Multifunctional probiotic engineering bacterium for in-vivo continuous in-situ melanin production and application of multifunctional probiotic engineering bacterium

Abstract

The invention discloses a multifunctional probiotic engineering bacterium capable of continuously producing melanin in situ in vivo and application of the multifunctional probiotic engineering bacterium. According to the application, a genetically engineered bacterium EcN-Mel is constructed by adopting a probiotic Escherichia coli 1917 (EcN), and the EcN-Mel has the advantages of oral safety, continuous in-situ melanin production, inflammation site targeting and multi-mechanism synergistic treatment of acute radiation enteritis; researches find that EcN-Mel has a better curative effect on acute radiation enteritis than EcN; compared with the traditional Chinese medicine composition, the traditional Chinese medicine composition has stronger free radical scavenging capability, stronger capability of reducing inflammation level, stronger capability of increasing intestinal beneficial flora and reducing harmful flora, stronger capability of targeting a focus part-intestinal inflammation part, higher survival rate in a stomach acidic environment, longer retention time in the intestinal inflammation part, concentration increased by about 3 times, and more stable in vivo.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a multifunctional probiotic engineering bacterium capable of continuously producing melanin in situ in vivo and an application thereof. Background Art

[0002] Acute radiation enteritis (ARN) is intestinal damage caused by large doses of radiation to the abdomen or whole body. The clinical manifestations are mainly severe gastrointestinal symptoms. The course of the disease is rapid and it is an acute radiation sickness that is difficult to treat.

[0003] Direct damage to the intestine caused by radiation and the resulting oxidative stress and dysbiosis are key pathological mechanisms of ARN. Radiation-induced DNA damage and free radical production can trigger severe tissue damage and inflammatory responses. This is manifested as excessive reactive oxygen species (ROS) triggering lipid peroxidation, DNA damage, and ferroptosis, activating pro-inflammatory signaling pathways such as NF-κB [1,2]. ROS levels are positively correlated with the severity of inflammation, forming a vicious cycle of "oxidative stress-inflammation" [3,4]. In addition, the role of intestinal flora in regulating intestinal health and radiation damage cannot be ignored. Radiation can significantly affect the structure of the intestinal flora, leading to an imbalance in the flora, thereby aggravating intestinal damage. Regulation of the intestinal flora plays an important role in the repair of intestinal damage, alleviating damage by promoting epithelial cell regeneration and immune regulation [5].

[0004] The limitations of existing antioxidant treatments are as follows:

[0005] Natural enzymes: Superoxide dismutase (SOD) and catalase (CAT) are highly effective, but they have drawbacks such as high cost, poor stability, and strong immunogenicity[6,7]. Small molecule antioxidants: Vitamin C / E have limited efficacy, single function, difficulty in storage, high cost, and cannot specifically target lesions[8].

[0006] Clinical drugs such as 5-aminosalicylic acid (5-ASA) and glucocorticoids have problems with low bioavailability, systemic side effects, and drug resistance [9-14].

[0007] Nanozymes: Nanozymes (such as CeO2 and MoSe2) can remove ROS by mimicking enzyme activity, but they have significant defects: complex preparation process, poor gastrointestinal stability, and unclear potential toxicity and metabolic mechanisms of non-natural components

[15] .

[0008] Melanin: As a natural antioxidant, it has unique advantages: it can efficiently remove free radicals such as O2·- and ·OH, and promote the balance of intestinal flora; its acid-resistant properties make it suitable for oral delivery and have high biosafety [16-19]. However, exogenous melanin needs to be extracted and purified, which is a cumbersome process and lacks targeting.

[0009] Probiotics: E. coli Nissle 1917 (EcN) is a traditional probiotic with good biosafety. However, natural EcN has inherent defects in the treatment of radiation enteritis: lack of antioxidant function: lack of endogenous free radical scavenging system, unable to block the vicious cycle of "oxidative stress-inflammation"; limited microbial regulation: although it can inhibit pathogenic bacteria, it cannot actively promote the proliferation of beneficial bacteria such as Verrucomicrobia; low targeting efficiency: it relies on passive colonization and the retention concentration at the inflammatory site is not high.

[20]

[0010] Genetically engineered bacteria: They colonize the intestine and secrete therapeutic substances in situ, but existing systems have defects: the hosts are mostly non-probiotic bacteria (such as Escherichia coli, Bacillus, Trichoderma reesei, and Pichia pastoris expression systems), which have insufficient biosafety; complex surface modifications are required to improve gastrointestinal tolerance, and the process costs are high; there is a lack of treatment options that directly utilize probiotics to secrete melanin [21-23].

[0011] Patent application number 202410412709.6, "Recombinant bacteria for producing melanin by fermentation using tyrosine as a substrate and its application", discloses: recombinant bacteria for producing melanin by fermentation using tyrosine as a substrate and its application, belonging to the field of microbial metabolic engineering technology. The present invention uses Escherichia coli BL21 (DE3) as the starting strain, knocks out the genes pheA, trpR and pykA, and overexpresses the tyrosine operon genes melC1 and melC2 from two sources, Streptomyces antibioticus or Streptomyces castaneoglobisporus, respectively, to obtain recombinant Escherichia coli that can synthesize melanin. The Escherichia coli BL21 (DE3) in this patent is a non-probiotic bacteria and has problems such as poor biocompatibility, insufficient targeting, and inability to release sustainedly in situ. The main purpose of the research is to increase the production of melanin. The recombinant Escherichia coli strain is a non-probiotic bacteria and has insufficient safety for oral administration. In addition, there is no research on the efficacy, in vivo stability, and targeting of the in vivo treatment of acute radiation enteritis.

[0012] In the existing technology, the patent application number 202210125583.5 "Application of BMNP in protecting the intestine from ionizing radiation damage" is a chemically synthesized melanin analogue (BMNP), which requires exogenous administration and lacks the ability to continuously produce melanin in situ in the intestine. It does not integrate the multiple functions of antioxidant, anti-inflammatory and intestinal flora regulation, and lacks the ability to actively target inflammatory sites.

[0013] In summary, the current problems with the antioxidant flora regulation treatment of intestinal inflammation such as acute radiation enteritis are: lack of comprehensive intervention treatment methods that take into account both safety and effectiveness, relatively simple process, good in vivo stability, high targeting, long duration of action, single function, and lack of antioxidant and anti-inflammatory flora regulation.

[0014] References:

[0015] [1] E.L. Campbell, S.P. Colgan, Control and dysregulation of redox signalling in the gastrointestinal tract, Nature reviews. Gastroenterology & hepatology 16(2)(2019)106 - 120.

[0016] [2] H. Sies, D.P. Jones, Reactive oxygen species(ROS) as pleiotropic physiological signalling agents, Nat. Rev. Mol. Cell Biol. 21(7)(2020)363 - 383.

[0017] [3] K. Brainina, N. Stozhko, M. Vidrevich, Antioxidants: Terminology, Methods, and Future Considerations, Antioxidants 8(8)(2019)297.

[0018] [4] J. Flieger, W. Flieger, J. Baj, R. Maciejewski, Antioxidants: Classification, Natural Sources, Activity / Capacity Measurements, and Usefulness for the Synthesis of Nanoparticles, Materials(Basel) 14(15)(2021)4135.

[0019] [5] Wang W, Cui B, Nie Y, et al. Radiation injury and gut microbiota - based treatment. Protein & cell, 2023, 1; 15(2):83 - 97.

[0020] [6] K. M. Sztanke, P. M.Celejewski,K.Kurek,S.Szkutnicki,P.Korga,W.Bulikowski,K.Sztanke,Antioxidant Therapy inInflammatory Bowel Diseases,Antioxidants 10(3)(2021)412.

[0021] [7]W.Liang,P.Wied,F.Carraro,CJSumby,B.Nidetzky,CKTsung,P.Falcaro,CJDoonan,Metal-Organic Framework-Based Enzyme Biocomposites,Chem.Rev.121(3)(2021)1077-1129.

[0022] [8]H.Vargas Robles,AFCitalan Madrid,A.García Ponce,A.SilvaOlivares,M.Shibayama,A.Betanzos,L.Del Valle Mondragon,P.Nava,M.Schnoor,Experimental Colitis Is Attenuated by Cardioprotective Diet SupplementationThat Reduces Oxidative Stress,Inflammation,and Mucosal Damage,Oxidative Medicine and Cellular Longevity 2016(2016)8473242.

[0023] [9]T.Kobayashi,B.Siegmund,C.Le Berre,SCWei,M.Ferrante,B.Shen,CNBernstein,S.Danese,L.Peyrin-Biroulet,T.Hibi,Ulcerative Colitis,Nat RevDis Primers 6(1)(2020)74.

[0024]

[10] M.F.Neurath,Current and emerging therapeutic targets for IBD,Nature reviews.Gastroenterology&hepatology 14(5)(2017)269-278.

[0025]

[11] D.C.Baumgart,C.Le Berre,Newer Biologic and Small-MoleculeTherapies for Inflammatory Bowel Disease,N.Engl.J.Med.385(14)(2021)1302-1315.

[0026]

[12] S.Zhang,B.Chen,B.Wang,H.Chen,Y.Li,Q.Cao,J.Zhong,M.J.Shieh,Z.Ran,T.Tang,M.Yang,B.Xu,Q.Wang,Y.Liu,L.Ma,X.Wang,N.Zhang,S.Zhang,W.Guo,L.Huang,S.Schreiber,M.Chen,Effect of Induction Therapy With Olamkicept vs Placebo onClinical Response in Patients With Active Ulcerative Colitis:A RandomizedClinical Trial,The Journal of the American Medical Association 329(9)(2023)725-734.

[0027]

[13] B.Gros,G.G.Kaplan,Ulcerative Colitis in Adults:A Review,TheJournal of the American Medical Association 330(10)(2023)951-965.

[0028]

[14] P.S.Dulai,S.Singh,V.Jairath,E.Wong,N.Narula,Integrating Evidenceto Guide Use of Biologics and Small Molecules for Inflammatory BowelDiseases,Gastroenterology 166(3)(2024)396-408.

[0029]

[15] B.Yang,Y.Chen,J.Shi,Reactive Oxygen Species(ROS)-BasedNanomedicine,Chem.Rev.119(8)(2019)4881-4985.

[0030]

[16] A.Mavridi-Printezi,A.Menichetti,D.Mordini,R.Amorati,M.Montalti,Recent Applications of Melanin-like Nanoparticles as Antioxidant Agents,Antioxidants 12(4)(2023)863.

[0031]

[17] C.Maraveas,I.S.Bayer,T.Bartzanas,Recent Advances in AntioxidantPolymers:From Sustainable and Natural Monomers to Synthesis and Applications,Polymers(Basel)13(15)(2021)2465.

[0032]

[18] E.Kim,M.Kang,T.Tschirhart,M.Malo,E.Dadachova,G.Cao,J.J.Yin,W.E.Bentley,Z.Wang,G.F.Payne,Spectroelectrochemical Reverse EngineeringDemonstratesThat Melanin's Redox and Radical Scavenging Activities AreLinked,Biomacromolecules 18(12)(2017)4084-4098.

[0033]

[19] L.Panzella,G.Gentile,G.D'Errico,N.F.Della Vecchia,M.E.Errico,A.Napolitano,C.Carfagna,M.d'Ischia,Atypical Structural andπ-Electron Featuresof a Melanin Polymer That Lead to Superior Free-Radical-ScavengingProperties,Angew.Chem.Int.Ed.52(48)(2013)12684-12687.

[0034]

[20] Yan X,Liu XY,Zhang D,Zhang YD,Li ZH,Liu X,Wu F,ChenGQ.Construction of a sustainable3-hydroxybutyrate-producing probioticEscherichia coli for treatment of colitis.Cell Mol Immunol.2021;18(10):2344-2357.

[0035]

[21] J.Zhou,M.Li,Q.Chen,X.Li,L.Chen,Z.Dong,W.Zhu,Y.Yang,Z.Liu,Q.Chen,Programmable probiotics modulate inflammation and gut microbiota forinflammatory bowel disease treatment after effective oral delivery,Nat Commun13(1)(2022)3432.

[0036]

[22] A.Xie, H.Ji, Z.Liu, Y.Wan, 17(15)(2023)14775-14791.

[0037]

[23] Z.-Y.Han,C.Zhang,J.-X.An,J.-Y.Qiao,X.-Z.Zhang,Microalgal biomass-assisted delivery of probiotics for modulation of gut homeostasis andalleviation of intestinal inflammation,Nano today 54(2024)102093. Summary of the Invention

[0038] To address the problems of the prior art, this study used the probiotic Escherichia coli neisseri 1917 (EcN) to construct a genetically engineered bacterium, EcN-Mel. The study found that EcN-Mel is more effective than EcN in treating acute radiation enteritis. It has a stronger ability to reduce intestinal inflammation, a stronger ability to scavenge free radicals, a stronger ability to increase beneficial intestinal flora and reduce harmful flora, and a stronger ability to target the lesion site—the site of intestinal inflammation. It has a higher survival rate in the acidic environment of the stomach, a longer residence time in the site of intestinal inflammation, an approximately 3-fold increase in concentration, and is more stable in vivo. The specific technical solutions of the present invention are as follows:

[0039] First, construct genetically engineered bacteria EcN-Mel

[0040] A genetically engineered bacterium was constructed based on the probiotic Escherichia coli Nissle 1917 (EcN). The CRISPR / Cpf1 gene editing method was used to knock out the pheA, trpR, and pykA genes involved in the competitive pathway of tyrosine synthesis in Nissle1917, and to overexpress the endogenous gene Tyr1 related to tyrosine synthesis with a C-terminal fusion of 6his. The genetically engineered bacterium E. coli Nissle 1917△pheA△trpR△pykA pUKTAC-Vstyr(M235A / N229H), abbreviated as "EcN-Mel", was obtained and identified by colony PCR and sequencing.

[0041] Second aspect: culture, expansion and screening of EcN-Mel

[0042] The kanamycin resistance of the EcN-Mel engineered bacteria was screened and amplified, and melanin nanoparticles MelNPs were isolated from the EcN-Mel culture using a high-concentration hydrochloric acid precipitation method. Each bacterial supernatant contained approximately 0.52 mg / mL of melanin.

[0043] Third aspect: Characterization of the physical and chemical properties of EcN-Mel

[0044] (1) Full-wavelength microplate reader dynamically monitors the reaction process

[0045] Results: The absorbance values ​​at 600 nm of EcN and EcN-Mel at 0, 2, 4, 6, 8, 12, and 24 hours after culture were compared. At the same time point, the optical absorbance of EcN-Mel exceeded that of EcN, indicating the formation of melanin. It is believed that the higher absorption after 300 nm is caused by melanin, which is similar to the characteristic peaks and absorption characteristics of melanin standards.

[0046] (2) TEM observation of morphology

[0047] TEM observation images showed that the edges of EcN-Mel became unevenly thickened and darkened, which was caused by melanin; no nanostructure was observed in the EcN supernatant, while the EcN-Mel culture supernatant showed spherical melanin nanoparticles with a size of about 50 nm.

[0048] (3) SEM observation of morphology

[0049] SEM morphology images showed that EcN and EcN-Mel were rod-shaped, and EcN-Mel appeared longer, which might be due to the insertion of exogenous genes and changes in culture conditions.

[0050] (IV) FTIR detection of chemical functional groups

[0051] FT-IR spectroscopy showed that EcN-Mel and MelNPs exhibited peak patterns similar to those of commercial melanin, confirming that EcN-Mel could produce melanin nanoparticles.

[0052] (V) DLS detection of hydration size

[0053] The hydrated sizes of MelNPS, EcN and EcN-Mel were detected by DLS and were approximately 50 nm, 1100 nm and 1750 nm, respectively.

[0054] (6) Colony PCR identification

[0055] PCR identification results showed that there was a band at the position of 1359 bp in length. PCR identification results confirmed that the screened colonies were positive clones containing the target gene.

[0056] (VII) Colony WB Identification

[0057] Tyrosinase (Tyr protein) expressed in EcN-Mel had a distinct band at 38.7 kDa, while the EcN strain without genetic engineering modification had no corresponding band.

[0058] The results of colony PCR and WB identification proved that the genetically engineered bacteria EcN-Mel was successfully constructed.

[0059] Fourthly, comparison of free radical scavenging ability between EcN-Mel and EcN

[0060] Compared with the control group, EcN-Mel showed a weakened electron spin resonance signal, indicating that EcN-Mel has a broad-spectrum free radical scavenging ability; when EcN-Mel was co-incubated with gastrointestinal simulation fluid, SDF-EcN-Mel showed a weakened electron spin resonance signal similar to that of EcN-Mel, indicating that gastrointestinal simulation fluid had no significant effect on the free radical scavenging ability of EcN-Mel; in the absence of gastric acid, ECN itself has no free radical scavenging ability, indicating that EcN-Mel has the potential for antioxidant therapy and good gastrointestinal stability, while EcN has no free radical scavenging ability.

[0061] Fifth aspect: EcN-Mel safety evaluation

[0062] Treatment with melanin produced by EcN-Mel at different concentrations had no significant effect on the viability of HiEC cells. At a concentration of 200 μg / mL, the viability of the cells remained above 85%, indicating that nanoMel has good biocompatibility at the cellular level.

[0063] There were no significant differences in the various routine blood indicators of healthy mice at different time points (0 days, 3 days, 7 days, and 14 days) after oral delivery of EcN-Mel, indicating that oral delivery of EcN-Mel had no significant effect on routine blood indicators; various serum biochemical indicators fluctuated, but were mostly within the normal reference range; no obvious histological abnormalities or structural damage were observed in the structures of various tissues and organs under the light microscope, indicating that oral delivery of EcN-Mel had no significant effect on the histological structure of major organs.

[0064] The above results collectively indicate that EcN-Mel has good biosafety and is suitable for subsequent biomedical applications.

[0065] Sixth aspect: Comparison of EcN-Mel and EcN colonization in vivo and in vitro

[0066] (1) In vitro MPI detection

[0067] MPI was used to detect the MPI signals of EcN-Mel@SPIONs and gastrointestinal simulated fluid at different time points of co-incubation and its quantitative analysis. The results showed that although the MPI signals of EcN-Mel@SPIONs at different time points fluctuated, they always maintained a strong MPI signal. The MPI signal at 24 hours did not decrease compared with the initial value, indicating that EcN-Mel@SPIONs has good gastrointestinal stability.

[0068] (2) In vivo MPI detection

[0069] After oral administration of EcN@SPIONs to ARN model mice, the abdominal intestinal region showed no MPI signal at 24 hours. However, after oral administration of EcN-Mel@SPIONs to ARN model mice, the abdominal intestinal region maintained a strong MPI signal intensity at 24 hours, suggesting that EcN-Mel@SPIONs can colonize and retain a large portion of the inflamed intestinal segment (colon). At 24 hours, the colonic MPI signal intensity in the EcN-Mel@SPIONs group was significantly higher than that in the EcN@SPIONs group (P<0.001), representing a six-fold increase. This suggests that EcN-Mel colonizes the abdominal intestinal region longer than EcN.

[0070] Seventh aspect: Comparison of EcN-Mel and EcN in the treatment of acute radiation enteritis

[0071] Histochemical analysis, including H&E staining scoring, hematoxylin & eosin staining, Alcian blue staining, and immunohistochemical staining, confirmed that EcN-Mel could effectively alleviate the histological abnormalities of ARN model mice, while no significant relief was observed in the ECN group.

[0072] Eighth aspect: Comparison of anti-inflammatory effects of EcN-Mel and EcN

[0073] The enzyme-linked immunosorbent assay was used to detect the expression levels of inflammatory factors IL-6 and TNF-α in the small intestinal tissues of the ARN model mice treated in the groups. The results showed that compared with the ARN model group, the levels of TNF-α and IL-6 in the EcN-Mel group were significantly decreased, with P values ​​of 0.001 and 0.01, respectively, indicating that the inflammation in the EcN-Mel group was significantly reduced; compared with the ARN model group, the levels of TNF-α and IL-6 in the ECN group were decreased, with P values ​​of 0.05, indicating that the inflammation in the ECN group was alleviated.

[0074] Ninth aspect: Comparison of the effects of EcN-Mel and EcN on intestinal flora

[0075] Compared with ARN model mice, oral treatment with EcN-Mel significantly promoted the proliferation of beneficial bacteria Verrucomicrobia (such as Akkermansia), which may enhance intestinal barrier function; the proportion of potentially harmful bacteria Proteobacteria was slightly higher than that in the healthy group, but the difference was not significant.

[0076] Oral treatment with EcN: partially reversed the harmful bacterial flora changes in ARN model mice, but the effect was weaker than that of EcN-Mel intervention alone.

[0077] Compared with the prior art, the present invention has the following advantages:

[0078] This application uses the probiotic Escherichia coli 1917 (EcN) to construct the genetically engineered bacteria EcN-Mel. The study found that EcN-Mel is more effective than EcN.

[0079] 1. It has the ability to comprehensively intervene in multiple factors, including antioxidant, anti-inflammatory, and intestinal flora regulation, and has better efficacy in treating acute radiation enteritis;

[0080] 2. Stronger free radical scavenging ability;

[0081] 3. Stronger ability to increase beneficial intestinal flora and reduce harmful flora;

[0082] 4. Stronger targeting ability to target intestinal inflammatory lesions, with a longer residence time in the intestinal inflammatory lesions, exceeding 24 hours, and a concentration in the intestinal inflammatory lesions increased by approximately 3 times;

[0083] 5. It is more stable in the body and has a higher survival rate in the acidic environment of the stomach. BRIEF DESCRIPTION OF THE DRAWINGS

[0084] Figure 1 , EcN and EcN-Mel culture colors at 0, 3, 8, and 24 hours, where

[0085] The above is the culture color of EcN at 0, 3, 8, and 24 hours.

[0086] The following shows the color of EcN-Mel culture at 0, 3, 8, and 24 hours after adding copper ions and l-tyrosine to the culture medium.

[0087] Figure 2 , UV-visible absorption spectra of EcN and EcN-Mel at 0, 0.5, 3, 6, and 24 h;

[0088] Figure 3 , absorbance values ​​at 600 nm at 0, 2, 4, 6, 8, 12, and 24 h of culture of EcN and EcN-Mel;

[0089] Figure 4 , UV-visible absorption spectra of various culture substrates of EcN and EcN-Mel;

[0090] Figure 5 , SEM images and TEM images of EcN and EcN-Mel culture medium, among which,

[0091] Left: SEM images of EcN and EcN-Mel, scale bar = 1 μm, middle: biological TEM images of EcN and EcN-Mel, scale bar = 1 μm, right: TEM images of EcN and EcN-Mel;

[0092] Figure 6 TEM images of bacterial culture supernatants after centrifugation of EcN and EcN-Mel, scale bar = 50 nm;

[0093] Figure 7 , FT-IR spectra of EcN-Mel, MelNPs, and commercial melanin;

[0094] Figure 8 , the sizes of EcN, EcN-Mel, and melanin nanoparticles (MelNPs);

[0095] Figure 9 , Nissle 1917ΔpheAΔtrpRΔpykA pUKTAC-Vstyr(M235A / N229H) colony PCR identification, where 1-5 are randomly picked clone numbers;

[0096] Figure 10 , Nissle 1917ΔpheAΔtrpRΔpykA pUKTAC-Vstyr(M235A / N229H) colony WB identification;

[0097] Figure 11The free radical scavenging ability of EcN and EcN-Mel before and after treatment with gastrointestinal tract simulated fluid, wherein the control is represented by Control, EcN without treatment with gastrointestinal tract simulated fluid is represented by EcN, and EcN-Mel after treatment with gastrointestinal tract simulated fluid is represented by SDF-EcN-Mel.

[0098] a is the detection of the scavenging ability to O2·-,

[0099] b is the detection of scavenging ability to NO,

[0100] c is the detection of scavenging ability to ·OH,

[0101] d is the detection of scavenging ability of DPPH free radicals,

[0102] e is the detection of H2O2 scavenging ability;

[0103] Figure 12 , evaluation of the cytotoxicity of nanoMel on human intestinal epithelial cells Hiec, where nanoMel is a melanin produced by the genetically engineered bacteria EcN-Mel;

[0104] Figure 13 , routine blood test results at different time points (0 days, 3 days, 7 days, and 14 days) after oral delivery of EcN-Mel;

[0105] Figure 14 , serum biochemical test results at different time points (0 days, 3 days, 7 days, and 14 days) after oral delivery of EcN-Mel;

[0106] Figure 15 , Histochemical test results of major organs (heart, liver, spleen, lung, and kidney) at different time points (0 days, 3 days, 7 days, and 14 days) after oral delivery of EcN-Mel;

[0107] Figure 16 TEM images of SPIONs (left) and labeled biomimetic engineered bacteria EcN@SPIONs (middle) and EcN-Mel@SPIONs (right);

[0108] Figure 17 , MPI signal images and quantitative analysis of EcN-Mel@SPIONs and gastrointestinal tract simulation fluid at different time points in vitro;

[0109] Figure 18 , In vivo MPI images of mice at 0h, 6h, 8h, and 24h after oral delivery of EcN@SPIONs and EcN-Mel@SPIONs, where EcN@SPIONs is represented by EcN and EcN-Mel@SPIONs is represented by EcN-Mel;

[0110] Figure 19 , Statistical graphs of in vivo MPI signal intensity at 0h, 6h, 8h, and 24h after oral delivery of EcN@SPIONs and EcN-Mel@SPIONs to mice;

[0111] Figure 20 , Schematic diagram of the establishment of acute radiation-induced intestinal injury (ARN) model and treatment plan;

[0112] Figure 21 , Hematoxylin & eosin staining of small intestine tissues of mice after group treatment for 3 days, scale bar, 50 μm;

[0113] Figure 22 , Comparative statistical graph of small intestinal histopathological scores of mice after 3 days of treatment;

[0114] Figure 23 , Comparative statistical graph of villus length of small intestine tissue of mice after 3 days of treatment;

[0115] Figure 24 , Alcian blue staining of small intestine tissue of mice after group treatment for 3 days, scale bar, 100 μm;

[0116] Figure 25 , Quantitative comparison of the number of goblet cells in each crypt of the small intestine tissue of mice after 3 days of treatment;

[0117] Figure 26 , Immunohistochemical staining of Ki67 in small intestine tissue of mice after grouping and treatment for 3 days, scale bar, 50 μm;

[0118] Figure 27 , Semi-quantitative comparison of Ki67-positive cells in small intestine tissue of mice after 3 days of treatment;

[0119] Figure 28 , Tunel immunohistochemical staining of small intestinal tissues of mice grouped and treated for 3 days, scale bar, 50 μm;

[0120] Figure 29 , Semi-quantitative comparison of Tunel-positive cells in small intestine tissue of mice after 3 days of treatment;

[0121] Figure 30 , enzyme-linked immunosorbent assay kits were used to detect the levels of TNF-α and IL-6 in the small intestinal tissue homogenate of mice after grouping and treatment for 3 days, where a is the level of TNF-α and b is the level of IL-6;

[0122] Figure 31 , Linear discriminant analysis plot of mice grouped and treated;

[0123] Figure 32, statistical diagram of the differences in the composition of the intestinal microbiota of mice after grouping and treatment;

[0124] Figure 33 , Comparison of the colors of genetically engineered bacterial cultures constructed from two sources of tyrosinase. The left one is tyrosinase VsTYR (M235A / N229H) from Verrucomicrobium spinosum, and the right one is tyrosinase from Bacillus megaterium.

[0125] in Figure 1-Figure 33 middle,

[0126] *, **, ***, and **** represent P < 0.05, P < 0.01, P < 0.001, and P < 0.0001, respectively, indicating statistically significant differences between the two groups as determined by a two-tailed t-test. Data are the mean ± SD of at least three independent experiments. DETAILED DESCRIPTION

[0127] In order to make those skilled in the art better understand the present invention, the technical solution of the present invention is clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed description is exemplary and is only a part of the embodiments of the present invention, rather than all embodiments.

[0128] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work should fall within the scope of protection of the present invention.

[0129] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this application belongs. The experimental materials used in the examples of the present invention are all conventional experimental materials in the art and can be purchased through commercial channels. Experimental methods without detailed conditions were performed according to conventional experimental methods or according to the operating instructions recommended by the supplier.

[0130] The gene names involved in the present invention are explained as follows:

[0131] pheA gene: chorismate mutase and prephenate dehydratase bifunctional enzyme gene;

[0132] trpR gene: tryptophan operon repressor gene;

[0133] pykA gene: pyruvate kinase gene;

[0134] VsTYR gene: tyrosinase gene from Verrucomicrobium spinosum;

[0135] The nucleotide sequence of the pheA gene is shown in SEQ ID No. 1, the nucleotide sequence of the upstream homology arm of the pheA gene is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream homology arm of the pheA gene is shown in SEQ ID No. 3;

[0136] The nucleotide sequence of the trpR gene is shown in SEQ ID No. 4, the nucleotide sequence of the upstream homology arm of the trpR gene is shown in SEQ ID No. 5, and the nucleotide sequence of the downstream homology arm of the trpR gene is shown in SEQ ID No. 6;

[0137] The nucleotide sequence of the pykA gene is shown in SEQ ID No. 7, the nucleotide sequence of the upstream homology arm of the pheA gene is shown in SEQ ID No. 8, and the nucleotide sequence of the downstream homology arm of the pheA gene is shown in SEQ ID No. 9;

[0138] The amino acid sequence of VsTYR is shown in SEQ ID No.28.

[0139] Main biomaterials

[0140]

[0141]

[0142] Main reagents and materials

[0143] Reagent name Manufacturer Name 2,2-Di-(4-tert-octylphenyl)-1-picrylhydrazide free radical (DPPH) Sigma-Aldrich Shanghai Trading Co., Ltd. Isopropyl-β-D-thiogalactopyranoside (IPTG) Shanghai Sangon Biotech Co., Ltd. <![CDATA[Copper(II) sulfate pentahydrate (CuSO4·5H2O)]]> Shanghai Sangon Biotech Co., Ltd. Tyrosine Shanghai Sangon Biotech Co., Ltd. LB liquid medium Shanghai Sangon Bioengineering Co., Ltd. LB kanamycin resistance solid medium Shanghai Sangon Bioengineering Co., Ltd. Kanamycin Shanghai Sangon Biotech Co., Ltd. Bacterial freezing solution Shanghai Biotech Biotechnology Co., Ltd. Rhamnose Beijing Inokai Technology Co., Ltd. Pepsin Beijing Inokai Technology Co., Ltd. Trypsin Beijing Inokai Technology Co., Ltd. Electron microscopy fixative Beijing Solebow Technology Co., Ltd. dimethyl sulfoxide Sigma-Aldrich Shanghai Trading Co., Ltd. Fetal bovine serum Gibco Corporation of the United States 0.25% trypsin Gibco Corporation of the United States 1640 culture medium American Hydrone Company Penicillin-streptomycin American Hydrone Company Phosphate buffered saline (PBS) American Hydrone Company

[0144] Main instruments

[0145]

[0146]

[0147] Example 1. Construction of genetically engineered E. coli Nissle 1917ΔpheAΔtrpRΔpykA pUKTAC-Vstyr(M235A / N229H)

[0148] Based on the tyrosine metabolic pathway and its global regulation in Escherichia coli, the present invention constructed a genetically engineered bacterium based on the probiotic Escherichia coli Nissle 1917 (E. coli Nissle 1917, EcN). The CRISPR / Cpf1 gene editing method was used to knock out the pheA, trpR, and pykA genes involved in the competitive pathway of tyrosine synthesis in E. coli Nissle 1917, and the endogenous gene Tyr1 related to tyrosine synthesis was overexpressed with 6his fused to the C-terminus. The obtained Nissle1917 overexpressing the Tyr1 gene had excellent melanin production capacity.

[0149] The primer sequence information used in the following examples is shown in Table 1.

[0150] Table 1. Primer sequence list

[0151]

[0152]

[0153] 1. Construction of the pheA knockout strain E. coli Nissle 1917ΔpheA

[0154] (1) Experimental materials and reagents

[0155] Strains: E. coli Nissle 1917; E. coli DH5α (for plasmid cloning and amplification)

[0156] plasmids

[0157] pEcCpf1 (carrying CRISPR / Cpf1 system, kanamycin resistance)

[0158] pTargetF (carrying N23 targeting sequence, kanamycin resistance)

[0159] (2) Steps

[0160] 1. Primer design and PCR amplification of homology arms

[0161] Objective: Amplify the upstream and downstream homology arms (UP / DH) of pheA;

[0162] Upstream and downstream homology arm primers (UP / DH), used for homologous recombination, see Table 1;

[0163] N23 sequence replacement primers: pheA-N23-F / R, used for pTargetF transformation, see Table 1;

[0164] Here are the steps:

[0165] PCR system (50 μL): template DNA, 50 ng (EcN genome), 2.5 μL each of forward / reverse primers (10 μM), 1 μL of dNTPs (10 mM), 0.5 μL of Phusion DNA polymerase, 10 μL of 5× GC Buffer, and ddH2O to 50 μL.

[0166] PCR program: pre-denaturation at 98°C for 30 sec, denaturation at 98°C for 10 sec, annealing (primer specificity) at 60°C for 30 sec, extension at 72°C (1 kb / min) for 30 sec, and final extension at 72°C for 5 min.

[0167] Gel recovery: 1% agarose gel electrophoresis (120V, 30min) was performed to recover the target band (UP / DH) using AxyPrep TM Kit, elution according to the instructions (30 μL ddH2O).

[0168] 2. Construction of homologous recombination fragment (UD)

[0169] Goal: Connect the UP and DH fragments.

[0170] step

[0171] Overlap extension PCR (50 μL): 100 ng of UP fragment, 100 ng of DH fragment, 0.5 μL of Phusion polymerase, number of cycles = 20, extension time 1 kb / min; PCR procedure was the same as in "1. Primer design and PCR amplification of homology arms", except that the annealing temperature was lowered to 55°C.

[0172] Purify the UD fragment: Repeat gel recovery once. The gel recovery method is the same as "1. Primer design and PCR amplification of homology arms".

[0173] 3. Transformation of pTargetF plasmid

[0174] Target: Insertion targeting N23 sequence.

[0175] step

[0176] PCR amplification of linearized pTargetF

[0177] Primer: pheA-N23-F / R (containing N23 sequence) system is the same as "1. Primer design and PCR amplification of homology arms", and the template is pTargetF plasmid (50 ng);

[0178] DpnI digestion: 45 μL of PCR product, 1 μL of DpnI enzyme, incubate at 37°C for 1 h;

[0179] Transform E. coli DH5α competent cells: heat shock method (42°C, 90 sec), spread on Cannabidiol (100 μg / mL), and culture at 37°C for 12 h.

[0180] 4. Preparation of competent cells

[0181] Objective: To obtain competent E.coli DH5α-pEcCpf1.

[0182] step

[0183] Inoculation of E. coli DH5α: Inoculate a single colony into 5 mL of LB (containing 50 μg / mL Kan) and culture at 37°C, 200 rpm for 12 h.

[0184] Expansion culture: transfer to 50 mL LB (Kan) at a dilution of 1:100, and incubate on ice for 15 min when OD600 ≈ 0.6;

[0185] Competent cell preparation: Centrifuge at 5000g for 5 min at 4°C and discard the supernatant. Resuspend in 10 mL of ice-cold 0.1 M CaCl2, incubate on ice for 30 min, centrifuge at 5000g for 5 min at 4°C and discard the supernatant. Resuspend in 1 mL of ice-cold 10% glycerol, aliquot (100 μL / tube), and store at -80°C.

[0186] 5. Co-transformation and screening

[0187] Target: pTargetF-UD fragment

[0188] step

[0189] System: E. coli DH5α-pEcCpf1 competent medium 100 μL, pTargetF-pheA plasmid 100 ng, pheA-UD fragment 500 ng;

[0190] Heat shock method (42°C, 90 sec).

[0191] Recovery and plating: immediately add 1 mL of LB and resuscitate at 37°C, 200 rpm for 1 h; spread on Kan plates and incubate at 37°C for 24 h.

[0192] 6. Eliminate the editing plasmid

[0193] Target: Remove pTargetF and pEcCpf1.

[0194] step

[0195] Rhamnose induction: Pick positive clones into 5 mL LB (Kan + 10 mM rhamnose) and culture at 37°C for 12 h;

[0196] Sucrose counter-screening: After induction with 10 mM rhamnose for 12 h, the cells were spread on 10% sucrose plates (no resistance) and cultured at 37°C for 24 h.

[0197] 2. Construction of the trpR gene knockout strain E. coli Nissle 1917ΔpheAΔtrpR

[0198] Use trpR-UP-F / R, trpR-DH-F / R and trpR-N23-F / R primers, and the steps are as shown in "I. Construction of the pheA gene knockout strain E. coli Nissle 1917△pheA".

[0199] 3. Construction of the pykA knockout strain E. coli Nissle 1917ΔpheAΔtrpRΔpykA

[0200] Using primers pykA-UP-F / R, pykA-DH-F / R, and pykA-N23-F / R, the steps are described in "I. Construction of the pheA gene knockout strain E. coli Nissle 1917△pheA", and finally obtained E. coli Nissle 1917△pheA△trpR△pykA, which was sent to a sequencing company to verify the knockout region.

[0201] 4. Construction of E. coli Nissle 1917 ΔpheA ΔtrpR ΔpykA pUKTAC-Vstyr(M235A / N229H)

[0202] (I) Construction of pUKTAC-Vstyr(M235A / N229H) plasmid

[0203] 1. Based on the VsTYR gene, a mutation was performed to obtain the VsTYR(M235A / N229H) gene, whose amino acid sequence is shown in SEQ ID No. 29. VsTYR(M235A / N229H) is a mutant of VsTYR with mutations at M235A and N229H. VsTYR(M235A / N229H) was constructed by Hangzhou Fenghai Biotechnology Co., Ltd.

[0204] 2. The Vstyr (M235A / N229H) gene was codon-optimized in E. coli using the JCat tool (http: / / www.jcat.de). After optimization, the GC content was 52% and the CAI value was 0.89. The optimized gene nucleotide sequence is shown in SEQ ID No. 30.

[0205] 3. The pUKTAC vector was used to construct the pUKTAC-Vstyr (M235A / N229H) plasmid, which was constructed by Hangzhou Fenghai Biotechnology Co., Ltd.

[0206] (II) Transformation and screening of recombinant bacteria

[0207] 1. Preparation of E. coli Nissle1917 and E. coli Nissle1917ΔpheAΔtrpRΔpykA electroporation competent cells

[0208] (1) Activate and culture the above two strains at 37°C respectively;

[0209] (2) Inoculate each single clone into 5 ml of LB liquid medium;

[0210] (3) The next day, 1% of the cells were transferred to 50 ml of LB liquid medium and grown to an OD of approximately 0.8, and the cells were collected by centrifugation.

[0211] (4) Wash the cells three times with 10% glycerol and resuspend them in 2 ml of 10% glycerol to prepare competent cells.

[0212] 2. Electroconversion

[0213] 1 μL of the synthetically constructed pUKTAC-Vstyr (M235A / N229H) plasmid was added to the prepared Nissle1917 and Nissle1917ΔpheAΔtrpRΔpykA electroporation competent cells, mixed evenly, placed on ice for 5 minutes, electroporated at 2500V, added with 1 ml of LB medium, cultured at 37°C for 1 hour, and then coated on LB plates containing Kan (50 mg / ml). The grown clones were identified by colony PCR.

[0214] 5. Colony PCR Identification

[0215] Identification primers:

[0216] pUKTAC-JD-F:GTGATGACGGTGAAAACCTCTGA (SEQ ID No. 31)

[0217] pUKTAC-JD-R:TCGCCACCTCTGACTTGAGCGTC (SEQ ID No. 32)

[0218] Identification of positive clones 1359bp

[0219] System: Pick a single clone and add it to 10 μL of sterile water, mix it evenly, and then take 0.5 μL as a template for colony PCR identification according to the system in Table 2; PCR program: 95°C for 5 min; 30× (95°C for 30 s, 60°C for 30 s, 72°C for 1.5 min); 72°C for 5 min.

[0220] Table 2. qRT-PCR reaction system

[0221]

[0222] 6. Genetically Engineered E. coli Nissle1917 △pheA△trpR△pykA pUKTAC-Vstyr(M235A / N229H) Plasmid

[0223] Sequencing

[0224] The genetically engineered bacterium E. coli Nissle 1917ΔpheAΔtrpRΔpykA pUKTAC-Vstyr(M235A / N229H) is hereinafter referred to as "EcN-Mel".

[0225] The EcN-Mel plasmid was sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing. The sequence of the EcN-Mel plasmid is shown as SEQ ID No. 33.

[0226] Example 2: Cultivation, amplification, and screening of genetically engineered bacteria

[0227] 1. Cultivation of EcN

[0228] Pour 100 mL of LB liquid medium into the sterilized conical flask, add 100 μL of EcN frozen bacterial solution, seal the flask and transfer it to a shaker at 37°C and culture overnight at 150 rpm.

[0229] 2. EcN Expansion

[0230] Pour 100 mL of LB liquid medium into a sterilized conical flask, add 100 μL of EcN frozen bacterial solution, seal the flask, and move to a 37°C shaker for incubation at 150 rpm for 6-8 hours; use a microplate reader to measure the OD600 value. When it is between 0.6 and 0.8, transfer 10 mL of the bacterial solution to a 15 mL centrifuge tube and centrifuge at 4000 rpm for 10 minutes; dissolve the precipitate in 1 mL of bacterial freezing solution, divide the tubes into cryovials, seal with parafilm, and store at -80°C for future use.

[0231] 3. Kanamycin resistance screening of EcN-Mel engineered bacteria

[0232] Pour 100 mL of LB liquid medium into a sterilized conical flask, add 100 μL of EcN-Mel frozen bacterial solution and 100 μL of kanamycin (50 mg / mL), seal the flask, and incubate overnight at 150 rpm in a 37°C shaker. A small amount of bacterial solution was streaked onto a kanamycin-resistant LB solid culture dish, sealed, and incubated overnight at 150 rpm in a 37°C shaker. Pick a single colony from the dish and transfer it to a new 100 mL of LB liquid medium. Seal the flask and incubate at 37°C in a shaker for 6-8 hours at 150 rpm. Measure the OD600 value using a microplate reader. When the OD600 value is between 0.6 and 0.8, transfer 10 mL of bacterial solution to a 15 mL centrifuge tube and centrifuge at 4000 rpm for 10 minutes. Dissolve the precipitate in 1 mL of bacterial freezing solution, aliquot into cryovials, seal with parafilm, and store at -80°C.

[0233] IV. Amplification of EcN-Mel engineered bacteria

[0234] Pour 100 mL of LB liquid medium into a sterilized conical flask, add 100 μL of EcN-Mel frozen bacterial solution, seal the flask, and move to a 37°C shaker for incubation at 150 rpm for 6-8 hours; use a microplate reader to measure the OD600 value. When it is between 0.6 and 0.8, transfer 10 mL of the bacterial solution to a 15 mL centrifuge tube and centrifuge at 4000 rpm for 10 minutes; dissolve the precipitate in 1 mL of bacterial freezing solution, divide the tubes into cryovials, seal with parafilm, and store at -80°C for future use.

[0235] 5. Operation steps of EcN-Mel engineered bacteria to produce melanin

[0236] Pour 100 mL of LB liquid medium into the sterilized conical flask, add 100 μL of EcN-Mel frozen bacterial solution, CuSO4·5H2O solution (5 mg mL -1 ,1mL), 80mg tyrosine, 1mM IPTG (23.83mg), seal the tube and move to a 37℃ shaker for overnight culture; the next day the bacterial solution turns black, indicating the production of melanin.

[0237] like Figure 1 As shown above, the culture of the unmodified strain EcN maintained a consistent golden yellow color and became turbid over time;

[0238] like Figure 1 As shown below, after adding copper ions and l-tyrosine to the culture medium, the color of the EcN-Mel culture changes from golden yellow to light brown and finally to dark brown. This change is attributed to the continued production of melanin.

[0239] Analysis: Tyrosinase catalyzes the conversion of l-tyrosine into dopa, which is oxidized to dopachromium and rearranged into 5,6-dihydroxyindole or 5,6-dihydroxyindole-2-carboxylic acid, eventually undergoing spontaneous polymerization to form melanin. The presence of copper ions can accelerate the synthesis of melanin.

[0240] 6. Purification of Melanin Nanoparticles (Mel)

[0241] The EcN-Mel culture medium was filtered through a 0.22 μm filter membrane, and the filtrate was centrifuged at 11,000 rpm for 10 minutes. One-third of the volume of 6M hydrochloric acid was added to the centrifuged supernatant, and the mixture was allowed to stand at room temperature for 10 hours, followed by centrifugation at 11,000 rpm for 10 minutes. Purified Mel was obtained by centrifugation and resuspension five times in deionized water (12,000 rpm, 10 minutes each time), and lyophilized to a black powder. The Mel was lyophilized and weighed using a freeze dryer to quantify the yield of Mel. An appropriate amount of aqueous ammonia solution (25% to 28%) was added to dissolve the Mel, and then rotary evaporated to obtain a Mel solution.

[0242] Melanin nanoparticles (MelNPs) were isolated from EcN-Mel culture using high-concentration hydrochloric acid precipitation, and each bacterial supernatant contained approximately 0.52 mg / mL of melanin.

[0243] Example 3: Characterization of the physicochemical properties of genetically engineered bacteria

[0244] 1. Dynamic monitoring of reaction progress using a full-wavelength microplate reader

[0245] (1) Method

[0246] At 0, 0.5, 3, 6, and 24 hours of culture, 200 μL each of EcN-Mel culture medium and melanin extract Mel was aspirated and placed in a 96-well microplate. The UV-visible absorption spectrum of each sample was measured using a full-wavelength microplate reader with a scanning range of 300 to 1000 nm.

[0247] After culturing for 0, 2, 4, 6, 8, 12, and 24 hours, 200 μL each of EcN-Mel culture medium and melanin extract Mel was aspirated and placed in a 96-well microplate. The absorbance of each sample at 600 nm was measured using a full-wavelength microplate reader.

[0248] UV-visible absorption spectra of various culture substrates (CuSO4·5H2O solution, tyrosine, IPTG and kanamycin) of EcN and EcN-Mel

[0249] (2) Results

[0250] like Figure 2As shown in the UV-visible absorption spectra of 0, 0.5, 3, 6, and 24 h, EcN and EcN-Mel showed characteristic absorption peaks in the range of 300-350 nm, and in the visible light region (400-850 nm), a monotonically decreasing broadband absorption was observed without obvious peaks.

[0251] like Figure 3 As shown, the absorbance values ​​at 600 nm of EcN and EcN-Mel at 0, 2, 4, 6, 8, 12, and 24 h of culture were compared. At the same time point, the optical absorbance of EcN-Mel exceeded that of EcN, indicating the formation of melanin;

[0252] like Figure 4 As shown in the UV-visible absorption spectra of various culture substrates of EcN and EcN-Mel, reagents such as CuSO4, tyrosine, IPTG and kanamycin have weak light absorption in the range of 300-850nm and have almost no effect on the absorption of the bacterial solution. After deducting the light absorption of these reagents, the main difference between EcN and EcN-Mel is the production of melanin. Therefore, it is believed that the higher absorption after 300nm is caused by melanin, which is similar to the characteristic peaks and absorption characteristics of the melanin standard.

[0253] 2. TEM observation of morphology

[0254] After centrifugation, 10 mL of each EcN and EcN-Mel culture medium was collected, and the supernatant and precipitate were collected respectively. The precipitated bacteria were resuspended with PBS, and 10 μL of the diluted EcN and EcN-Mel resuspensions and the supernatant after centrifugation of the two culture mediums were aspirated with a pipette, and carefully and quickly added dropwise onto the amorphous carbon film-coated copper grid, and naturally dried at room temperature; the morphology of the products in the EcN and EcN-Mel culture mediums and the supernatant after centrifugation was observed on a TEM with an accelerating voltage of 200 kV.

[0255] like Figure 5 TEM images (middle) and (right) show that the edges of EcN-Mel are unevenly thickened and darkened, which is caused by melanin.

[0256] like Figure 6 As shown, no nanostructures were observed in the EcN supernatant, while the EcN-Mel culture supernatant showed spherical melanin nanoparticles with a size of approximately 50 nm;

[0257] 3. SEM morphology observation

[0258] 50 μL of centrifugally concentrated EcN and EcN-Mel bacterial solutions were respectively aspirated and dropped onto tin foil. After drying, 50 μL was added again. This process was repeated several times until a thin film visible to the naked eye was formed on the surface of the tin foil. The films were then sprayed with gold and observed and photographed under a SEM.

[0259] like Figure 5 (Left) The SEM observation morphology image suggests that EcN and EcN-Mel are rod-shaped, among which EcN-Mel appears longer, which may be due to the insertion of exogenous genes and changes in culture conditions.

[0260] 4. FTIR detection of chemical functional groups

[0261] Vacuum-dried potassium bromide powder was ground to less than 2 μm in an agate mortar. 1 mg of freeze-dried EcN-Mel, Mel powder sample (MelNPs), commercial melanin powder, and 100 mg of ground and sieved potassium bromide powder were added to each of the mortars. The mixture was ground and mixed several times until no large particles were observed by naked eye. The potassium bromide powder mixed with the sample was pressed into tablets using a tablet press under infrared lamp irradiation. The tablets were then tested on an infrared spectrometer to measure the infrared light passing through the test sheet and obtain an infrared spectrum. The detection conditions were: scanning range 4000-400 cm -1 , with a resolution of 4cm -1 , scans were performed 256 times and superimposed to analyze the surface chemical functional groups.

[0262] like Figure 7 The FT-IR spectra of EcN-Mel and MelNPs showed peak patterns similar to those of commercial melanin.

[0263] The stretching vibration peaks of NH and Oh are close to 3380 cm -1 The C=O structure is related to 1200cm -1 、1500-1550cm -1 (indole skeleton vibration) corresponds to the C=C bond in the aromatic ring and 1644cm -1 The peak corresponds to .

[0264] This study demonstrated the successful generation of engineered bacteria, EcN-Mel, that can produce melanin nanoparticles; the engineered EcN strain was genetically engineered as the basis for tyrosinase gene expression, resulting in the generation of bacteria, EcN-Mel, that can produce melanin.

[0265] 5. DLS detection of hydration size

[0266] After extracting and purifying the melanin solution secreted by the engineered bacteria, 1 mL of a 10 μg / mL Mel solution was added to a cuvette and measured using a Malvern potentiometric particle size analyzer. Data acquisition conditions included irradiation with a 633 nm helium-neon laser source, a diffraction angle of 173°, and a test temperature of 25°C. The hydrated size of Mel was determined. Instrument measurement parameters were set as follows: temperature of 20°C, diffraction angle of 90°, and equilibration time of 60 seconds. All samples were tested in triplicate.

[0267] The results are as follows Figure 8 As shown, the hydrated sizes of MelNPS, EcN, and EcN-Mel were detected by DLS and were approximately 50 nm, 1100 nm, and 1750 nm, respectively.

[0268] 6. Colony PCR Identification of Nissle 1917ΔpheAΔtrpRΔpykA pUKTAC-Vstyr(M235A / N229H)

[0269] (1) Method

[0270] Refer to Example 1.

[0271] (2) Results

[0272] The results are as follows Figure 9 As shown, 1-5 are randomly picked clones. The PCR identification results showed that all of them had a band at the position of 1359 bp in length. The PCR identification results confirmed that the screened colonies were positive clones containing the target gene.

[0273] VII. Western blot identification of Nissle 1917ΔpheAΔtrpRΔpykA pUKTAC-Vstyr(M235A / N229H) colonies

[0274] (1) Method

[0275] After incubation of EcN and EcN-mel bacterial solutions for 8 hours, the bacterial pellets were collected. Subsequently, protein quantification was performed for each sample. Proteins were separated by 10% SDS-PAGE. After gel preparation, electrophoresis, and transfer, the membrane was blocked with 5% skim milk and incubated with the primary antibody at 4°C for 12 hours and the secondary antibody at 37°C for 1 hour. The antibody dilution ratio was Recombinant anti-hisTag antibody (GB15125, 1:2000, Servicebio). Gel images were analyzed.

[0276] (2) Results

[0277] The results are as follows Figure 10 As shown, tyrosinase (Tyr protein) expressed in EcN-Mel has an obvious band at 38.7 kDa; while the EcN strain without genetic engineering modification has no corresponding band.

[0278] The results of colony PCR and WB identification proved that the genetically engineered bacteria EcN-Mel was successfully constructed.

[0279] Example 4: Detection of free radical scavenging ability of genetically engineered bacteria

[0280] 1. Methods

[0281] (1) Detection of the stability of EcN-Mel in simulated digestive fluid (SDF)

[0282] Sodium chloride and pepsin were dissolved in deionized water to a concentration of 32 μg / mL, and the pH value was adjusted to 1.2 with hydrochloric acid to obtain a gastric fluid simulation solution.

[0283] After dissolving dipotassium hydrogen phosphate in deionized water, trypsin was added and dissolved in deionized water to 100 μg / mL. The pH value was adjusted to about 7.5 with sodium hydroxide to obtain an intestinal fluid simulation solution.

[0284] The original bacterial solution with OD600≈2.5 was concentrated 100 times, and 200 μL of the concentrated bacterial solution was incubated with gastric fluid simulation solution (volume ratio of 1:1) for 4 hours. The EcN-Mel precipitate was then collected by centrifugation and incubated with intestinal fluid simulation solution (volume ratio of 1:1) for 20 hours to simulate the gastric emptying time and intestinal transit time after oral delivery. It was named SDF-treated EcN-Mel (SDF-EcN-Mel).

[0285] (2) ESR detection of free radical scavenging ability

[0286] ESR spectroscopy was used to compare the scavenging abilities of EcN-Mel and SDF-EcN-Mel on DPPH·, ·OH, O2·-, H2O2 and ·NO.

[0287] Briefly, a 10 mM DPPH solution was prepared in ethanol for measurement, and 100 mM 5,5-dimethyl-1-pyrroline oxide was used as a spin trapping agent;

[0288] O2·- was generated by the reaction of xanthine (10 mM) with xanthine oxidase (1 U / mL), and 100 mM 5,5-dimethyl-1-pyrroline oxide was used as a spin trap;

[0289] ·OH is generated by the reaction of ferrous ions with H2O2, and 5,5-dimethyl-1-pyrroline oxide is used as a spin trapping agent;

[0290] 400 μL of 20 mM H2O2 solution was mixed with 100 μL of deionized water for 30 min to deoxygenate as the H2O2 source, and 100 mM 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxide-3-oxide potassium salt was used as a spin trap;

[0291] 10 mM S-nitroso-N-acetyl-DL-penicillamine was used as a source of ·NO, and 100 mM 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxide-3-oxide potassium salt was used as a spin trap;

[0292] Incubate with 200 μg / mL of EcN-Mel and SDF-EcN-Mel for 10 minutes, respectively. Place the test solution in an ESR quartz tube and freeze-degas-thaw several times. After degassing, record the ESR spectrum at room temperature.

[0293] 2. Results

[0294] The results are as follows Figure 11 As shown, compared with the control group, EcN-Mel showed a weakened electron spin resonance signal, indicating that EcN-Mel has a broad spectrum of free radical scavenging ability;

[0295] When EcN-Mel was co-incubated with gastrointestinal tract simulation fluid, SDF-EcN-Mel showed a weakened electron spin resonance signal similar to that of EcN-Mel, indicating that the gastrointestinal tract simulation fluid had no significant effect on the free radical scavenging ability of EcN-Mel.

[0296] like Figure 11 As shown, in the absence of gastric acid, ECN itself has no free radical scavenging ability, so ECN was not treated with gastrointestinal simulated fluid.

[0297] 3. Conclusion

[0298] These results indicate that EcN-Mel has the potential for antioxidant therapy and good gastrointestinal stability, while EcN has no free radical scavenging ability, so only EcN-Mel is expected to be used for the treatment of gastrointestinal oxidative stress damage-related diseases via oral delivery.

[0299] Example 5: Safety evaluation of genetically engineered bacteria EcN-Mel

[0300] Male C57BL / 6J mice (6-8 weeks old, 18-22 g) were used for the experiments.

[0301] 1. Safety evaluation methods for genetically engineered bacteria

[0302] (1) CCK-8 kit to detect cell activity

[0303] 5,000 HiEC cells were seeded in a 96-well cell culture plate and cultured in a cell culture incubator for 12 hours after cell attachment. Different concentrations of nanoMel (0, 12.5, 25, 50, 100, and 200 μg / mL) were added, with six replicate wells per group. After 24 hours of incubation with the cells, CCK-8 reagent was added. One hour later, absorbance at 450 nm was measured using a microplate reader to analyze the effect of nanoMel on cell viability.

[0304] Note: nanoMel is a melanin produced by the genetically engineered bacterium EcN-Mel.

[0305] (2) Routine blood test

[0306] EcN-Mel was orally delivered to healthy mice [OD600 value, original bacterial solution at 2.5±0.1, concentrated 100 times, 10 μL / g (1x10 9 CFU / 100 μL) of mouse body weight were administered. Healthy mice given only saline by gavage served as controls. At different time points after administration (0, 3, 7, and 14 days), fresh blood was obtained by enucleation of the eyeballs and placed in anticoagulant tubes. The whole blood was stored at 4°C for routine blood tests.

[0307] (3) Serum biochemical test

[0308] For serum extraction, place whole blood in an anticoagulant tube at room temperature for 30 minutes, centrifuge at 3000 rpm for 10 minutes, and carefully collect the supernatant serum. Serum biochemical parameters were quantitatively measured using a serum biochemistry analyzer. Five mice were included in each group. Test parameters included liver function indicators such as aspartate aminotransferase (AST) and alkaline phosphatase (ALP); and renal function indicators such as urea (UREA) and uric acid (UA).

[0309] (3) Histochemical analysis

[0310] EcN-Mel was orally delivered to healthy mice [dose: original bacterial solution with OD600 value of 2-2.5, concentrated 100 times, 10 μL / g (1x10 9 CFU / 100 μL) mouse body weight dose], and healthy mice in the oral delivery of normal saline group were used as controls. At different time points after administration (0 days, 3 days, 7 days, and 14 days), mice were anesthetized with 10% chloral hydrate and then perfused through the heart with 50 mL of normal saline and 50 mL of 4% paraformaldehyde. Major organs such as the heart, liver, spleen, lungs, and kidneys were quickly separated and immersed in 4% paraformaldehyde. Paraffin embedding was performed after 24 hours. Sections were sliced ​​with a layer thickness of 5 μm and dewaxed. The tissue sections were immersed in hematoxylin stain for 3 minutes, stained with eosin for 1 minute, dehydrated, sealed, observed under an inverted microscope, and photographed.

[0311] 2. Results

[0312] like Figure 12 As shown in the results, within the tested concentration range, treatment with different concentrations of nanoMel had no significant effect on the survival activity of HiEC cells. At a concentration of 200ug / mL, the survival activity of the cells remained above 85%, indicating that nanoMel has good biocompatibility at the cellular level.

[0313] like Figure 13As shown, there was no significant difference in the various blood routine indicators at different time points (0 days, 3 days, 7 days, and 14 days) after oral delivery of EcN-Mel in healthy mice, indicating that oral delivery of EcN-Mel had no significant effect on the blood routine indicators.

[0314] like Figure 14 As shown, the results of serum biochemical index detection at different time points (0 days, 3 days, 7 days, and 14 days) after oral delivery of EcN-Mel to healthy mice showed that the parameters of various indicators at different time points fluctuated, but were mostly within the normal reference range.

[0315] like Figure 15 As shown, no obvious histological abnormalities or structural damage were observed in the light microscopic structures of various tissues and organs (heart, liver, spleen, lung, and kidney) at different time points, indicating that oral delivery of EcN-Mel had no significant effect on the histological structure of major organs.

[0316] The above results collectively indicate that EcN-Mel has good biosafety and is suitable for subsequent biomedical applications.

[0317] Example 6: Magnetic Particle Imaging Monitoring of Metabolic Distribution of Genetically Engineered Bacteria

[0318] 1. In vitro MPI detection

[0319] (1) Method

[0320] After culturing EcN and EcN-Mel for 2 hours, 1 mL of 5 mg / mL superparamagnetic iron oxide nanoparticles (SPIONs) was added to each of them. After incubation for 24 hours, the cells were centrifuged and washed three times to obtain SPIONs-labeled engineered bacteria, named EcN@SPIONs and EcN-Mel@SPIONs. The morphologies of SPIONs-labeled biomimetic engineered bacteria EcN@SPIONs and EcN-Mel@SPION were observed by TEM.

[0321] 100 mL of EcN-Mel@SPIONs culture medium was concentrated 100-fold. 100 μL of the concentrate was incubated in gastric fluid-simulating solution for 30 minutes (v / v 1:1), collected by centrifugation, and resuspended in intestinal fluid-simulating solution (v / v 1:1). MPI signals were then acquired at different time points (0, 2, 4, 6, 8, and 24 hours) using an excitation field of 45 kHz. 2D imaging parameters included: Scan mode: Default; Field of view: 6 cm × 4 cm.

[0322] (2) Results

[0323] like Figure 16 As shown, the TEM images of SPIONs, labeled biomimetic engineered bacteria EcN@SPIONs and EcN-Mel@SPIONs suggest:

[0324] SPIONs are nanoparticles with a diameter of approximately 30 nm. After EcN and EcN-Mel were labeled with SPIONs, EcN and EcN-Mel were observed to engulf the SPIONs.

[0325] like Figure 17 As shown, the labeled EcN-Mel@SPIONs were co-incubated with gastrointestinal simulated fluid in vitro, and MPI was used to detect the MPI signals at different time points of co-incubation of EcN-Mel@SPIONs and gastrointestinal simulated fluid and its quantitative analysis. The results showed that although the MPI signals of EcN-Mel@SPIONs at different time points fluctuated, they always maintained a strong MPI signal. The MPI signal at 24 hours did not decrease compared with the initial value, indicating that EcN-Mel@SPIONs have good gastrointestinal stability.

[0326] 2. In vivo MPI assessment of EcN-Mel colonization

[0327] (1) Method

[0328] 1. Establishment of an acute radiation enteritis (ARN) model in mice

[0329] The ARN model was established by exposing the abdomen of 6-8 week-old male C57BL / 6 mice to X-rays at a dose rate of 10 mGy / s (220 mV, 13 mA) for a total irradiation dose of 12 Gy.

[0330] 2. Drug administration and in vivo MPI

[0331] Six ARN model mice were randomly divided into two groups of three. The mice were fasted for 24 hours with free access to water. EcN@SPIONs and EcN-Mel@SPIONs were administered orally. The original bacterial solution, concentrated 100-fold at an OD600 value of 2.5±0.1, was administered at a dose of 10 μL / g mouse body weight. MPI signals were acquired before and at various time points (0, 6, 8, and 24 hours) after oral gavage. The excitation field was 45 kHz. 2D imaging parameters included: Scan mode: Default; Field of view: 6 cm × 4 cm.

[0332] (2) Results

[0333] like Figure 18As shown, after oral delivery of EcN@SPIONs to ARN mice, the abdominal region maintained strong MPI signal intensity at 6 hours and 8 hours, and almost no MPI signal was observed at 24 hours, suggesting that EcN@SPIONs were excreted from the intestine; while after oral delivery of EcN-Mel@SPIONs to ARN mice, the abdominal region maintained strong MPI signal intensity at 6 hours, 8 hours and 24 hours.

[0334] like Figure 19 As shown, after 24 hours in vivo, the MPI signal intensity of the EcN-Mel@SPIONs group was significantly higher than that of the EcN@SPIONs group, suggesting that the colonization time of EcN-Mel in the abdomen is longer than that of EcN.

[0335] like Figure 19 As shown, after oral delivery of EcN@SPIONs to ARN model mice, there was no MPI signal in the abdominal intestinal area at 24 hours; however, after oral delivery of EcN-Mel@SPIONs to ARN model mice, the abdominal intestinal area still maintained a strong MPI signal intensity at 24 hours, suggesting that EcN-Mel@SPIONs can colonize in the inflamed intestinal segment (colon) and retain a long period of time.

[0336] like Figure 19 As shown in the figure, at the 24-hour time point, the colon MPI signal intensity of mice in the EcN-Mel@SPIONs group was significantly higher than that of mice in the EcN@SPIONs group, P < 0.001, and the former was 6 times that of the latter, indicating that the colonization time of EcN-Mel in the abdominal intestinal area was longer than that of EcN.

[0337] The reason may be that the mucosal layer of the inflamed intestinal segment is disordered and expresses a large number of positively charged proteins, which leads to the accumulation of positive charges on the surface of the intestinal mucosa in the diseased intestinal segment, thus providing a natural targeting site for agents with negative surface charge. The surface of the bacteria and Mel is negatively charged, and they can adhere to the positively charged intestinal mucosal surface of the inflamed intestinal segment through electrostatic interaction. The intestinal mucosal barrier of the inflamed intestinal segment is damaged and the permeability is increased. Mel has strong mucosal adhesion ability, which can prolong the colonization and retention time in the inflamed intestinal segment. In addition, Escherichia coli is a dominant commensal bacterium in the intestine and has a certain active homing effect on the inflamed intestinal segment. These factors work together to promote the targeted colonization of EcN-Mel@SPIONs in the inflamed intestinal segment and prolong the retention time in the inflamed intestinal segment.

[0338] Example 7: Treatment of mice with acute radiation enteritis (ARN) using genetically engineered bacteria

[0339] 1. Establishment of Mouse ARN Model

[0340] The ARN model was established by exposing the abdomen of 6-8 week-old male C57BL / 6 mice to X-rays at a dose rate of 10 mGy / s (220 mV, 13 mA) for a total irradiation dose of 12 Gy.

[0341] Mice were randomly divided into 4 groups:

[0342] Healthy group (Control group): did not receive treatment;

[0343] ARN model group: X-ray irradiation;

[0344] EcN-Mel treatment group: X-ray irradiation + EcN-Mel treatment;

[0345] EcN treatment group: X-ray irradiation + EcN treatment;

[0346] Administration: EcN and EcN-Mel were administered orally 24 hours and 6 hours before X-ray irradiation; Dosage: The original bacterial solution with an OD600 value of 2-2.5 was concentrated 100 times and 10 μL / g (1x10 9 CFU / 100 μL) mouse body weight dose, 3 days after the end of different treatment regimens.

[0347] Schematic diagram of model establishment and treatment plan is shown in Figure 20 .

[0348] 2. Histochemical Analysis

[0349] (1) Method

[0350] Three days after the end of group treatment, mice were euthanized by carbon dioxide, and small intestinal tissue was obtained and immersed in 4% paraformaldehyde; after 24 hours, it was paraffin-embedded, sliced ​​with a thickness of 5 microns, and dewaxed; the intestinal tissue sections were subjected to tissue staining procedures according to standard procedures.

[0351] The general process of H&E staining is as follows: the tissue sections were immersed in hematoxylin staining solution for 3 minutes, stained with eosin for 1 minute, dehydrated, sealed, observed under an inverted microscope, photographed, and scored. The specific scoring criteria are shown in Table 3.

[0352] Table 3. Histological scoring scheme for ARN

[0353]

[0354]

[0355] The general process of Alcian blue staining (AB / PAS staining) includes dewaxing of paraffin sections, staining with Alcian blue, periodic acid staining, Schiff staining, hematoxylin staining, dehydration and mounting, microscopic observation, and image acquisition and analysis.

[0356] Immunohistochemical staining process: citric acid antigen retrieval, inactivation of endogenous peroxidase, antigen blocking, addition of primary antibody (incubation overnight at 4°C), addition of secondary antibody (Ki67 and Tunel) (incubation at 37°C for 30 minutes), diaminobenzidine (DAB) color development, dehydration, sealing, observation under an inverted microscope, and photography.

[0357] (2) Results

[0358] like Figure 21 Hematoxylin & eosin staining showed that

[0359] Compared with the mice in the healthy group, the small intestinal tissue of the mice in the model group showed severe morphological and structural abnormalities, including crypt atrophy and loss, basement membrane thickening, erosion and shedding of mucosal epithelial cells, exposure of the lamina propria, disappearance of normal goblet cells, and replacement by severe mucosal gland defects, mucosal ulcers and a large number of inflammatory cell infiltrations, indicating that the mouse ARN model was successfully established.

[0360] After EcN-Mel treatment, the arrangement of small intestinal mucosal epithelial cells and mucosal glands became neat and tight, with no obvious reduction or shedding, less inflammatory cell infiltration, and a significantly reduced histopathological score. However, after EcN treatment, there was no obvious relief, and the pathological score did not decrease significantly.

[0361] like Figure 22 As shown,

[0362] Compared with the healthy group, the small intestinal histopathological score of the IR group was significantly higher than that of the healthy group (P < 0.001), indicating that the ARN model was successfully established;

[0363] The small intestinal pathology score of the IR+EcN-Mel group was significantly lower than that of the IR group, P < 0.05;

[0364] There was no statistical difference in the small intestinal histopathological score between the IR+EcN group and the IR group, suggesting that no significant relief was observed in the ECN group.

[0365] like Figure 23 As shown,

[0366] The villus length of the small intestine tissue in the IR+EcN-Mel group was significantly higher than that in the IR group (P<0.05);

[0367] There was no statistical difference in the villus length of the small intestine tissue between the IR+EcN group and the IR group.

[0368] like Figure 24 As shown in the Alcian blue staining figure,

[0369] Compared with the healthy group, the model group mice showed significant collapse, destruction, and disappearance of the intestinal villi. After EcN-Mel treatment, the destruction of the small intestinal villi structure was significantly improved, intestinal mucosal damage was alleviated, and the number of goblet cells recovered, while the ECN group showed no significant improvement.

[0370] like Figure 25 As shown,

[0371] The number of goblet cells per crypt in the small intestine tissue of the IR+EcN-Mel group was significantly higher than that of the IR group (P < 0.01);

[0372] There was no statistical difference in the crypt depth of small intestinal tissue between the IR+EcN group and the IR group.

[0373] like Figure 26 Immunohistochemical staining of Ki67 in small intestine tissue of mice after 3 days of treatment Figure 24 Tunel immunohistochemical staining results showed that

[0374] The proliferation ability of small intestinal tissue cells in mice in the IR model group was reduced, and the number of apoptotic cells increased; after EcN-Mel treatment, the proliferation ability of small intestinal tissue cells was significantly increased, and the number of apoptotic cells decreased; no significant relief was observed in the ECN group.

[0375] like Figure 27 As shown,

[0376] The Ki67-positive cells in the small intestine of the IR+EcN-Mel group were significantly higher than those in the IR group (P<0.01);

[0377] There was no statistical difference in Ki67-positive cells in the small intestine tissue between the IR+EcN group and the IR group.

[0378] like Figure 28 As shown,

[0379] The number of Tunel-positive cells in the small intestine of the IR+EcN-Mel group was significantly higher than that of the IR group, P < 0.01;

[0380] like Figure 29 shown

[0381] There was no statistical difference in the number of Tunel-positive cells in the small intestine tissue of the IR+EcN group and the IR group.

[0382] The above results collectively indicate that EcN-Mel can effectively alleviate the histological abnormalities of ARN model mice, while no significant relief was observed in the ECN group.

[0383] Example 8: Detection of anti-inflammatory ability of genetically engineered bacteria

[0384] 1. Methods

[0385] An acute radiation enteritis (ARN) model was established in mice, and the mice were divided into four groups for drug administration. The ARN model and drug administration groups were the same as those in Implementation 7. Determination of inflammatory factors in the small intestinal tissue of mice: 3 days after the end of the treatment, the mice were euthanized by carbon dioxide, and the small intestinal tissue was collected, weighed, and homogenized in PBS at 4°C. The cells were centrifuged at 3000 rpm for 20 minutes at 4°C, and the supernatant was collected. The expression levels of representative inflammatory factors such as IL-6 and TNF-α in the small intestinal tissue homogenate were detected using an enzyme-linked immunosorbent assay kit.

[0386] 2. Results

[0387] like Figure 30 As shown, compared with the mice in the healthy group, the levels of TNF-α and IL-6 proinflammatory cytokines in the small intestinal tissue of the mice in the ARN model group were significantly increased;

[0388] Compared with the ARN model group, the levels of TNF-α and IL-6 in the EcN-Mel group were significantly decreased, with P values ​​of 0.001 and 0.01, respectively;

[0389] Compared with the ARN model group, the levels of TNF-α and IL-6 in the ECN group were decreased, with P values ​​of 0.05.

[0390] 3. Conclusion and Analysis

[0391] Conclusion: The inflammation in the EcN-Mel group was significantly reduced; the inflammation in the ECN group was alleviated.

[0392] Analysis: Excessive production of reactive oxygen species will stimulate the secretion of a variety of proinflammatory cytokines at the inflammatory site, thereby increasing the production of intracellular reactive oxygen species, forming a vicious cycle. The EcN-Mel group can significantly reduce the inflammation level of the small intestinal tissue of ARN model mice, while the EcN group has a weaker effect in alleviating small intestinal tissue inflammation.

[0393] Example 9: Effects of genetically engineered bacteria on intestinal flora

[0394] 1. Fecal intestinal flora analysis method

[0395] On the third day after the end of mouse treatment, fresh fecal samples were collected in sterile tubes and stored at -80°C for subsequent testing; fecal DNA was extracted using a DNA Microprep Kit according to the instructions; centrifuged at 10,000 rpm for 1 minute; the supernatant was collected, 1200 μL of DNA binding buffer was added, and the column was transferred to the IC-Z column, centrifuged twice (10,000 rpm for 1 minute), and the supernatant was discarded; 400 μL, 700 μL, and 200 μL of DNA wash buffer were added sequentially, and the column was washed three times, each at 10,000 rpm for 1 minute, and the supernatant was discarded; the IC-Z column was transferred to a 1.5 mL centrifuge tube, 10 μL of enzyme-free water was added, and the column was allowed to stand for 1 minute. The column was centrifuged at 10,000 rpm for 1 minute, and the supernatant was discarded; the column was centrifuged at 8,000 rpm for 1 minute, and the extracted DNA concentration was measured using a microspectrophotometer;

[0396] Design of PCR primers for bacterial 16S rDNA gene V4 region: According to the V4 sequencing region, specific primers (V4: 515F-806R) were synthesized.

[0397] 515-F: 5′-GTGCCAGCMGCCGCGGTAA-3′ (SEQ ID No. 33);

[0398] 806-R: 5′-GGACTACHVGGGTWTCTAAT-3′ (SEQ ID No. 34).

[0399] PCR amplification, product identification, recovery, and fluorescence quantification were performed according to standard protocols. Library construction was performed according to the TruSeq DNA PCR-Free Sample Preparation Kit instructions, followed by HiSeq high-throughput gene sequencing. In-depth analysis of species community diversity, taxonomy, and abundance was performed.

[0400] 2. Results

[0401] like Figure 31 The LDA EffectSize analysis shown in the figure and the linear discriminant analysis (LEfSe) or LDA-LEfSe analysis show that

[0402] Compared with the healthy group (control), the IR group showed a decrease in Bacteroidetes, an increase in Proteobacteria, and an upregulation of the abundance of enteropathogenic bacteria, which reflected the characteristics of intestinal microbiota imbalance in the IR group.

[0403] Compared with the IR group, EcN-Mel treatment significantly increased the abundance of Verrucomicrobia (such as Akkermansia). This specific microbial regulation synergistically interacted with the antioxidant function of EcN-Mel: on the one hand, the proliferation of Akkermansia may enhance intestinal barrier function. On the other hand, increased Akkermansia abundance has been reported to be associated with reduced intestinal ROS levels, suggesting that it may indirectly improve the intestinal microenvironment by alleviating oxidative stress.

[0404] EcN treatment: partially reversed the harmful bacterial flora changes in the IR group, but the effect was weaker than that of EcN-Mel intervention alone.

[0405] like Figure 32 As shown, the control group (healthy control group) was dominated by Bacteroidetes and Firmicutes, with a lower proportion of Proteobacteria. Compared with the healthy control group, the Proteobacteria were significantly higher in the IR model group than in the EcN-Mel group, suggesting that opportunistic pathogens may increase under inflammatory conditions. Furthermore, Verrucomicrobia were significantly lower in the IR group than in the EcN-Mel group, indicating that inflammation leads to a decrease in beneficial bacteria. Compared with the control group, the proportion of Bacteroidetes decreased, while the proportion of Proteobacteria increased. These results reflect the characteristics of the dysbiosis of the intestinal microbiota in the IR group.

[0406] Compared with the IR group, the Verrucomicrobia in mice treated with EcN-Mel was significantly higher than that in the IR group, suggesting that EcN-Mel may promote the proliferation of beneficial bacteria such as Akkermansia.

[0407] The proportion of potentially harmful bacteria, Proteobacteria was slightly higher than that in the Control group, but the difference was not significant.

[0408] Compared with the IR group, the proportion of Verrucomicrobia after EcN treatment was intermediate between the IR and EcN-Mel groups, suggesting that EcN may partially restore beneficial bacteria. The proportion of Bacteroidetes remained lower than in the control group, but higher than in the IR group. The proportion of harmful bacteria, Proteobacteria, was lower than in the IR group but higher than in the control group.

[0409] Comparative Example 1: Construction of genetically engineered bacteria using tyrosinase from other sources

[0410] The construction of the pykA gene knockout strain E. coli Nissle 1917ΔpheAΔtrpRΔpykA is shown in Example 1.

[0411] Tyrosinase from Bacillus megaterium and E. coli Nissle 1917 ΔpheA ΔtrpR ΔpykA were used to construct the strain E. coli Nissle 1917 overexpressing the Tyr1 gene. The operation was carried out in accordance with Example 1.

[0412] Results: As Figure 33 As shown, under the same culture conditions of the strain using tyrosinase from Bacillus megaterium, the color of the test tube is lighter than that of tyrosinase VsTYR (M235A / N229H) from Verrucomicrobium spinosum, indicating that the tyrosinase from Verrucomicrobium spinosum has higher catalytic efficiency. The melanin production of genetically engineered bacteria constructed with tyrosinase from Bacillus megaterium is low, so this solution was not selected.

[0413] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria is a genetically engineered bacteria that expresses a tyrosinase gene, and the nucleotide sequence of the genetically engineered bacteria plasmid is shown in SEQ ID No. 33; The tyrosinase gene is a gene obtained by optimizing the VsTYR (M235A / N229H) gene according to the codon preference of Escherichia coli, and its nucleotide sequence is shown in SEQ ID No. 30; The VsTYR (M235A / N229H) gene is a mutant gene of the VsTYR gene, and its amino acid sequence is shown in SEQ ID No. 29; The VsTYR gene is a tyrosinase gene derived from Verrucomicrobium spinosum, and its amino acid sequence is shown in SEQ ID No.

28. The NCBI accession number of the VsTYR gene is MK550618.1; The starting bacteria of the genetically engineered bacteria are Escherichia coli with pheA gene, trpR gene and pykA gene knocked out, the Escherichia coli is E. coli Nissle 1917, and the E. coli Nissle 1917 is a probiotic.

2. The method for preparing the genetically engineered bacteria according to claim 1, wherein: The CRISPR / Cpf1 gene editing method is used to integrate the VsTYR (M235A / N229H) gene optimized according to the codon preference of Escherichia coli into the starting bacteria of the genetically engineered bacteria.

3. Use of the genetically engineered bacteria as claimed in claim 1 in the biological preparation of drugs for treating acute radiation enteritis.

4. The use according to claim 3, characterized in that: The genetically engineered bacteria have a broad-spectrum scavenging ability for free radicals DPPH·, ·OH, O2·-, H2O2 and ·NO.

5. The use according to claim 3, characterized in that: The genetically engineered bacteria can reduce the inflammation level of small intestinal tissue in mice with acute radiation enteritis model.

6. The use according to claim 3, characterized in that: The colonization concentration of the genetically engineered bacteria in the abdomen of acute radiation enteritis model mice is more than three times higher than that of Escherichia coli E. coli Nissle 1917, and the melanin is continuously released for more than 24 hours.

7. The use according to claim 3, characterized in that: The genetically engineered bacteria increase the beneficial bacteria Verrucomicrobia in the intestinal flora of acute radiation enteritis model mice and reduce the harmful bacteria Bacteroidetes.

8. The use according to any one of claims 3 to 7, wherein the drug for treating acute radiation enteritis is an oral liquid preparation.

9. The use according to claim 3, characterized in that: The melanin produced by the genetically engineered bacteria has no significant effect on the survival activity of HiEC cells when taken orally, and has good biocompatibility at the cellular level.

10. The use according to claim 3, characterized in that: Oral administration of the genetically engineered bacteria has no significant effect on routine blood indicators; and has no significant effect on the histological structure of major organs.

Images