Cas9 editing genome ofextremophile Halomonas spp.Metab Eng[J],47:219-229.
[0258] Ren K,Zhao Y Q,Chen G Q,et al.2023.Construction of a StableExpression System Based on the Endogenous hbpB / hbpC Toxin-Antitoxin System ofHalomonas bluephagenesis.Acs Synthetic Biology[J],13:61-67.
[0259] Shen R,Yin J,Ye J W,et al.2018.Promoter Engineering for Enhanced P(3HB-co-4HB)Production by Halomonas bluephagenesis.ACS Synth Biol[J],7:1897-1906.
[0260] Tan D,Xue Y S,Aibaidula G,et al.2011.Unsterile and continuousproduction of polyhydroxybutyrate by Halomonas TD01.Bioresour Technol[J],102:8130-8136.
[0261] Tao W,Lv L,Chen G Q 2017.Engineering Halomonas species TD01 forenhanced polyhydroxyalkanoates synthesis via CRISPRi.Microb Cell Fact[J],16:48.
[0262] Tsuge T,Ko T,Tago M,et al.2013.Effect of glycerol and its analogs onpolyhydroxyalkanoate biosynthesis by recombinant Ralstonia eutropha:Aquantitative structure-activity relationship study of chain transferagents.Polymer Degradation and Stability[J],98:1586-1590.
[0263] Wang L J,Jiang X R,Hou J,et al.2022a.Engineering Halomonasbluephagenesis via small regulatory RNAs.Metab Eng[J],73:58-69.
[0264] Wang Z,Zheng Y,Ji M,et al.2022b.Hyperproduction of PHA copolymerscontaining high fractions of 4-hydroxybutyrate(4HB)by outer membrane-defectedHalomonas bluephagenesis grown in bioreactors.Microb Biotechnol[J],15:1586-1597.
[0265] Yan X,Liu X,Yu L P,et al.2022.Biosynthesis of diverse alpha,omega-diol-derived polyhydroxyalkanoates by engineered Halomonasbluephagenesis.Metab Eng[J],72:275-288.
[0266] Ye J,Hu D,Che X,et al.2018a.Engineering of Halomonas bluephagenesisfor low cost production of poly(3-hydroxybutyrate-co-4-hydroxybutyrate)fromglucose.Metab Eng[J],47:143-152.
[0267] Ye J,Hu D,Yin J,et al.2020.Stimulus response-based fine-tuning ofpolyhydroxyalkanoate pathway in Halomonas.Metab Eng[J],57:85-95.
[0268] Ye J,Huang W,Wang D,et al.2018b.Pilot Scale-up of Poly(3-hydroxybutyrate-co-4-hydroxybutyrate)Production by Halomonas bluephagenesisvia Cell Growth Adapted Optimization Process.Biotechnol J[J],13:e1800074.
[0269] Zhang L Z,Ye J W,Zhang X,et al.2022.Effective production of Poly(3-hydroxybutyrate-co-4-hydroxybutyrate)by engineered Halomonas bluephagenesisgrown on glucose and 1,4-Butanediol.Bioresource Technology[J],355.
[0270] Zheng S,Zhang Z H,Jiang P,et al.2024.A self-stimulating system basedon a polyhydroxyalkanoates coupled induction mechanism and its applicationsfor Halomonas.Chemical Engineering Journal[J],489.
Claims
1. A recombinant microorganism for producing P34HB (poly-3-hydroxybutyrate (3HB)-4-hydroxybutyrate (4HB) ester), comprising a metabolic pathway for producing P34HB and overexpressing 4-hydroxybutyryl-CoA transferase and PHA polymerase.
2. The recombinant microorganism according to claim 1, wherein the microorganism is selected from the genus Halomonas, Pseudomonas, Escherichia coli, Ralstonia eutropha, Aeromonas, Bacilllus, Alcaligenes latus and Alcaligenes eutropus, preferably the microorganism is Halomonas, more preferably the Halomonas is Halomonas bluephagenesis, Halomonas aydingkolgenesis, Halomonas campaniensis, Halomonas lutescens, Halomonas hydrothermalis, Halomonas sp.KM1, Halomonas elongata and Halomonas smyrnensis, still more preferably Halomonas bluephagenesis TD1.0, Halomonas bluephagenesis TD01 (Culture Collection Number CGMCC No. 4353), Halomonas aydingkolgenesis M1 (Culture Collection Number CGMCC No. 19880), Halomonas campaniensis LS21 (Culture Collection Number CGMCC No. 6593), Halomonas bluephagenesis TD27, Halomonas bluephagenesis TDB141, Halomonas bluephagenesis TDB141ΔAC, Halomonas bluephagenesis WZY254, Halomonas bluephagenesis WZY278 or Halomonas bluephagenesis CYL0307.
3. The recombinant microorganism according to claim 1 or 2, wherein the recombinant microorganism is Halomonas, and wherein: 1) The recombinant microorganism further overexpresses one or more (preferably all) of the 4-hydroxybutyrate dehydrogenase gene (4hbD), the succinate semialdehyde dehydrogenase gene (sucD) and the α-ketoglutarate decarboxylase gene (ogdA), preferably expressing one or more (preferably all) of 4hbD, sucD and ogdA via a toxin-antitoxin system plasmid; and / or 2) The succinate semialdehyde dehydrogenase gene has been knocked out or knocked down in the recombinant microorganism.
4. The recombinant microorganism according to any one of claims 1 to 3, wherein: 1) The endogenous plasmid has been knocked out in the recombinant microorganism; 2) the 4-hydroxybutyryl-CoA transferase and / or the PHA polymerase are overexpressed on a plasmid and / or genome in the recombinant microorganism, preferably the plasmid is a toxin-antitoxin system plasmid; 3) One or more of the endogenous β-ketothiolase gene phaA, the endogenous acetoacetyl-CoA reductase gene phaB, and the endogenous PHA polymerase gene phaC have been knocked out or knocked down in the recombinant microorganism, preferably the endogenous β-ketothiolase gene phaA and the acetoacetyl-CoA reductase gene phaB have been knocked out or knocked down, and more preferably the endogenous β-ketothiolase gene phaA has been knocked out or knocked down; 4) an ssrA degradation tag sequence is inserted before the stop codon of the endogenous phaA, phaB and / or phaC gene (preferably phaB) in the recombinant microorganism; 5) one or more (preferably all) of the genes 3-hydroxybutyryl-CoA dehydrogenase (3hbD), enoyl-CoA hydratase (fadB), 2,3-dehydroadipyl-CoA dehydratase (paaF), and enoyl-CoA hydratase (paaG) in the recombinant microorganism have been knocked out or knocked down; 6) The recombinant microorganism further overexpresses a PHA particle binding protein; 7) The recombinant microorganism has also knocked out or knocked down the gene encoding exopolysaccharide synthesis through outer membrane engineering, preferably the outer membrane PS4 gene cluster has been knocked out or knocked down in the recombinant microorganism; 8) The recombinant microorganism further has the sspB gene knocked out or knocked down and an ssrA degradation tag sequence inserted before the stop codon of the cytoskeleton mreB gene, and / or the endogenous PHA particle binding protein gene is knocked out; 9) The recombinant microorganism also overexpresses endogenous or exogenous genes encoding α-ketoglutarate aminotransferase (gdhA), glutamate decarboxylase (gadB), γ-aminobutyrate aminotransferase (gabT), glutamate-succinate semialdehyde aminotransferase (gadA) and / or glutamate dehydrogenase (gdhA) and metabolic pathway genes that degrade amino acids (including arginine, glutamine and proline) into γ-aminobutyric acid (including speA, speB, pat, prr, gltBD and putA); 10) The recombinant microorganism further overexpresses an alcohol dehydrogenase gene and / or an aldehyde dehydrogenase gene, preferably the aldehyde dehydrogenase is selected from aldD1, aldD2, aldH and ydcW, and the alcohol dehydrogenase is adhp or dhaT, and / or preferably the alcohol dehydrogenase gene and / or the aldehyde dehydrogenase gene is overexpressed on a plasmid or genome in the recombinant microorganism, more preferably the recombinant microorganism overexpresses adhp and aldD; and / or 11) The recombinant microorganism is further deleted from the 3-hydroxypropionate dehydrogenase gene (dddA), the methylmalonate semialdehyde dehydrogenase gene (dddC), or a combination thereof.
5. The recombinant microorganism according to any one of claims 1 to 4, wherein the overexpression is constitutive expression under the control of a constitutive promoter or inducible expression under the control of an inducible promoter, preferably the inducible promoter is selected from Mmp1 promoter, lux promoter, lac promoter, trp promoter, tac promoter, hypoxia-inducible promoter, bacterial quorum sensing-inducible promoter, temperature-sensitive promoter or a combination thereof, preferably the constitutive promoter is selected from the wild-type porin gene Pporin promoter or a mutant thereof, the wild-type PHA particle binding protein phaP1 gene promoter or an essential gene promoter, wherein the mutant is selected from Pporin1, Pporin42, Pporin51, Pporin58, Pporin68, Pporin140, Pporin141, Pporin192, Pporin194, Pporin221, Pporin226, Pporin259 and Pporin278.
6. The recombinant microorganism according to claim 4 or 5, wherein: 1) The plasmid is a pSEVA plasmid (preferably pSEVA321), and / or the toxin-antitoxin system plasmid is pHbPBC; 2) The 4-hydroxybutyryl-CoA transferase is selected from 4-hydroxybutyryl-CoA transferase (orfZ) derived from Clostridium klyveri, 4-hydroxybutyryl-CoA transferase (abfT) derived from Clostridium aminobutyricum, 4-hydroxybutyryl-CoA transferase (catfT) derived from Cupriavidus necator, Cn ), 4-hydroxybutyryl-CoA transferase from Nitrosopumilus maritimus (cat Nm ) or a combination thereof, preferably orfZ; and / or 3) The PHA polymerase is an exogenous PHA polymerase, preferably selected from phaC from Cupriavidus necator Cn gene, phaC from Burkholderia contaminans Kad1 Bc gene, phaC from Burkholderia sp. USM (JCM15050) Bs or a combination thereof. 7 . A method for producing P34HB (poly-3-hydroxybutyrate (3HB)-4-hydroxybutyrate (4HB)), the method comprising fermenting and culturing the recombinant microorganism according to claim 1 . The method according to claim 7 , wherein the fermentation culture utilizes glucose as the sole carbon source to synthesize the P34HB.
9. The method of claim 7 or 8, wherein the fermentation culture utilizes glucose and a 4HB structurally related precursor or a 4HB structurally unrelated precursor to synthesize the P34HB, wherein the 4HB structurally related precursor comprises 1,4-butanediol, γ-butyrolactone, or sodium 4-hydroxybutyrate, and / or the 4HB structurally unrelated precursor comprises sodium acetate, α-ketoglutarate, citric acid, γ-aminobutyric acid, glutamate, glutamine, proline, or arginine.
10. The method according to any one of claims 7 to 9, wherein the fermentation culture utilizes urea, yeast extract, corn steep liquor or wool hydrolyzate as a nitrogen source; and / or the fermentation culture is an open fermentation, and preferably, the culture medium used in the fermentation culture does not need to be sterilized.
Citation Information
Patent Citations
Halomonas strain and application thereof
CN102120973A
Method for producing hydrocarbons for making fuel by using sea water as medium and special strain
CN102925382A
Self-flocculation halomonas aydingkolgenesis M1 and application thereof
CN111593006A
A method for producing a 5-carbon compound or a polymer thereof
CN117143793B
Biological systems for manufacture of polyhydroxyalkanoate polymers containing 4-hydroxyacids
US6316262B1
Cited By
Method for improving molecular weight of polyhydroxyalkanoate PHA synthesized by microorganisms
CN121344105A
Rogowski eutrophic alkali-producing engineering strain for producing p-coumaric acid as well as construction method and application of Rogowski eutrophic alkali-producing engineering strain
CN121450560A
A rothia mucilaginosa engineering strain for producing p-coumaric acid, a construction method and application thereof
CN121450560B
Strain for producing high-performance polyhydroxyalkanoate as well as construction method and application of strain
CN121555393A