Use of a small molecule antagonist of the cgpr receptor in the preparation of a medicament for the treatment of chronic rhinosinusitis with nasal polyps
Local administration of small molecule CGRP receptor antagonists addresses the shortcomings of existing targeted biologics, providing a highly effective, safe, and economical treatment option for eosinophilic chronic sinusitis with nasal polyps.
Patent Information
- Application Number
- CN202511247590.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-03
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2045-09-03
AI Technical Summary
Existing targeted biologics are not effective enough for patients with eosinophilic chronic sinusitis and nasal polyps, have a narrow range of applications, high treatment costs, and pose safety risks.
Using small molecule antagonists of CGRP receptors, by intervening in the pro-inflammatory effects of the neuropeptide CGRP, a spray formulation, nasal drops, or rinsing solution is prepared for local administration to treat eosinophilic chronic sinusitis with nasal polyps.
It significantly reduces local inflammation of nasal polyps, is low in cost, highly safe, has good patient compliance, and avoids systemic side effects.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of biological medicine, in particular to the technical field of therapeutic drugs for eosinophilic chronic rhinosinusitis with nasal polyps, and more particularly to application of a CGRP receptor small molecule antagonist in preparation of a drug for treating eosinophilic chronic rhinosinusitis with nasal polyps. BACKGROUND
[0002] Chronic rhinosinusitis with nasal polyps (CRSwNP) is a chronic inflammatory disease mainly occurring in the nasal mucosa and accompanied by the formation of polyps.
[0003] In view of the type 2 cytokines and eosinophilic inflammation in nasal polyps, in recent years, a number of phase II or III clinical studies have shown that targeted biologics (such as dupilumab and mepolizumab) that block type 2 cytokines (including anti-IL-5R, anti-IL-4Rα and anti-IgE) exhibit encouraging efficacy in patients with eosinophilic CRSwNP who are dominated by type 2 inflammation and have poor response to glucocorticoid therapy: they can significantly reduce polyp size, improve clinical symptoms and reduce the probability of reoperation. However, the limitations of existing targeted biologics are also very prominent:
[0004] First, they are only effective for 40%-60% of patients with high expression of type 2 inflammation, and have no significant improvement for patients with non-type 2 inflammation or low response;
[0005] Second, biologics need to be administered by injection for a long time (such as dupilumab, which is administered by subcutaneous injection once every 2 weeks), and the annual treatment cost is as high as 100-200 thousand yuan, which is a heavy burden for patient compliance and economic burden;
[0006] Third, some patients may have hypersensitivity reactions (such as redness and swelling at the injection site, and systemic skin rash), which pose a safety hazard. These defects suggest that there is an urgent need to develop new action targets or drugs for the formation mechanism of eosinophilic inflammation in nasal polyps.
[0007] Nasal epithelial cells, as the first line of defense of nasal mucosal immunity, not only serve as a barrier structure, but also have a key immune regulatory function, and are the core cells in regulating eosinophilic inflammation of nasal polyps. However, epithelial cells are highly heterogeneous, and it is still unclear which types of epithelial cells are involved in the regulation of eosinophilic inflammation. In recent years, new technologies such as single-cell sequencing have revealed that respiratory epithelial cells contain multiple subpopulations, in addition to the common basal cells, ciliated cells and goblet cells, there are also isolated chemosensory cells, neuroendocrine cells (pulmonary neuroendocrine cell, PNEC) and other special types. Neuroendocrine cells can sense oxygen, mechanical stretching, chemical substances and other stimuli, and release calcitonin related polypeptide (CGRP), gastrin releasing peptide (GRP), chromogranin A (CHGA) and synaptophysin (SYP) and other neuropeptides when activated. These neuropeptides have immune regulatory functions, for example, CGRP has been shown to promote the secretion of inflammatory factors by activating ILC2, macrophages and other immune cells. However, existing studies have focused on the role of CGRP in diseases such as migraine and asthma (such as CGRP receptor antagonists have been approved for use in migraine prevention), and its pathological mechanism in CRSwNP (especially the regulatory effect on eosinophilic inflammation) and therapeutic potential have not been systematically studied, creating a significant technical gap.
[0008] Currently, there is no drug reported for treating nasal polyps by using neuropeptides (especially CGRP). Based on the above background, the research and development of new therapeutic targets (such as neuropeptide CGRP) for eosinophilic inflammation in CRSwNP has important clinical significance and innovative value in overcoming the deficiencies of existing biological agents, such as insufficient efficacy, narrow application range, etc. SUMMARY
[0009] The purpose of the present application is to overcome the deficiencies of existing glucocorticoids and targeted type 2 cytokine biological agents, such as insufficient efficacy, narrow application range, and high treatment cost for some patients with eosinophilic chronic rhinosinusitis with nasal polyps, and to provide a use of a CGRP receptor small molecule antagonist in the preparation of a drug for treating eosinophilic chronic rhinosinusitis with nasal polyps. The CGRP receptor small molecule antagonist of the present application can effectively treat eosinophilic chronic rhinosinusitis with nasal polyps by interfering with the pro-inflammatory effect of neuropeptide CGRP, providing a more precise, economical and safe treatment option for patients with eosinophilic chronic rhinosinusitis with nasal polyps.
[0010] To achieve the above object, the present application provides the following technical solutions:
[0011] 1. Application of small molecule CGRP receptor antagonists
[0012] This invention provides the application of a CGRP receptor small molecule antagonist in the preparation of a medicament for treating eosinophilic chronic sinusitis with nasal polyps. The CGRP receptor small molecule antagonist is a small molecule compound that binds to the CGRP receptor CRLR (capable of specifically inhibiting CGRP).
[0013] Furthermore, the CGRP receptor small molecule antagonist has a molecular weight ≤1000 Da.
[0014] Furthermore, the CGRP receptor small molecule antagonist is Olcepanet.
[0015] 2. Pharmaceutical preparations for treating eosinophilic chronic sinusitis with nasal polyps
[0016] The present invention also provides a pharmaceutical preparation for treating eosinophilic chronic sinusitis with nasal polyps, comprising an effective amount of the CGRP receptor small molecule antagonist as described above.
[0017] Furthermore, in the pharmaceutical formulation, the effective concentration of the CGRP receptor small molecule antagonist is 2~5 μM.
[0018] Furthermore, in the pharmaceutical formulation, the effective concentration of the CGRP receptor small molecule antagonist is 3 μM.
[0019] Furthermore, it also includes pharmaceutically acceptable excipients.
[0020] Furthermore, the excipients are any one of physiological saline, glucose, vitamin C, and amino acids.
[0021] Furthermore, the pharmaceutical preparation is a spray, nasal drop, or rinse.
[0022] Furthermore, the spray formulation is any one of an atomizing agent, a spray, and a suspension.
[0023] The preparation method of the above-mentioned pharmaceutical formulation (taking the spray formulation as an example):
[0024] ① Weigh out a small molecule antagonist of CGRP receptor (purity ≥98%) and dissolve it in physiological saline (pH 6.5-7.5) at a concentration of 3μM.
[0025] ② Add vitamin C (0.1% w / v) as an antioxidant and stir until completely dissolved;
[0026] ③ After being sterilized by filtration through a 0.22μm sterile filter membrane, it is dispensed into a high-pressure spray device, 10mL per bottle;
[0027] After sealing, the above-mentioned drug preparations underwent sterility testing (compliant with the sterility testing methods of the 2025 edition of the Chinese Pharmacopoeia) and CGRP antagonist concentration detection (HPLC method, deviation ≤ ±5%). The quality control standards are as follows:
[0028] ① pH value: 6.5-7.5 (pH determination method according to the 2025 edition of the Chinese Pharmacopoeia);
[0029] ② Sterility: Must pass a sterility test (no bacterial or fungal growth);
[0030] ③ Active drug content: The concentration of the CGRP receptor small molecule antagonist is 3μM±0.15μM (HPLC method);
[0031] ④Stability: After being stored at room temperature (25℃) for 6 months, the degradation rate of the active pharmaceutical ingredient is ≤5% (accelerated test verification).
[0032] The principle of this invention
[0033] This invention, through systematic research, reveals the abnormal expression of nasal mucosal PNECs and their secreted CGRP in Eos CRSwNPs and their mechanism of action in type 2 inflammation.
[0034] 1. This invention, through immunofluorescence staining and quantitative analysis using ImageJ image analysis software, revealed that the distribution density of PNECs in the nasal mucosa of Eos CRSwNP patients was significantly higher than that in the normal control group, while there was no significant difference between the Non-Eos CRSwNP group and the normal control group. Further RT-PCR detection showed that the mRNA expression levels of the PNEC lineage-determining transcription factor ASCL1 and the neuropeptide CGRP were significantly upregulated in the Eos CRSwNP group. ELISA verification showed that the CGRP protein expression level was significantly increased in the Eos CRSwNP group. Immunofluorescence co-localization showed that CGRP in the nasal mucosal epithelial tissue mainly originated from PNECs. In summary, this indicates that PNECs and their secreted CGRP are abnormally highly expressed in Eos CRSwNP.
[0035] 2. This invention, through expression correlation analysis, shows that in CRSwNP tissue, the expression levels of PNEC and its secreted CGRP are significantly positively correlated with the mRNA expression levels of IL-5 and IL-13. The mRNA expression of ASCL1 and CGRP also shows a clear positive correlation with the expression of IL-5 and IL-13, suggesting that PNEC and its secreted CGRP may play an inducing role in the type 2 inflammatory response of CRSwNP.
[0036] 3. Immunofluorescence staining analysis revealed that CRLR and RAMP1, components of the CGRP receptor complex, are co-localized and expressed in mast cells. Furthermore, the number of PGP9.5-positive PNECs in nasal polyps was positively correlated with the number of Tryptase-positive mast cells, suggesting that mast cells may serve as downstream target cells for CGRP and may exhibit functional responsiveness to CGRP stimulation.
[0037] 4. This study found that both CRLR and RAMP1 are expressed in mouse bone marrow-derived mast cells (BMMCs). CGRP significantly promotes BMMC degranulation, as evidenced by a significant upregulation of β-aminohexokinase levels in the culture supernatant. CGRP stimulation of BMMCs activates the cAMP-PKA-pCREB downstream signaling pathway, and increases the mRNA expression levels of Il-5 and Il-13 in BMMCs, indicating that CGRP may promote the production of type 2 inflammatory factors by mast cells. In vivo animal experiments show that mast cells play a key role in CGRP-mediated type 2 upper airway inflammation, and CRLR antagonists can significantly alleviate the inflammatory response.
[0038] 5. The small-molecule CRLR antagonist Olcepent, administered intranasally to mice, significantly alleviated papain-induced type 2 inflammatory responses, reduced eosinophil infiltration and goblet cell proliferation in tissues, and decreased the expression levels of IL-5 and IL-13 in nasal tissues. These results indicate that PNEC-derived CGRP plays an important role in maintaining upper airway type 2 inflammation, and CRLR antagonists have potential clinical application value.
[0039] In summary, this invention reveals the abnormal expression of PNEC and its secreted CGRP in Eos CRSwNP and its key role in type 2 inflammation. In vivo experiments have verified the anti-inflammatory effect of CRLR antagonists, providing a theoretical basis and potential application value for developing therapeutic strategies targeting the CGRP signaling pathway.
[0040] Beneficial effects of the present invention
[0041] 1. Clear therapeutic effect: The CGRP receptor small molecule antagonist of the present invention can significantly reduce the local inflammation of nasal polyps in patients with eosinophilic chronic sinusitis and nasal polyps by blocking the pro-inflammatory effect of CGRP on mast cells, thus making up for the deficiency of existing biological agents that are ineffective in 40%-60% of patients.
[0042] 2. Economy and safety: Small molecule compounds have mature synthesis processes and low costs, and their systemic side effects are avoided by local administration (spray / nasal drops / rinse), making them safer than biological agents that require long-term injection.
[0043] 3. Convenient to use: The drug preparation is in the form of spray, nasal drops or rinse, which is easy to administer and can be used by patients themselves, significantly improving treatment compliance. Attached Figure Description
[0044] Figure 1 Immunofluorescence images of PNEC distribution in ethmoid sinus mucosa / nasal polyp epithelial tissue of normal controls and patients with nasal polyps, as well as PNEC lineage-determining transcription factors ASCL1 and neuropeptide CGRP (encoding gene: CALCA A diagram illustrating the level of expression;
[0045] Where A is the tissue distribution diagram of PNEC (left figure) and the corresponding statistical diagram (right figure);
[0046] B is a schematic diagram showing how the PNEC lineage determines the mRNA expression level of the transcription factor ASCL1;
[0047] C is a schematic diagram showing the mRNA expression level of the neuropeptide CGRP;
[0048] D is a schematic diagram showing the protein expression level of the neuropeptide CGRP;
[0049] E is a schematic diagram of the immunofluorescence co-localization of PGP9.5 and CGRP in nasal mucosal epithelial tissue;
[0050] In the figure, Control: control group; Eos CRSwNP: eosinophilic chronic sinusitis with nasal polyps; Non-Eos CRSwNP: non-eosinophilic chronic sinusitis with nasal polyps; PGP9.5: protein gene product 9.5; DAPI: 4,6-biamidin-2-phenylindole; ASCL1: basic helical-loop-helical transcription factor 1 of the non-setrobanoid family; CALCA: calcitonin gene-related peptide α (encoding CGRP gene); CGRP: calcitonin gene-related peptide.
[0051] express P <0.05, express P <0.01, express P <0.001.
[0052] Figure 2 A schematic diagram illustrating the positive correlation between ASCL1 and CALCA mRNA expression and tissue IL-5 and IL-13 mRNA expression levels in CRSwNP patients;
[0053] A is a schematic diagram showing the positive correlation between ASCL1 mRNA expression and tissue IL-5 and IL-13 mRNA expression levels;
[0054] B is a schematic diagram showing the positive correlation between CALCA mRNA expression and tissue IL-5 and IL-13 mRNA expression levels;
[0055] In the figure, ASCL1: basic helical-loop-helical transcription factor 1 of the non-setrobatoid family;
[0056] CALCA: Calcitonin gene-related peptide α (the gene encoding CGRP); IL-5: Interleukin-5; IL-13: Interleukin-13.
[0057] Figure 3 A schematic diagram showing the expression of CGRP receptor subunits CRLR and RAMP1 on the surface of mast cells in nasal polyp tissue of CRSwNP patients and the correlation between mast cell and PNEC distribution.
[0058] A is a schematic diagram of the expression of CGRP receptor subunits CRLR and RAMP1 on the surface of mast cells.
[0059] B is a schematic diagram illustrating the correlation between PNEC distribution and mast cell Tryptase expression in nasal polyp tissue;
[0060] In the figure, CRLR: calcitonin receptor-like receptor; RAMP1: receptor activity modified protein 1; Tryptase: trypsin; PGP9.5: protein gene product 9.5; DAPI: 4,6-biamidin-2-phenylindole.
[0061] Figure 4 A schematic diagram illustrating how CGRP can promote degranulation of mouse bone marrow-derived mast cells and the production of type 2 inflammatory factors Il-5 and Il-13;
[0062] Wherein, A is a schematic diagram of the expression levels of the CGRP receptor subunits CRLR and RAMP1 in BMMCs;
[0063] B is a schematic diagram of the production of β-aminohexokinase in mast cell supernatant;
[0064] C is a schematic diagram showing the expression levels of type 2 inflammatory factors Il-5 and Il-13 mRNA in mast cells;
[0065] In the figure, CD117: stem cell factor receptor (c-Kit), a mast cell surface marker; FcεR1: high-affinity IgE receptor, a mast cell surface marker; CRLR: calcitonin receptor-like receptor; RAMP1: receptor activity modified protein 1; CGRP: calcitonin gene-related peptide; Il-5: interleukin-5; Il-13: interleukin-13.
[0066] express P <0.05, express P <0.001.
[0067] Figure 5 A schematic diagram illustrating the activation of the downstream cAMP-PKA-pCREB signaling pathway in mast cells by CGRP;
[0068] The left figure shows a schematic diagram of the protein expression level of pCREB in BMMCs;
[0069] The figure on the right is a statistical diagram.
[0070] In the figure, pCREB: phosphorylated cyclic adenosine monophosphate response element-binding protein; β-actin: β-actin; kDa: kilodalton, a unit of molecular weight; CGRP: calcitonin gene-related peptide.
[0071] express P <0.05.
[0072] Figure 6 A schematic diagram of the ECRS modeling scheme;
[0073] A is a schematic diagram of a modeling protocol for eosinophilic chronic sinusitis (ECRS) using papain.
[0074] B: Adoptive transfer of WT to mast cell-deficient mice or CRLR - / + A schematic diagram of mouse-derived BMMCs and the ECRS modeling protocol using Papain;
[0075] C: Schematic diagram of the ECRS modeling protocol using the CGRP receptor small molecule antagonist Olcepant to pretreat WT mice, followed by Papain.
[0076] In the figure, Papain: papain; CRLR: calcitonin receptor-like receptor; BMMCs: bone marrow-derived mast cells; Olcepant: selective calcitonin gene-related peptide (CGRP) receptor non-peptide antagonist.
[0077] Figure 7 Schematic diagram of mouse head section staining and mouse nasal mucosa tissue mRNA expression levels.
[0078] In this figure, A is a schematic diagram of HE staining of mouse head sections (left figure) and the corresponding statistical graph (right figure);
[0079] B shows a schematic diagram of PAS staining on mouse head sections (left) and the corresponding statistical graph (right).
[0080] C is a schematic diagram of RT-PCR detection of the mRNA expression levels of type 2 inflammatory factors Il-5 and Il-13 in mouse nasal mucosa tissue;
[0081] In the figure, Papain: papain; WT: wild-type mouse; CRLR: calcitonin receptor-like receptor; BMMCs: bone marrow-derived mast cells; Il-5: interleukin-5; Il-13: interleukin-13.
[0082] express P <0.05, express P <0.01, express P <0.001.
[0083] Figure 8 A schematic diagram showing the staining of mouse head sections and the mRNA expression levels in mouse nasal mucosa tissue;
[0084] In this figure, A is a schematic diagram of HE staining of mouse head sections (left figure) and the corresponding statistical graph (right figure);
[0085] B is a schematic diagram of PAS staining of mouse head sections (left) and B is the corresponding statistical graph (right).
[0086] C is a schematic diagram showing the mRNA expression levels of type 2 inflammatory factors Il-5 and Il-13 in mouse nasal mucosa tissue detected by RT-PCR.
[0087] In the diagram, Papain: papain; Olcepant: a selective non-peptide antagonist of the calcitonin gene-related peptide (CGRP) receptor; Il-5: interleukin-5; Il-13: interleukin-13;
[0088] express P <0.05, express P <0.01. Detailed Implementation
[0089] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.
[0090] The following examples illustrate the grouping of study subjects and the collection and source of specimens.
[0091] 1. The research subjects are divided into:
[0092] ① The normal control group consisted of patients who underwent decompression surgery for simple sinus cysts, nasal tumors, or traumatic optic nerve injury. During the surgery, the ethmoid sinus mucosa without obvious inflammation was collected.
[0093] ② In the eosinophilic CRSwNP group, the eosinophil count in the nasal polyp tissue was greater than 10% of the total inflammatory cells, and the excised nasal polyp tissue was collected during the operation.
[0094] ③ In the non-eosinophilic CRSwNP group, the eosinophil count in the nasal polyp tissue was less than 10% of the total inflammatory cells, and the excised nasal polyp tissue was collected intraoperatively. All subjects had not used systemic or local corticosteroids or leukotriene receptor antagonists within one month prior to surgery; all subjects had not received immunotherapy; patients with posterior nasal polyps, fungal sinusitis, cystic fibrosis, primary ciliary dyskinesia, immunodeficiency, systemic vasculitis, IgG4-related disease, acute upper respiratory tract infection or acute asthma exacerbation within 4 weeks, and other nasal diseases were excluded. The diagnosis of concomitant allergic rhinitis was based on the ARIA diagnostic criteria (Brozek JL, et al. Journal of Allergy and Clinical Immunology 2017; 140: 950-8); the diagnosis of asthma was based on the GINA criteria (https: / / ginasthma.org / ).
[0095] Example 1: Nasal mucosa histopathology and immunofluorescence staining
[0096] During the procedure, ethmoid sinus mucosa was collected from normal controls, and nasal polyps from patients with Eos CRSwNP (eosinophilic chronic sinusitis with nasal polyps) and Non-Eos CRSwNP (non-eosinophilic chronic sinusitis with nasal polyps) were added. The tissue specimens were completely immersed in an appropriate volume of 4% general-purpose tissue paraformaldehyde solution for fixation. After 24 hours, the specimens were embedded in paraffin and prepared into paraffin sections approximately 4 μm thick.
[0097] The expression of PGP9.5 was identified using immunofluorescence staining, and the PGP9.5 levels were statistically analyzed. + PNEC expression distribution in nasal mucosa tissues of different groups ( Figure 1 A); Immunofluorescence co-localization was used to study the co-localization of PGP9.5 and CGRP in nasal mucosal epithelial tissue. Figure 1 E) and the expression distribution of CGRP receptor subunits CRLR and RAMP1 in mast cells ( Figure 3 A).
[0098] The results showed that PNEC was scattered along the nasal mucosal epithelium, and was significantly elevated in the EosCRSwNP group. Figure 1 A); CGRP and PGP9.5 co-localize in nasal mucosal epithelial tissue. Figure 1E), meaning that CGRP mainly originates from PNECs; mast cells and their surface CGRP receptor subunits CRLR and RAMP1 co-localize ( Figure 3 A).
[0099] Example 2: Detection of neuropeptides in nasal mucosal tissue
[0100] 1) RT-PCR detection of neuropeptide expression in nasal mucosa tissue:
[0101] During the procedure, ethmoid sinus mucosa was collected from normal controls, and nasal polyps from Eos CRSwNP and Non-Eos CRSwNP patients. Total RNA was extracted, and RT-PCR was used to validate the PNEC lineage-determining transcription factor ASCL1 and the neuropeptide CGRP (encoding gene [missing information]) in a large sample. CALCA mRNA expression level of ) Figure 1 B);
[0102] 2) The correlation between the mRNA expression levels of ASCL1 and CALCA in CRSwNP patients and the mRNA expression levels of type 2 inflammatory factors IL-5 and IL-13 was analyzed. Figure 2 ).
[0103] The results showed that the PNEC lineage determines the transcription factor ASCL1 and the neuropeptide CGRP (encoding gene: CALCA The mRNA expression level of ) was significantly increased in the EosCRSwNP group ( Figure 1 B and C); the mRNA expression levels of ASCL1 and CALCA were positively correlated with the tissue mRNA expression levels of IL-5 and IL-13 (B and C). Figure 2 ).
[0104] Example 3: Regulatory effect of CGRP on bone marrow-derived mast cells
[0105] 1) Culture of mouse bone marrow-derived mast cells:
[0106] Mouse bone marrow-derived mast cells (BMMCs) were generated and cultured from wild-type C57BL / 6J mice. Specific culture protocol:
[0107] Bone marrow mesenchymal stem cells (BMMCs) were collected from the femur and tibia of C57BL / 6J mice and cultured in RIPM 1640 medium supplemented with 10% fetal bovine serum, 100 U / mL penicillin, 100 μg / mL streptomycin, 50 μmol / L β-mercaptoethanol, 10 ng / mL mouse recombinant IL-3, and 20 ng / mL mouse recombinant stem cell factor (SCF). The culture was maintained for 6–10 weeks, with the medium changed weekly. Flow cytometry was used to detect the co-expression of c-Kit and FcεRI in BMMCs to identify mature MCs. Only BMMCs with a purity higher than 90% were used for subsequent cell stimulation experiments.
[0108] 2) Using the method described in 1) above, when BMMCs were cultured to week 9 and the purity of mature MCs was greater than 90% as determined by flow cytometry, BMMCs were stimulated with 1 μM CGRP for 6 hours. BMMCs were then collected for quantitative RT-PCR to detect the mRNA expression levels of Il-5 and Il-13. Figure 4 C). After stimulating BMMCs with 1 uM CGRP for 2 hours, the cell culture supernatant was extracted, and the level of β-aminohexokinase was detected by ELISA. Figure 4 B).
[0109] The results showed that CGRP promoted mast cell degranulation (…). Figure 4 B) and the production of type 2 inflammatory factors ( Figure 4 C).
[0110] Example 4
[0111] A method for preparing a pharmaceutical preparation (spray formulation) for treating eosinophilic chronic sinusitis with nasal polyps includes the following steps:
[0112] ① Weigh out the CGRP receptor small molecule antagonist Olcepepant (purity ≥98%, Olcepepant (BIBN-4096) is an effective and selective calcitonin gene-related peptide 1 (CGRP1) receptor antagonist, purchased from MedChemExpress (MCE), catalog number HY-10095, website: https: / / www.medchemexpress.cn / Olcegepant.html), and dissolve it in physiological saline (pH 6.5-7.5) at a concentration of 3 μM.
[0113] ② Add vitamin C (0.1% w / v) as an antioxidant and stir until completely dissolved;
[0114] ③ After being sterilized by filtration through a 0.22μm sterile filter membrane, the product is dispensed into a high-pressure spray device, 10mL per bottle; thus, the pharmaceutical preparation is obtained.
[0115] After sealing, the above-mentioned drug preparations underwent sterility testing (compliant with the sterility testing methods of the 2025 edition of the Chinese Pharmacopoeia) and CGRP antagonist concentration detection (HPLC method, deviation ≤ ±5%). The quality control standards are as follows:
[0116] ① pH value: 6.5-7.5 (pH determination method according to the 2025 edition of the Chinese Pharmacopoeia);
[0117] ② Sterility: Must pass a sterility test (no bacterial or fungal growth);
[0118] ③ Active drug content: The concentration of the CGRP receptor small molecule antagonist is 3μM±0.15μM (HPLC method);
[0119] ④Stability: After being stored at room temperature (25℃) for 6 months, the degradation rate of the active pharmaceutical ingredient is ≤5% (accelerated test verification).
[0120] Example 4: Adoptive transfer of mast cell-deficient mice CRLR - / + Animal model study of the inhibition of eosinophilic inflammation of the nasal mucosa by mouse-derived BMMCs and drug formulations containing small molecule antagonists of CGRP receptors.
[0121] 1) Establish a papain-induced mouse model of eosinophilic chronic sinusitis:
[0122] ① Referring to previous research (Wang WQ, et al. Nat Immunol 23(10):1484-1494), a papain-induced mouse model of eosinophilic chronic sinusitis was constructed, as follows:
[0123] Administer 20 μL of 2 mg / mL Papain into each nostril on days 0, 1, and 2. No treatment is given on days 3-6. Administer 20 μL of 2 mg / mL Papain into each nostril on days 7-11. The mice are sacrificed on day 12. Figure 6 A).
[0124] ② Adoptive transfer of mast cell-deficient mice: To demonstrate the importance of mast cells, in Kit w-sh / w-sh Adoptive transfer experiments of BMMCs were performed in mice. From wild-type mice and... CRLR - / + BMMCs were obtained from mice and cultured in vitro. After the BMMCs matured, 10^6 cells were adoptively transferred in a volume of 200 μL via tail vein injection. Kit w-sh / w-sh In mice, papain was used to induce a model 48 hours after adoptive transfer of BMMCs. Figure 6B).
[0125] ③ Pretreatment of the drug preparation prepared in Example 4: When mice were modeled for ECRS, 20 μL of the drug preparation was instilled into each nostril three days in advance (days 0-2). Papain modeling was performed simultaneously on the fourth day, continuing until day 15 (day 14). Mice were sacrificed on day 16. Figure 6 C).
[0126] 2) Sampling and Detection: After deep anesthesia, nasal irrigation fluid was collected from mice and stored at -80°C. After euthanasia, the head was dissected, and the scalp skin and soft tissue were removed. A coronal incision was made 1 mm posterior to both eyes to separate the nasal cavity and sinuses. The nasal cavity and sinuses were decalcified, fixed, and embedded in paraffin. Serial sections with a thickness of 4 μm were then prepared in the coronal plane. Alternatively, the nasal cavity and sinuses were dissected under a microscope to obtain the nasal and sinus mucosa, which was then stored at -80°C. The following studies were then conducted:
[0127] ① Histological observation, HE and PAS staining to observe eosinophil infiltration and goblet cell metaplasia in mouse nasal mucosa tissue, etc. Figure 7 A and B; Figure 8 (A and B)
[0128] ② RT-PCR was performed using the following primer pairs to detect the mRNA expression levels of Il-5 and Il-13 in mouse nasal mucosa tissue. Figure 7 C; Figure 8 C) Primer pair sequences are as follows:
[0129] house mouse Il-5-F:TCAGGGGCTAGACATACTGAAG,
[0130] house mouse Il-5-R: CCAAGGAACTCTTGCAGGTAAT;
[0131] house mouse Il-13-F:TGAGCAACATCACACAAGACC,
[0132] house mouse Il-13-R: GGCCTTGCGGTTACAGAGG.
[0133] The results show that: Adoption transfer CRLR - / + Mast cell-deficient mice derived from mouse BMMCs showed reduced eosinophilic inflammation in the nasal mucosa, manifested as decreased eosinophil count, reduced goblet cell metaplasia, and suppressed mRNA expression of type 2 inflammatory factors Il-5 and Il-13. Figure 7Nasal drops containing Olcepant reduced eosinophilic inflammation in the nasal mucosa of mice, manifested as a decrease in eosinophil count, reduced goblet cell metaplasia, and inhibition of tissue Il-5 and Il-13 mRNA expression. Figure 8 ).
[0134] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The application of a small molecule CGRP receptor antagonist in the preparation of a medicament for treating eosinophilic chronic sinusitis with nasal polyps; characterized in that: The CGRP receptor small molecule antagonist is Olcepant.
Citation Information
Patent Citations
Preventative treatment of migraine
US20230321066A1