Primer of molecular marker of klhl14 gene related to piglet number trait and application thereof

By screening for the KLHL14 gene molecular marker at position 116519102 of pig chromosome 6, and using PCR amplification and Sanger sequencing technology, the problem of rapid screening for weak piglets was solved, improving breeding efficiency and the survival rate of healthy piglets.

CN120719035BActive Publication Date: 2026-04-17NANJING AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING AGRICULTURAL UNIVERSITY
Filing Date
2025-08-15
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately screen the number of weak piglets at multiple stages of pig growth, which affects the reproductive efficiency and economic benefits of sows.

Method used

A molecular marker for the KLHL14 gene associated with the number of weak piglets was provided. The SNP site located at 116519102 bases on chromosome 6 of pigs was screened through genome-wide association analysis. Specific primers were designed for PCR amplification and Sanger sequencing to detect the genotype of pigs.

Benefits of technology

This technology enables rapid and accurate identification of weak piglets, improves breeding efficiency, reduces feeding costs, increases the survival rate of healthy piglets, and provides a scientific basis for pig breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120719035B_ABST
    Figure CN120719035B_ABST
Patent Text Reader

Abstract

This invention relates to primers for a molecular marker of the KLHL14 gene associated with the weak piglet count trait in pigs and its applications, belonging to the field of biotechnology. The KLHL14 gene molecular marker of this invention is located at base 116519104 on chromosome 6 of the pig reference genome Sscrofa 11.1 version, with a base mutation of C or T, resulting in genotypes of C / C, C / T, and T / T. This invention utilizes forward and reverse primer pairs to amplify fragments containing the aforementioned molecular marker site, and performs Sanger sequencing on the amplified products for rapid and accurate identification of individual genotypes. This molecular marker can serve as a genetic marker for pig breeding, enabling the selection of pigs with fewer weak piglets. It can efficiently and accurately detect the weak piglet count trait in pigs, improve the survival rate of healthy piglets in pig herds, and has significant value for pig breeding and production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to primers for a molecular marker of the KLHL14 gene associated with the weak piglet number trait in pigs and their applications, belonging to the field of biotechnology. Background Technology

[0002] The number of weak piglets, as a key indicator of sow reproductive efficiency, directly affects the survival probability of piglets and subsequent pork production costs, making it an indispensable part of sow breeding. Weak piglets typically refer to those with a birth weight of less than 1 kg and excluding genetic defects. Their occurrence is closely related to various factors, including but not limited to the sow's parity, litter size, farrowing interval, assisted delivery methods, the number of effective teats of the sow, the quality of care for newborn piglets, and environmental stress conditions.

[0003] Studies reveal that sows exhibit optimal reproductive performance during their 3rd to 7th parity, while sows with 1st to 2nd parity and those with more than 8 parities show relatively weaker disease resistance. As the parity of a sow increases, although the number of piglets per litter rises, the proportion of weak piglets and stillbirths also increases, a phenomenon particularly pronounced in sows after their 6th parity. First-parity sows, due to uterine volume limitations, when the number of fetuses exceeds a certain threshold (e.g., more than 12), some fetuses suffer from developmental problems due to insufficient space and nutrient supply, leading to an increase in weak piglets. Furthermore, prolonged labor, physical injury during assisted delivery, insufficient number of effective teats, improper lactation management, and environmental stress can all contribute to the development of weak piglets. Summary of the Invention

[0004] The purpose of this invention is to address the shortcomings of existing technologies by proposing a primer for the KLHL14 gene molecular marker associated with the trait of weak piglets in pigs, and its application, enabling rapid and accurate screening of weak piglets at multiple stages. The KLHL14 gene, associated with retinol transport function, plays a particularly prominent role in the reproductive system. Studies have shown that KLHL14 plays a key regulatory role in the proliferation, migration, and apoptosis of endometrial epithelial cells and stromal cells, thereby affecting the embryo implantation process and being closely related to piglet size. Furthermore, KLHL14 also participates in the regulation of sperm quality and boar reproductive traits, influencing testicular morphology and spermatogenesis. These findings suggest a profound intrinsic link between the KLHL14 gene and the formation of weak piglets.

[0005] Given that weak piglets face a higher risk of mortality due to their frail health, this not only wastes sow reproductive and feed resources but may also exacerbate the spread of diseases on pig farms, harming the overall economic benefits. Therefore, accurately identifying genotypes associated with the KLHL14 gene using advanced molecular marker technology and applying them to early breeding selection is expected to shorten the breeding cycle, reduce feeding costs, improve resource utilization efficiency, and provide strong support for the sustainable development of the pig industry.

[0006] This invention statistically analyzed the number of weak piglets in pigs, used second-generation sequencing technology to perform whole-genome SNP genotyping, and screened the KLHL14 gene molecular marker, which is significantly associated with the trait of weak piglet count, through genome-wide association analysis, providing new gene and molecular marker resources for the breeding of healthy piglet count.

[0007] The present invention solves the technical problem through the following technical solution: First, it provides a molecular marker for the KLHL14 gene associated with the number of weak piglets. The molecular marker is located at the 116519102nd base of pig chromosome 6, with a base mutation of C or T. The sequence is shown as the 312th base of SEQ ID NO:3 or SEQ ID NO:4. The nucleotide sequences of the pig DNA-specific primer pairs required for molecular marker detection are shown as SEQ ID NO:1 and SEQ ID NO:2.

[0008] This invention further provides applications of the KLHL14 gene molecular marker associated with the number of weak piglets in pigs, including the detection of SNP genotypes associated with the number of weak piglets in pigs. Specifically, a method for detecting SNP genotypes associated with the trait of weak piglet count using PCR amplification combined with Sanger sequencing includes the following steps:

[0009] Step 1: Provide a pig DNA sample to be tested, and perform PCR amplification using DNA-specific primers designed for the KLHL14 gene molecular marker to obtain the amplification product. The pig DNA sample to be tested contains an SNP molecular marker at position 116519102 on pig chromosome 6.

[0010] The second step is to perform Sanger sequencing on the PCR products.

[0011] The third step is to determine the SNP molecular marker genotype at position 116519102 on chromosome 6 of pig based on the sequencing results from the second step.

[0012] The deoxyribonucleotide sequence of the DNA-specific primer pair mentioned in the first step is as follows:

[0013] Upstream primer: 5'-AGCCAAAATAAGTGCTTGCCT-3' (SEQ ID NO: 1)

[0014] Downstream primer: 5'-GGTGGACGGAATGAAACTGG-3' (SEQ ID NO: 2)

[0015] The amplification product described in the first step is 630 bp in length and contains the 116519102nd base on chromosome 6 of pig.

[0016] The final concentration of the reaction system (25 μl) is:

[0017] 50 ng of pig DNA to be tested

[0018] 2 x Accurate Taq Master Mix 12.5 μl

[0019] upstream primer 1 μl

[0020] 1 μl of downstream primer

[0021] Add sterile water to a final volume of 25 μl.

[0022] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; and storage at 4℃.

[0023] In the third step, the criteria for judgment are that the number of weak piglets in T / T genotype pigs at each stage is lower than that in C / T and C / C genotype pigs, and the number of weak piglets in C / T genotype pigs at each stage is lower than that in C / C genotype pigs.

[0024] This invention reveals that at a specific locus in the KLHL14 gene, pigs with a particular genotype have a significantly lower number of weak piglets compared to individuals with other genotypes. Specifically, T / T genotype pigs have a lower number of weak piglets at all stages of development compared to C / T and C / C genotype individuals, and C / T genotype pigs have a lower number of weak piglets at all stages of development compared to C / C genotype individuals. This discovery provides new genetic markers and selection methods for pig breeding and production.

[0025] To achieve rapid and accurate identification of the number of weak piglets, this invention uses genomic DNA from the pigs to be tested as a template and employs specific primers for PCR amplification. These specific primers are designed based on SNP sites in the KLHL14 gene associated with the target trait, and can accurately amplify DNA fragments containing these SNP sites. Subsequently, the PCR amplification products are subjected to Sanger sequencing, and the sequencing results can determine the SNP molecular marker genotype of the pig KLHL14 gene.

[0026] In pig breeding, depending on the breeding objectives, breeders can eliminate individuals with the C / T and C / C genotypes while retaining those with the T / T genotype. The beneficial effect is that this molecular marker can serve as a genetic marker for pig breeding, thereby selecting pigs with a higher number of healthy piglets. This method not only efficiently and rapidly identifies the weak piglet number trait but also significantly improves the survival rate of healthy piglets in a herd, providing a scientific basis for early pig selection and possessing significant value for pig breeding. Furthermore, the detection method disclosed in this invention is simple and easy to operate, and can be widely implemented under laboratory conditions, greatly facilitating pig breeding and production practices. Attached Figure Description

[0027] Figure 1 Manhattan plots show the longitudinal trait correlation analysis of the number of weak piglets in four periods.

[0028] Figure 2 These are Sanger sequencing results of PCR amplification products from three genotypes. Detailed Implementation

[0029] The following examples are applicable to the breeding of pigs.

[0030] Example 1: In this example, the number of weak piglets was detected in 500 Large White pigs. Genome-wide SNP genotyping was performed using next-generation sequencing technology. Genome-wide association analysis was used to screen for the KLHL14 gene molecular marker, which was significantly associated with the number of weak piglets. The results are as follows: Figure 1 As shown.

[0031] This embodiment uses the following experiments to identify and apply the KLHL14 gene molecular marker related to the number of weak piglets in pigs.

[0032] 1. Phenotyping and Genotyping

[0033] (1) Experimental materials and determination of weak offspring number phenotype

[0034] Five hundred Large White pigs were selected as experimental animals and raised under the same feeding conditions. Throughout the process, they were given free access to food and water. The number of weak piglets in each of the five hundred pigs was recorded as phenotypic data on the number of weak piglets.

[0035] (2) Extraction of genomic DNA

[0036] ① Take about 25 mg of ear tissue into a centrifuge tube, add it to a 1.5 ml centrifuge tube, add 400 µl of buffer digestion, and vortex to mix. Incubate at 65°C for 1 h until the cells are completely lysed.

[0037] ② Add 20 μL of Proteinase K solution, vortex to mix, and place in a 56℃ water bath for digestion overnight.

[0038] ③ Add 200 µl of Buffer PA, mix thoroughly by inverting, and place in a -20°C refrigerator for 5 min.

[0039] ④ Centrifuge at 10,000 rpm for 5 min at room temperature, and transfer the supernatant (500-550 µl) to a new 1.5 ml centrifuge tube.

[0040] ⑤ Add an equal volume of isopropanol, invert 5-8 times to mix thoroughly, and let stand at room temperature for 2-3 minutes. Centrifuge at 10,000 rpm for 5 minutes at room temperature and discard the supernatant.

[0041] ⑥ Add 1 ml of 75% ethanol, rinse by inversion for 1-3 min, centrifuge at 10,000 rpm for 2 min, and discard the supernatant.

[0042] ⑦ Repeat step 6.

[0043] ⑧ Open the lid and invert at room temperature for 5-10 minutes until any residual ethanol has completely evaporated. ⑨ Dissolve the obtained DNA in 50-100 µl of TE buffer. The extracted DNA can be used immediately for the next experiment or stored at -20°C.

[0044] ⑩ Determine the concentration. After measuring the mass and concentration with a spectrophotometer, dilute the concentration to 50 ng / μL and store at -20℃ for later use.

[0045] (3) PCR amplification

[0046] Using the extracted genomic DNA as a template, the fragment containing base 116519102 of chromosome 6 was amplified.

[0047] Upstream primer: 5'-AGCCAAAATAAGTGCTTGCCT-3' (SEQ ID NO: 1)

[0048] Downstream primer: 5'-GGTGGACGGAATGAAACTGG-3' (SEQ ID NO: 2)

[0049] The final concentration of the reaction system (25 μl) is:

[0050] DNA to be tested 50 ng

[0051] 2 x Accurate Taq Master Mix 12.5 μl

[0052] upstream primer 1 μl

[0053] 1 μl of downstream primer

[0054] Add sterile water to a final volume of 25 μl.

[0055] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; storage at 4℃; 10 μl was used for agarose gel assay, and a single target band of 630 bp was obtained. The amplified product contained the SNP marker at position 116519102 on porcine chromosome 6.

[0056] The amplified product sequence is shown in SEQ ID NO: 3.

[0057] GTTGACATCATTATTCATTTCTTTAATGTGTGTGGTAACTTCAGAGTAATCCTATCTGCAGGAGAGCCAAAATAAGTGCTTGCCTAAGGGTACTGCTAATTTACACAGAGTGGATTTTATTTGGTCAACATGTTTTTTACTTGGTTAACTATGATTA TCTAACGAGAAACCCCTAGCAAGAGGCATGAGATGCAAATGTTATTGTGATTTAAAAAAAAAAAAAAAGACCTTTCAAATGATTTCCTCCAATTGCATACAAGCGATCATTCATTACAGCCAAAGTGTGGATGGCACGTTTTGTGTTCATATCTTG TTTTCGAGCCCAGACATCCATGACGGGGTCATAGCAATAGAGCCATGGGACATATTCTCCATTGTGTACACCCCCTGTGAGTTAAACATAGACATACAAGTCAAGAAAGTGCTTGGGAACTGAATTTTGTAACAGAAAGCAGAGGAATGACTTGCCT GAAATGTATATTTTCCCATTGTGCACTGCTCCCGCATGAGCTGCCAGAGGCTGGGGCAAAGAGGACACGTAACGCCATTCATTTGTTTCTAGGTTATAGCACTCCACGCTGGACAAGTAGCCAGTTTCATTCCGTCCACCAATAACGTATAAGTGTTT

[0058] Or as shown in SEQ ID NO: 4

[0059] .

[0060] (4) Sanger sequencing and genotyping

[0061] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak diagrams of different genotypes were obtained as follows: Figure 2 As shown.

[0062] (5) Genotyping and genome-wide association analysis of 60K SNP microarray in the pig genome

[0063] Genotyping of pigs was performed according to the company's standard procedures. The "Zhongxin-1" 50K SNP chip was used to detect SNP genotypes in breeding pigs with weak litter number determination records. Quality control was performed on all SNP marker detection results. Genome-wide association analysis revealed that significant SNPs at the genome level were concentrated on pig chromosome 6.

[0064] 2. Correlation analysis

[0065] Five hundred Large White pigs with clear records of the weak piglet number phenotype were selected, and the number of weak piglets was recorded for each of the 500 individuals. The ANOVA test function of R 4.2 statistical plotting software was used for statistical testing. The pairwise mean comparison mode was selected to statistically test the genotype and weak piglet number trait in the experimental pig herd. P < 0.05 indicated a significant difference. The results showed that the mean number of weak piglets in T / T genotype individuals was 0.45, lower than the 0.52 in C / T genotype individuals and the 0.55 in C / C genotype individuals (P < 0.05). The results indicate that the KLHL14 gene molecular marker in pigs is significantly correlated with the weak piglet number trait. Based on actual breeding goals, selecting pigs with fewer weak piglets in the T / T genotype can improve the survival rate and uniformity of piglets in the herd, thereby improving breeding efficiency.

[0066] In addition to the above-described embodiments, the present invention may have other implementations. All technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope claimed by the present invention.

Claims

1. The application of a primer for a KLHL14 gene molecular marker associated with the weak piglet number trait in the detection of SNP genotypes related to the weak piglet number trait in Large White pigs, characterized in that: The molecular marker is located at the 312th base of the sequence shown in SEQ ID NO:3 or SEQ ID NO:4, with a base mutation of C or T, and the genotypes are C / C, C / T, and T / T.

2. The primer of the KLHL14 gene molecular marker related to the piglet number trait according to claim 1 is applied to the detection of the SNP genotype related to the piglet number trait of Large White pigs, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO:1 and SEQ ID NO:

2.

3. The primer of the KLHL14 gene molecular marker related to the piglet number trait according to claim 1 is applied to the detection of the SNP genotype related to the piglet number trait of Large White pigs, characterized in that: The detection method includes the following steps: The first step is to perform PCR amplification on the DNA sample of the pig to be tested using the SNP primers shown in SEQ ID NO:1-2, and obtain an amplification product with the molecular marker located at the 312th base of the sequence shown in SEQ ID NO:3 or SEQ ID NO:4, and the length of the amplification product is 312bp. The second step is to perform Sanger sequencing on the PCR products. The third step is to determine the genotype of the molecular marker based on the sequencing results from the second step.

4. The primer of the KLHL14 gene molecular marker related to the piglet number trait according to claim 3 is applied to the detection of the SNP genotype related to the piglet number trait of Large White pigs, characterized in that: The PCR reaction system in the first step is calculated in 25 μl units, and the system is as follows: 50 ng of pig DNA to be tested 2 x Accurate Taq Master Mix 12.5μl upstream primer 1 μl 1 μl of downstream primer Add sterile water to a final volume of 25 μl.

5. The primer of the KLHL14 gene molecular marker related to the piglet number trait according to claim 3 is applied to the detection of the SNP genotype related to the piglet number trait of Large White pigs, characterized in that: The PCR amplification reaction conditions in the first step are: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; and storage at 4℃.

6. The application of the primers for the KLHL14 gene molecular marker associated with the weak piglet number trait in claim 3 in the detection of SNP genotypes related to the weak piglet number trait in Large White pigs, characterized in that: The criteria for the third step are that the number of weak piglets in T / T genotype pigs at each stage is lower than that in C / T and C / C genotype pigs, and the number of weak piglets in C / T genotype pigs at each stage is lower than that in C / C genotype pigs.

Citation Information

Patent Citations

  • Primer of RBP4 gene molecular marker related to pig weak litter number character and application of primer

    CN120700164A