Application of LSH detection reagent in preparation of chronic obstructive pulmonary disease diagnosis preparation and application of LSH overexpression reagent in preparation of chronic obstructive pulmonary disease treatment medicine

Abstract

The invention discloses application of a reagent for detecting LSH in preparation of a chronic obstructive pulmonary disease diagnosis preparation and application of a reagent for overexpressing the LSH in preparation of a medicine for treating the chronic obstructive pulmonary disease. Protein expression of LSH in a patient suffering from the chronic obstructive pulmonary disease is found to be lower than that of healthy people and expression of pure smokers through western blot and RT-qPCR detection for the first time. Therefore, the possibility of using the LSH as the detection marker of the chronic obstructive pulmonary disease is provided. The LSH overexpression adeno-associated virus improves obstructive ventilation dysfunction and large and small airway dysfunction of a model mouse, relieves the emphysema degree, reduces the airway inflammation level and inhibits small airway remodeling, and further analysis on inflammatory cells in the lung shows that the overexpression of the LSH overexpression adeno-associated virus can reduce the proportion of pulmonary interstitial macrophages. The invention provides a new way with a prospect for treating the chronic obstructive pulmonary disease.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic diagnosis and treatment of chronic obstructive pulmonary disease, and specifically relates to the use of reagents for detecting LSH in the preparation of diagnostic preparations for chronic obstructive pulmonary disease and the use of reagents for overexpressing LSH in the preparation of drugs for treating chronic obstructive pulmonary disease. Background Art

[0002] The current treatment of COPD is not ideal. Existing drug treatments mainly target symptoms and have limited effects. Due to the lack of curative therapy, there is currently no drug that can reverse the disease process. Therefore, it is urgent to explore the pathogenesis and therapeutic targets of COPD. COPD can be understood as the final result of the accumulation of gene-environment interactions encountered by individuals throughout their lives. Epigenetic events caused by smoking cause potentially reversible changes in the genome that interfere with gene expression. Analyzing the relevant reversible genetic modifiers of gene-environment interactions based on epigenetic regulation will help to analyze the trajectory of lung function in the disease, in order to achieve scientific prevention and control of COPD.

[0003] At present, some COPD diagnostic markers have also been disclosed. For example, the patent application with publication number CN116445607A discloses a COPD screening marker KRT15 and a kit. KRT15 is an acidic keratin that was originally discovered in hair follicle stem cells. Studies have found that it is related to the stemness of cells and can mark pluripotent stem cells. It participates in the repair and regeneration of various tissue epithelial injuries, such as the esophageal epithelium, gastric epithelium, and ureteral epithelium.

[0004] The lymphocyte-specific DNA helicase (LSH) is a SNF2-like chromatin remodeling ATPase. Its gene is located in the 10q23-24 region on human chromosomes (sequence: NM_001289067.2:135-2789) and in the 19C3-D1 region on mouse chromosomes (sequence: NM_008234.3:104-2569). This gene encodes an 838-amino acid helicase belonging to the SNF2 protein family. It plays multiple roles in epigenetic regulation, including nucleosome remodeling, histone modification, and de novo DNA methylation or maintenance of DNA methylation. Initially considered a lymphocyte-specific helicase involved in regulating the expansion and survival of the lymphoid lineage, subsequent studies have shown that it is ubiquitously expressed in cells or tissues. To date, no direct association between LSH and COPD has been found. Summary of the Invention

[0005] In light of this, the present invention aims to provide the use of a reagent for detecting LSH in the preparation of a COPD diagnostic preparation, and the use of a reagent that overexpresses LSH in the preparation of a COPD treatment drug. This invention provides a new approach for the diagnosis and treatment of COPD and has promising application prospects.

[0006] In order to achieve the above invention objectives.

[0007] The present invention provides use of a reagent that overexpresses LSH in the preparation of a drug for treating chronic obstructive pulmonary disease.

[0008] The reagent for overexpressing LSH includes: AAV-LSH adeno-associated virus capable of overexpressing LSH.

[0009] The present invention provides a therapeutic drug for chronic obstructive pulmonary disease, including a reagent that overexpresses LSH.

[0010] The reagent for overexpressing LSH includes: AAV-LSH adeno-associated virus capable of overexpressing LSH.

[0011] The present invention provides use of a reagent for detecting LSH in the preparation of a diagnostic preparation for chronic obstructive pulmonary disease.

[0012] The reagents for detecting LSH include: Western blot detection reagents or PCR detection reagents, wherein the primer sequences are as follows: F:GATTTTGGATCGAATGCTGCCAG; R:ATGGACCCATCAAGCCTGCTGA.

[0013] The present invention provides a diagnostic preparation for chronic obstructive pulmonary disease, comprising a reagent for detecting LSH.

[0014] The reagents for detecting LSH include: Western blot detection reagents or PCR detection reagents, wherein the primer sequences are as follows: F:GATTTTGGATCGAATGCTGCCAG; R:ATGGACCCATCAAGCCTGCTGA.

[0015] This study, using Western blotting and RT-qPCR, demonstrated for the first time that LSH protein expression is decreased in COPD patients exposed to tobacco smoke compared with healthy controls and single smokers. Consistent with human lung tissue, both LSH protein and mRNA expression in COPD mice exposed to cigarette smoke (CS) were statistically significantly decreased compared with controls. This suggests the potential use of LSH as a biomarker for COPD diagnosis.

[0016] This study, using an adeno-associated virus overexpressing LSH, improved obstructive ventilation dysfunction and large and small airway dysfunction in model mice, reduced the severity of emphysema, lowered airway inflammation, and inhibited small airway remodeling. Further analysis of inflammatory cells in the lungs revealed that LSH overexpression reduced the proportion of interstitial macrophages. This provides a promising new approach for the treatment of COPD. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 : LSH protein and mRNA expression levels in human lung tissue; in Figure 1 A is the expression level of LSH detected by Western blot in human lung tissue and the corresponding bar graph; Figure 1 B is a histogram of the expression levels of LSH mRNA in human lung tissue; NS: lung tissue of non-smoking non-COPD patients; HS: lung tissue of smoking non-COPD patients; COPD: lung tissue of smoking COPD patients; .

[0018] Figure 2 : LSH expression level in mouse lung tissue; in Figure 2 A is the LSH protein expression level in mouse lung tissue and the corresponding bar graph; Figure 2 B is a bar graph showing the expression levels of mRNA in mouse lung tissue; Air: lung tissue of control mice (n=6); CS: lung tissue of smoked mice (n=6); , .

[0019] Figure 3 :Flowchart of LSH overexpression intervention in CS exposure-induced COPD mice and the effect of overexpression virus; in Figure 3 A is a diagram of the overexpression intervention model in CS mice; Figure 3 B, RT-qPCR detection of LSH mRNA levels; Figure 3 C is the LSH protein level detected by WB; Figure 3 D is the Flag expression level detected by immunofluorescence; , .

[0020] Figure 4 : Ventilatory function analysis in mice; in Figure 4 A is the forced vital capacity (FVC) of CS mice treated with LSH overexpression virus; Figure 4 B is the ratio of FEV to FVC at 50 ms after LSH overexpression virus intervention in CS mice; Figure 4 C is the ratio of FEV to FVC at 100ms after LSH-overexpressing virus intervention in CS mice; Figure 4 D is the ratio of FEV to FVC at 200ms after LSH-overexpressing virus intervention in CS mice; , , , .

[0021] Figure 5 : Expiratory flow rate analysis in mice; , .

[0022] Figure 6 :Effects of intratracheal titration of AAV-LSH adeno-associated virus on emphysema and airway inflammation in COPD mice; in Figure 6 A is HE staining to observe the effect of overexpressed LSH on CS mice; Figure 6 B is the mean alveolar lining index (MLI) to assess the degree of emphysema; Figure 6 C is the alveolar destruction index (DI) to assess the degree of emphysema; Figure 6 D is the quantitative analysis of airway wall thickness; , , , .

[0023] Figure 7 : PAS staining was used to observe the effects of LSH overexpression on different COPD model mice.

[0024] Figure 8 : Masson staining was used to observe the effects of LSH overexpression on different COPD model mice. DETAILED DESCRIPTION

[0025] The present invention is further illustrated below with reference to the following examples, but is not intended to limit the present invention.

[0026] Example 1 Expression levels of LSH molecules in lung tissues of COPD patients and mice: NS: lung tissue from non-smoking, non-COPD patients; HS: lung tissue from smokers without COPD; COPD: lung tissue from smokers with COPD. Human lung tissue samples were collected from patients undergoing pulmonary surgery for benign lesions such as pulmonary nodules at the Department of Thoracic Surgery, Xiangya Second Hospital, Central South University, between 2022 and 2024. Lung tissue samples were required to be fresh postoperative lung tissue and at least 5 cm from the primary lesion. After collection, the lung tissue was immediately placed on ice and cut and aliquoted using sterile instruments. A portion was preserved in tissue fixative (4% paraformaldehyde) for use as wax blocks for tissue embedding, while the remaining portion was aliquoted into cryovials of appropriate sizes for long-term storage in liquid nitrogen tanks. COPD patient inclusion criteria followed the Global Initiative for Chronic Obstructive Lung Disease (GAILD) criteria, including respiratory symptoms, risk factors, and persistent airflow limitation (defined as a pulmonary function test showing a forced expiratory volume in 1 second / forced vital capacity <0.7 after bronchodilator administration). This study was approved by the Medical Ethics Committee of the Second Xiangya Hospital of Central South University (No. 2022100), and informed consent was obtained from all participants. A total of 27 human lung tissue specimens were collected, including 9 non-smoking, non-COPD patients, 9 smokers, and 9 COPD patients. Three lung tissue specimens were randomly selected from each group for Western blotting (WB) protein analysis (shown in the figure), and 9 specimens from each group were used to measure LSH mRNA levels in human lung tissue.

[0027] 1. Experimental methods:

[0028] Western blot (WB) detection: After protein extraction, prepare a separation gel of appropriate concentration (usually 10% separation gel) based on the molecular weight of the target protein. Add the sample to the gel wells and follow the steps of electrophoresis-transfer-blocking-antibody incubation for color development. Semi-quantitatively analyze the expression level of the target protein based on the brightness and position of the bands.

[0029] RT-qPCR: RNA is extracted from tissue blocks and then reverse transcribed, and the reverse transcription reaction is performed on a PCR instrument.

[0030] .

[0031] The human LSH sequence is shown in SEQ ID NO.2, and the mouse LSH sequence is shown in SEQ ID NO.3.

[0032] 2. Experimental results: Figure 1 The expression levels of LSH protein and mRNA in human lung tissue, Figure 2The results show that LSH protein and mRNA expression levels in mouse lung tissue are decreased in smokers with COPD compared to healthy controls and smokers alone. Consistent with human lung tissue, both LSH protein and mRNA expression levels were significantly decreased in CS-exposed COPD mice compared to controls, with statistically significant differences.

[0033] Example 2 AAV-LSH adeno-associated virus tracheal titration intervention of lung tissue expression in COPD model mice: 1. Experimental methods: AAV-LSH adeno-associated virus (the constructed vector sequence is shown in SEQ ID NO.1) was constructed and verified by GeneCare Gene Corporation.

[0034] COPD mouse modeling: 6-8 week old C57BL / 6 mice were adaptively raised and placed in a whole-body smoke exposure chamber at a fixed time period twice a day for 50 minutes each time to simulate the natural smoking habits of humans. The average particulate matter concentration in the environment in which the mice were exposed was no less than 500 mg / m 3 Total particulate matter (TPM) was measured with continuous fumigation for 24 weeks, five days per week. The following key aspects require continuous monitoring during the fumigation period: 1) monitoring the carbon dioxide (CO2) concentration in the exposure chamber to no higher than 0.5%; 2) ensuring that the oxygen (O2) concentration is no less than 20%; and 3) ensuring that the carbon monoxide (CO) concentration in the exposure chamber is 288 ± 74 ppm. The success of the model is often verified through lung function and lung histopathology. COPD model mice often exhibit functional and structural abnormalities such as obstructive ventilatory dysfunction, emphysema, and airway remodeling.

[0035] After 14 weeks of smoke modeling, the control virus (empty virus), low-dose overexpression virus (10 11 vgAAV-LSH)) and high-dose overexpression virus (5x10 11 vg AAV-LSH)) was delivered into mice by tracheal titration, and then smoked for 10 weeks. Mouse-related functional experiments and specimen collection were performed 48 hours after the last smoked.

[0036] RT-qPCR, Western Blot and immunofluorescence experiments were used to verify the efficiency of AAV-LSH overexpression.

[0037] 2. Experimental results: Figure 3 A is a schematic diagram of the entire experimental process of constructing smoked mice and titrating overexpression of adeno-associated virus in the trachea. Figure 3B is the RT-qPCR experiment to verify the efficiency of AAV-LSH overexpression, Figure 3 C is the Western Blot experiment to verify the efficiency of AAV-LSH overexpression, Figure 3 D is an immunofluorescence experiment to verify whether AAV-LSH adeno-associated virus can successfully infect lung tissue. Figure 3 Results B showed that the RNA level of LSH in CS-exposed mice decreased, while AAV-LSH overexpression could effectively increase the RNA level of LSH in mouse lung tissue. Figure 3 Results C showed that LSH protein levels decreased in CS-exposed mice, while AAV-LSH overexpression effectively improved LSH protein levels in mouse lung tissue. Immunofluorescence analysis of the viral flag tag also demonstrated successful lung infection. These results demonstrate that transtracheal titration of AAV-LSH adeno-associated virus can effectively reverse the low LSH expression observed in the lungs of model mice.

[0038] Example 3 Effect of tracheal titration of AAV-LSH adeno-associated virus on lung function in COPD mice: 1. Experimental methods: Mouse pulmonary function testing: Mice were anesthetized intraperitoneally with tribromoethanol, then placed in the supine position and secured to a dissecting table. A tracheotomy was performed midway through the neck to expose the trachea, and endotracheal intubation was performed at a depth of approximately 0.5-1 cm. The endotracheal intubation port was connected to the plethysmograph. On the real-time sampling page, select TB mode for sampling. Click Start. Once the waveform is normal, click Record. Stop recording after 30 seconds. Then, switch to FEV mode for sampling. Again, click Start. Each FEV test involves eight forced exhalations. After the set fixed number of breaths is completed, sampling is canceled, the experiment is closed, and continuous ventilation is switched back to TB mode. (The instrument used is the Invasive Animal Pulmonary Function Testing and Analysis System (PFT) from Shanghai Tawang Intelligent Technology Co., Ltd.)

[0039] 2. Experimental results:

[0040] Figure 4 A is Forced Vital Capacity (FVC), Figure 4 BD is FEV 50 / FVC, FEV 100 FVC and FEV 200 / FVC is the ratio of forced expiratory volume (FEV) / FVC at each time point of 50ms, 100ms and 200ms. Figure 5Maximum mid-expiratory flow (MMEF). FVC is a key indicator for evaluating restrictive ventilatory dysfunction in humans, while the 1-second rate (FEV1 / FVC) is an important parameter for evaluating obstructive ventilatory dysfunction in humans. Based on the difference in lung volume between mice and humans, the FEV / FVC ratio in 50 milliseconds, 100 milliseconds or 200 milliseconds is often observed to reflect whether the experimental mice have obstructive ventilatory dysfunction. COPD is a disease characterized by obstructive ventilatory dysfunction, among which Figure 4 AD results showed that overexpression of LSH in lung tissue in this example could not effectively improve FVC, but different concentrations of overexpression virus could improve the ratio of forced expiratory volume (FEV) / FVC of mice at 50ms, 100ms and 200ms, indicating that overexpression of LSH is very effective in improving COPD. In addition, small airway dysfunction is also a characteristic change of COPD. Figure 5 The maximum mid-expiratory flow was measured, which is the most sensitive indicator for detecting small airway lesions. The results showed that overexpression of LSH can significantly improve small airway dysfunction in smoked mice.

[0041] Example 4 Effect of tracheal titration of AAV-LSH adeno-associated virus on emphysema and airway inflammation in COPD mice: 1. Experimental methods: HE staining: Paraffin sections of mouse lung tissue are dewaxed and hydrated, then stained in hematoxylin for 5-10 minutes to stain the cell nuclei blue. After staining, the sections are rinsed in tap water for several minutes to remove excess hematoxylin, followed by differentiation and re-blueing, and finally rinsed in distilled water. Hematoxylin-stained sections are then stained in eosin for 3-5 minutes to stain the cytoplasm red. After staining, the sections are rinsed in distilled water for several seconds to remove excess eosin. The eosin-stained sections are dehydrated, transparentized, and mounted. After the gum has dried, the sections are ready for microscopic examination. Under a microscope, cell nuclei appear blue and the cytoplasm red. Pathological changes in the tissue can be analyzed by observing cell morphology and tissue architecture. The mean alveolar lining index (MLI) and alveolar destruction index (DI) are used to assess the degree of emphysema, while airway wall thickness is used to assess airway inflammation.

[0042] PAS staining: Similar to HE staining procedures, paraffin sections are dewaxed with xylene and then hydrated with graded alcohols down to distilled water. Hydrated sections are oxidized in a 0.5%-1% periodic acid solution for 5-10 minutes to oxidize the glycol groups of polysaccharides in the tissue to dialdehyde groups. After oxidation, sections are rinsed in distilled water 2-3 times for 3-5 minutes each time to remove the periodic acid. Oxidized sections are stained in Schiff's reagent for 15-30 minutes. The colorless fuchsin in Schiff's reagent binds to the aldehyde groups produced by polysaccharide oxidation to form a purple-red compound, giving the polysaccharides a purple-red color. After staining, sections are directly immersed in a sulfurous acid solution three times for 1-2 minutes each time to remove unbound Schiff's reagent. Sections stained with Schiff's reagent are then stained in hematoxylin solution for 3-5 minutes to stain the nuclei. Following HE staining, hydrochloric acid-alcohol differentiation is performed and rinsed with tap water to restore the blue color. Following the same HE staining procedure, sections were dehydrated using graded alcohols, transparentized with xylene, and finally mounted with neutral gum. Microscopic observation revealed polysaccharides to be purplish-red, while cell nuclei appeared blue. The number of purplish-red cells was used to assess the number of goblet cells in the airway epithelium, reflecting the severity of airway inflammation.

[0043] 2. Experimental results: Figure 6 A is the HE staining result of mouse lung tissue. Figure 6 BC is the quantitative analysis of emphysema, Figure 6 D represents a quantitative analysis of airway wall thickness, using the ratio of epithelial cell area to epithelial basement membrane diameter. The results showed that smoke exposure can cause severe emphysema, and that LSH-overexpressing viruses can improve emphysema in mice at relatively low viral titers. Furthermore, airway wall thickness in CS mice was significantly increased compared to the control group, and LSH overexpression significantly ameliorated this thickening. Figure 7 PAS staining was used to observe changes in the number of goblet cells in the peripheral airway epithelium of mouse lung tissue. The results showed that the number of PAS-positive cells in the small airway epithelium of CS mice increased significantly. In CS mice given different concentrations of LSH-overexpressing virus during the same period, these PAS-positive cells were almost invisible, suggesting that LSH overexpression helps to improve the abnormal pathological characteristics of goblet metaplasia in the small airway epithelium of CS mice.

[0044] Example 5 Effect of tracheal titration of AAV-LSH adeno-associated virus on small airway remodeling in COPD mice: 1. Experimental methods: Masson staining: Paraffin sections of mouse lung tissue were gradually rehydrated from xylene to distilled water. The sections were placed in hematoxylin solution for 5-10 minutes to stain the cell nuclei blue. The sections were then rinsed in tap water for several minutes to remove excess hematoxylin. The sections were then differentiated in 1% hydrochloric acid alcohol for several seconds and rinsed in tap water to restore the blue color. After the blue color was restored, the sections were stained with Ponceau S or acid fuchsin.

[0045] 2. Experimental results:

[0046] Figure 8 Masson staining was used to assess the extent of peri-airway collagen deposition. In CS mice, collagen deposition around the small airways increased compared to the control group. However, treatment with different concentrations of the LSH-overexpressing virus significantly reduced this deposition. This result suggests that LSH overexpression may help alleviate the abnormal pathological changes in small airway remodeling in smoke-exposed mice.

Claims

1. Use of a reagent that overexpresses LSH in the preparation of a drug for treating chronic obstructive pulmonary disease, characterized in that: The reagent for overexpressing LSH includes: AAV-LSH adeno-associated virus capable of overexpressing LSH.

2. Application of reagents for detecting LSH in the preparation of diagnostic preparations for chronic obstructive pulmonary disease.

3. The use according to claim 2, characterized in that The reagents for detecting LSH include: Western blot detection reagents or qPCR detection reagents. The primer sequences of the qPCR detection reagents are as follows: F:GATTTTGGATCGAATGCTGCCAG; R:ATGGACCCATCAAGCCTGCTGA.

Images