Application of MITF Gene SNP Molecular Marker in Molecular Assisted Selection of Black-bone Chicken Breeding

Abstract

The application discloses a kind of MITF The application discloses application of gene SNP molecular markers in black-bone chicken muscle and skin black color degree molecular marker assisted breeding, and the SNP molecular markers include the following two SNP loci: SNP1 molecular marker is located at the 15747890th position of the positive strand of chromosome 12, is C or T polymorphism, numbered as rs316573471, and the dominant genotype is TT; SNP2 molecular marker is located at the 15751940th position of the positive strand of chromosome 12, is A or G polymorphism, numbered as rs14045480, and the dominant genotype is AA. MITF In the black-bone chicken muscle black color degree molecular marker assisted breeding, TT and AA dominant allele genotypes can be used as important molecular markers for selecting thigh muscle brightness L* value and back skin brightness L* value, respectively, and by selecting and retaining TT genotype and AA genotype individuals and eliminating other genotype individuals, thigh muscle black color degree and back skin black color degree breeding can be improved, and the progress of thigh muscle and back skin black color degree generation breeding can be accelerated.

Description

TECHNICAL FIELD

[0001] The present application relates to molecular marker assisted breeding, in particular, to MITF Application of gene SNP molecular marker in molecular marker assisted breeding of black-bone chicken skin and muscle blackness. BACKGROUND

[0002] Black-bone chicken has the characteristics of black skin, black meat, etc., and is deeply loved by consumers due to its high melanin content and unique nourishing and medicinal value. In the research and development and utilization process of black-bone chicken, “black skin, black meat, black bone” is the main research target, and “black skin, black meat” is the most prominent feature of black-bone chicken. Melanin deposition is the main reason for the formation of blackness, and people are used to judging the quality by the depth of blackness in consumption. Melanin deposition is a complex regulatory system, which is regulated by multiple genes and signal pathways and other factors. Microphthalmia-associated transcription factor (MITF) is mainly expressed in pigment cells and plays an important role in the survival, migration, proliferation and differentiation of melanocytes, and is crucial for maintaining melanocyte pigmentation. It is related to the expression activation of multiple pigment-related genes and directly involved in the expression of tyrosinase gene family, and has a positive regulatory effect on melanin deposition in black-bone chicken. High expression may help the formation of melanin in black-bone chicken.

[0003] Studies have shown that muscle brightness L* value reflects the brightness of the muscle surface, the lower the L* value, the darker the muscle color, the higher the blackness of the muscle, and the higher the melanin content. It is established that the brightness L* value can be used as a reference index for breeding blackness traits. At present, in the breeding process, black-bone chicken is usually slaughtered first, and then selected by visually observing the blackness of the muscle of the slaughtered black-bone chicken. The slaughtered black-bone chicken cannot be further developed and observed for blackness, which consumes cost and slows down the progress of generation inheritance. Therefore, it is of great significance to find molecular markers significantly related to skin and muscle blackness, which can save cost and improve the progress of skin and muscle blackness breeding of black-bone chicken by directly selecting skin and muscle blackness of live chickens using molecular markers in early stage. SUMMARY

[0004] In view of the slow progress of skin and muscle blackness breeding of black-bone chicken, the present application provides a kind of MITF Application of gene SNP molecular marker in molecular marker assisted breeding of black-bone chicken skin and muscle blackness, wherein MITF The information of the gene SNP molecular marker is as follows:

[0005]

[0006] The screening method of the SNP molecular marker is as follows:

[0007] The MassARRAY platform based on time-of-flight mass spectrometry analysis technology was used to genotype 60 SNP sites of the melanin deposition related genes, and the SNP sites without polymorphism were eliminated. The single variable analysis in the general linear model of SPSS 16.0 software was used to analyze the correlation between the genotype of the polymorphic sites and the meat color brightness L* value. After analysis, two SNP sites of the genes were screened to have polymorphism, and then the correlation between the SNP marker and the back skin color, the chest skin color, the thigh skin color, the chest muscle and the thigh muscle brightness L* value traits was analyzed. The TT genotype of the SNP1 site was significantly lower than the CT genotype in the thigh muscle brightness L* value, indicating that the TT genotype individual had higher thigh muscle dark color degree, and was the dominant genotype of the thigh muscle dark color degree. The AA genotype of the SNP2 site was significantly lower than the GA and GG genotypes in the back skin brightness L* value, indicating that the AA genotype had higher back skin dark color degree, and was the dominant genotype of the back skin dark color degree. MITF The TT and AA genotypes of the two SNPs of the genes can be used as important molecular markers for the molecular assisted breeding of the thigh muscle and back skin dark color degree of the black-bone chicken. MITF The TT and AA genotypes of the two SNPs of the genes can be used as important molecular markers for the molecular assisted breeding of the thigh muscle and back skin dark color degree of the black-bone chicken.

[0008] The nucleotide sequences of the primers of the above SNP molecular markers are as follows:

[0009]

[0010] Specifically, the application method of the SNP molecular markers of the genes in the molecular marker assisted breeding of the muscle and skin dark color degree of the black-bone chicken includes the following steps: MITF The application method of the SNP molecular markers of the genes in the molecular marker assisted breeding of the muscle and skin dark color degree of the black-bone chicken includes the following steps:

[0011] (1) extracting the total DNA of the genome of the chicken to be tested;

[0012] Preferably, the total DNA of the genome of the chicken to be tested is obtained by wing vein blood sampling of an individual of the chicken species.

[0013] (2) skin and muscle brightness L* value determination method: after the live chicken is slaughtered, first, the back skin, chest skin and thigh skin brightness L* value are determined by using a TC.PIIG type full-automatic color difference meter, then the thigh skin and chest skin are cut open by 4 cm 2 (2cm×2cm) to expose the thigh muscle and chest muscle, and the thigh muscle and chest muscle brightness L* value are determined by using a TC.PIIG type full-automatic color difference meter. All the skin color and meat color determination are measured by the same person, and the measured parts are basically consistent.

[0014] (3) designing primers according to the SNP sites, performing PCR amplification, and performing sequencing verification and genotyping;

[0015] PCR products were sent to a bio company for sequencing, and the obtained sequences were aligned with the reference genome of chicken to find the polymorphic sites. The nucleotide sequences of the PCR products of SNP sites are as follows:

[0016] MITF - SNP1 site, rs316573471 (mutation site C / T), PCR product: 212 bp.

[0017] AAGCGAGAGCACTGGCTAAGGAGAGGCAAAAGAAAGACAATCACAACK(C / T)TGAGTAAGTTTGATTCTTCACTTTTAACACTAATTTTAGTAATTATTTCAGGCTCTTTTAAGTATTGGAATGCTAGGTTTATAGCAGGTGTTGCTGTCAGCAGAGGCACTGAGAGCAACATCTAATCCAATTGCTTTTGACAAATTCATCTTGCACAATTTGGC.

[0018] MITF - SNP2 site, rs14045480 (mutation site A / G), PCR product: 246 bp.

[0019] TGATGGACGATACCCTCTCCCCCGTAGGAGTAACTGACCCACTGCTTTCCTCTGTGTCTCCTGGAGCATCK(A / G)AAAACGAGTAGCAGGCGGAGCAGCGTGAGCATGGAGGACACTGATCATGCTTGTTAGCAAATACTTGGCACGCCTTTCATAAACTGCTTTGGTTCTTGATCAGTAGATTAAATATTTTGCCTTTTGTAGAATTTTTTGATTTTTTTTTTCTTGTGCTTCATCGGTAGCCCAGTGT.

[0020] Note: K marked in the above sequence is the mutation site, and the mutation base in the brackets is the allelic mutation.

[0021] (4) According to the genotype results, select the superior genotype individuals with higher skin and muscle blackness, and eliminate the inferior genotype individuals with lower blackness.

[0022] The specific judgment method of the superior genotype individual is: MITF The SNP1 (rs316573471) gene site has two genotypes CT and TT, and the thigh muscle brightness L* value of the TT genotype is significantly lower than that of the CT genotypeP <0.05), indicating that the TT genotype is the dominant genotype for dark thigh muscle color; MITF The SNP2 (rs14045480) locus has three genotypes: AA, AG, and GG. The L* value of the back skin brightness of the AA genotype is significantly lower than that of the GA and GG genotypes. P <0.05), indicating that the AA genotype is the dominant genotype for dark skin on the back.

[0023] Through the above technical solution, the present invention achieves the following beneficial effects:

[0024] use MITF In marker-assisted breeding of muscle darkness in Silkie chickens, the dominant TT and AA alleles can be used as important molecular markers for selecting thigh muscle brightness L* values ​​and back skin brightness L* values, respectively. By selecting individuals with TT and AA genotypes and eliminating individuals with other genotypes, the breeding of thigh muscle darkness and back skin darkness can be improved, thus accelerating the generational selection progress of thigh muscle and back skin darkness. Attached Figure Description

[0025] Figure 1 This is an embodiment of the present invention. MITF Mass spectrometry genotyping of gene SNP1 (rs316573471);

[0026] Figure 2 This is an embodiment of the present invention. MITF Mass spectrometry typing of gene SNP2 (rs14045480). Detailed Implementation

[0027] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0028] Example 1: Screening for molecular markers significantly correlated with the blackness of the muscle and skin of Silkie chickens.

[0029] 1. Materials and Methods

[0030] Ninety-two Silkie chickens (half male and half female) were randomly selected, their leg numbers were recorded, and 1 mL of blood was collected from the subwing vein. The blood was anticoagulated with ACD, mixed thoroughly, and stored at -20 °C for later use. DNA was extracted using the standard phenol-chloroform method. DNA samples from all 192 individuals were sent to a biotechnology company for studies on melanin-related factors in Silkie chickens. MITF The gene sequencing was conducted using the time-of-flight mass spectrometry (TOF-MS) MassARRAY platform to collect data and perform SNP locus genotyping.

[0031] 2. Measurement of skin and muscle lightness L* value

[0032] After slaughtering the live chicken, the L* value of the skin brightness on the back, chest, and thigh was first measured using a TC.PIIG fully automatic colorimeter. Then, a 4cm incision was made in the skin of the thigh and chest. 2 (2cm x 2cm) Thigh and chest muscles were exposed, and the L* value of the thigh and chest muscles was measured using a TC.PIIG fully automatic colorimeter. All skin and flesh color measurements were taken by the same person, and the measured areas were basically consistent.

[0033] 3. Genotyping and its correlation with skin and muscle brightness L* values

[0034] 3.1 SNP locus genotyping

[0035] Genotyping of 192 individuals at 60 SNP loci related to melanin deposition genes was performed using the MassARRAY platform based on time-of-flight mass spectrometry, after removing SNP loci without polymorphism. MITF The gene has two polymorphic SNP sites, the information of which is shown in Table 1. Mass spectrometry analysis results are shown in [Table 1]. Figure 1 and Figure 2 . Figure 1 This is the mass spectrometry typing of SNP1 (rs316573471 C>T), NO call (0), C(0), CT(18), T(174), CC=0, CT=0.09, TT=0.91. Figure 2 This is the mass spectrometry typing of SNP2 (rs14045480 A>G), NO call (0), G(102), GA(83), A(7), GG=0.53, GA=0.43, AA=0.04.

[0036] Table 1 MITF SNP locus information

[0037]

[0038] 3.2 Genetic polymorphism analysis of MITF SNP loci

[0039] Haploview 4.1 was used to detect whether two SNP loci were linked and in Hardy-Weinberg (HW) equilibrium. Genotype frequencies, allele frequencies, and heterozygosity of the SNP loci were also calculated. The results are shown in Table 2. SNP1 and SNP2 were not strongly linked. Figure 1 .

[0040] Table 2 shows that there are two genotypes at the SNP locus. HW equilibrium was determined. MITF Genes SNP1 and SNP2 were in HW equilibrium (P>0.05). SNP1 had He=0.089 and Ho=0.094, indicating low genetic diversity, while SNP2 had He=0.379 and Ho=0.435, indicating high genetic diversity.

[0041] Table 2 MITF Genetic polymorphisms at SNP1 and SNP2 sites and Hardy-Weinberg equilibrium test

[0042]

[0043] 3.3 Correlation analysis of SNP markers with skin and muscle lightness L* values

[0044] Association analysis between polymorphic locus genotypes and skin and flesh color brightness L* values ​​was performed using univariate ANOVA in a general linear model in SPSS 16.0 software. Fixed factors: different genotypes of the SNP markers; dependent variables: skin and flesh color brightness L* values. The LSD test was used for multiple comparisons to determine the significance of differences in skin and flesh color brightness L* values ​​among different marker genotypes. P <0.05 indicates a significant difference.

[0045] MITF Correlation analysis of gene SNP markers with skin and muscle brightness L* values ​​revealed... MITF The SNP1 site of the gene was significantly correlated with the brightness L* value of the thigh muscle, but not with the brightness L* value of the chest muscle, back skin, chest skin and thigh skin. The results are shown in Table 3. MITF The SNP2 site of the gene was significantly correlated with the back skin brightness L* value, but not with the brightness L* values ​​of chest skin, thigh skin, chest muscle, and thigh muscle. The results are shown in Table 4.

[0046] As shown in Table 3, the L* value of thigh muscle brightness of the TT genotype at the SNP1 (rs316573471) locus was significantly lower than that of the CT genotype (P<0.05), indicating that the TT genotype is the dominant genotype for thigh muscle darkness.

[0047] As shown in Table 4, the L* value of back skin brightness of the AA genotype at the SNP2 (rs14045480) locus was significantly lower than that of the GA and GG genotypes (P<0.05), indicating that the AA genotype is the dominant genotype for back skin darkness.

[0048] In breeding, it can be MITFThe TT dominant allele at the SNP1 (rs316573471) locus and the AA dominant allele at the SNP2 (rs14045480) locus serve as important molecular markers for selecting the L* value of thigh muscle and back skin brightness, respectively. By selecting individuals with the TT and AA genotypes and eliminating individuals with other genotypes, we can assist in improving the darkness of thigh muscle and back skin and accelerate the generational selection progress of darkness of thigh muscle and back skin.

[0049] Table 3 MITF Association analysis of SNP1 gene locus with skin and muscle lightness L* value traits

[0050] (mean ± standard deviation)

[0051]

[0052] Note: Different lowercase letters in the same column at the same locus indicate significant differences in the L* value of flesh color brightness between different genotypes. P <0.05), the absence of a letter indicates that the difference in flesh color brightness L* values ​​between different genotypes is not significant ( P >0.05).

[0053] Table 4 MITF Association analysis of SNP2 gene locus with skin and muscle brightness L* value traits

[0054] (mean ± standard deviation)

[0055]

[0056] Note: Different lowercase letters in the same column at the same locus indicate significant differences in the L* value of flesh color brightness between different genotypes. P <0.05), the absence of a letter indicates that the difference in flesh color brightness L* values ​​between different genotypes is not significant ( P >0.05).

[0057] Example 2: Molecular marker-assisted breeding of black muscle color in Silkie chickens

[0058] By using molecular marker-assisted breeding based on genes related to the dark color of the skin and muscles of Silkie chickens, the skin and muscle brightness L* values ​​of Silkie chicken strain B in the Silkie chicken breeding line were selected to improve the dark color of the skin and muscles of the breeder chickens.

[0059] At 4 weeks of age, genotyping was performed on chickens in the B breed of Silkie chickens, retaining individuals with the dominant genotype showing higher skin and muscle blackness. The specific protocol is as follows:

[0060] (1) At 4 weeks of age, blood was collected from the wing veins of 800 Silkie chickens (half male and half female) using disposable syringes. DNA was extracted using the phenol-chloroform method, and total genomic DNA of the chickens to be tested was extracted. Related genes were designed and synthesized. MITF Primers for SNP1 (rs316573471) and SNP2 (rs14045480) sites, and primer sequence information is shown in Table 5.

[0061] Table 5 Primer sequence related information

[0062]

[0063] (2) PCR amplification, electrophoresis and sequencing genotyping: PCR amplification products were analyzed by 1.5% agarose gel electrophoresis and sequenced for genotyping. Genotyping was performed on male and female Silkie chickens, and individuals with the dominant genotypes of higher skin and muscle blackness were retained.

[0064] PCR total reaction volume 50 μL: DNA template 4 μL, dNTP (2 mmol / L) 2 μL, Mg 2+ (3 mmol·L) -1 0.6 μL, 5 μL of 1×PCR reaction buffer, and upstream and downstream primers (10 μmol·L⁻¹) -1 1 μL each of Taq polymerase (1 U·μL) -1 Add 2.5 μL of ultrapure water to a final volume of 50 μL.

[0065] PCR reaction procedure: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 5 min. The PCR amplified target fragment was detected by 1.5% agarose gel electrophoresis.

[0066] The PCR products were sent to a biotechnology company for sequencing. The obtained sequences were compared with the chicken reference genome to identify polymorphic sites. The nucleotide sequences of the SNP site PCR products are shown below:

[0067] MITF -SNP1 site, rs316573471 (mutation site C / T), PCR product: 212 bp.

[0068] AAGCGAGAGCACTGGCTAAGGAGAGGCAAAAGAAAGACAATCACAACK(C / T)TGAGTAAGTTTGATTCTTCACTTTTAACACTAATTTTAGTAATTATTTCAGGCTCTTTTAAGTATTGGAATGCTAGGTTTATAGCAGGTGTTGCTGTCAGCAGAGGCACTGAGAGCAACATCTAATCCAATTGCTTTTGACAAATTCATCTTGCACAATTTGGC.

[0069] MITF -SNP2 site, rs14045480 (mutation site A / G), PCR product: 246 bp.

[0070] TGATGGACGATACCCTCTCCCCCGTAGGAGTAACTGACCCACTGCTTTCCTCTGTGTCTCCTGGAGCATCK(A / G)AAAACGAGTAGCAGGCGGAGCAGCGTGAGCATGGAGGACACTGATCATGC TTGTTAGCAAATACTTGGCACGCCTTTCATAAACTGCTTTGGTTCTTGATCAGTAGATTAAATATTTTGCCTTTTGTAGAATTTTTTGATTTTTTTTTCTTGTGCTTCATCGGTAGCCCAGTGT.

[0071] Note: K marked in the sequence is the mutation site, and the mutated base in parentheses is the allele mutation.

[0072] (3) Method for determining the L* value of skin and muscle brightness: After slaughtering live chickens at 10 weeks of age, the L* value of the skin brightness of the back, chest and thigh was first determined using a TC.PIIG fully automatic colorimeter. Then, the skin brightness of the thigh and chest was measured at a depth of 4 cm. 2 The thigh and chest muscles were cut open (2cm x 2cm) to expose them. The L* value of the thigh and chest muscles was then measured using a TC.PIIG fully automatic colorimeter. All skin and flesh color measurements were taken by the same person, and the measured areas were basically consistent.

[0073] (4) Molecular marker-assisted breeding of black skin and muscle color in Silkie chickens

[0074] Will MITFThe TT dominant allele at the SNP1 (rs316573471) locus and the AA dominant allele at the SNP2 (rs14045480) locus serve as important molecular markers for selecting thigh muscle and back skin brightness L* values, respectively. By selecting individuals with the TT and AA genotypes and eliminating individuals with other genotypes, the breeding of individuals with improved thigh muscle and back skin darkness can be assisted.

[0075] Molecular marker-assisted breeding was used to improve the dark color of the thigh muscles in the 6th and 7th generations of Silkie chicken strain B. This method is simple and can more quickly improve the dark color of the thigh muscles. As shown in Table 6, after two generations of selection, the brightness values ​​(L*) of the thigh muscles and the back skin were significantly lower than in the 4th generation. The average L* value of the thigh muscles decreased by about 2 per generation compared to the previous generation, and the average L* value of the back skin decreased by about 2.4 per generation compared to the previous generation. Compared to the 3rd to 5th generations, the average L* value decreased by about 1 per generation. The L* value decreased significantly, and the coefficient of variation (CV) also decreased significantly. The dark color of the thigh muscles and back skin was significantly improved, and the uniformity of dark color also increased significantly, accelerating the selection and progress. After two generations of molecular marker-assisted breeding, the brightness values ​​(L*) of the breast muscles, breast skin, and thigh skin also decreased accordingly, and the dark color improved.

[0076] Table 6. Results of L* value determination of skin and muscle brightness in different generations of Silkie chicken strain B

[0077]

[0078] Age determined: 70 days

[0079] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0080] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0081] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. MITF The application of gene SNP molecular markers in marker-assisted breeding of muscle and skin blackness in Silkie chickens is characterized by, The SNP molecular markers include the following two SNP sites: The SNP1 molecular marker is located at position 15747890 on the positive strand of chromosome 12. It is a C or T polymorphism, numbered rs316573471, and the dominant genotype is TT. The SNP2 molecular marker is located at position 15751940 on the positive strand of chromosome 12. It is an A or G polymorphism, numbered rs14045480, and the dominant genotype is AA. The candidate Silkie chickens with the superior genotype are individuals with higher muscle and skin blackness.

2. A breeding method for improving the blackness of the skin and muscles of Silkie chickens, characterized in that, Includes the following steps: (1) Determine the genotype of the Silkie chicken to be bred, wherein the genotype is the genotype of the SNP molecular marker combination as described in claim 1; (2) Select individuals with the dominant TT genotype at SNP1 locus and individuals with the dominant AA genotype at SNP2 locus.

3. The breeding method according to claim 2, characterized in that, In step (1), the method for determining the genotype of the Silkie chickens to be selected is as follows: (1.1) Extract total DNA from the genome of the Silkie chicken to be tested; (1.2) The target sequence was amplified by PCR using primer pairs, the sequences of which are as follows: SNP1F: 5'AAGCGAGAGCACTGGCTAAG 3' SNP1R: 5'GCCAAATTGTGCAAGATGAA 3' SNP2F: 5'TGATGACGATACCCTCTCC3' SNP2R: 5'ACACTGGGCTACCGATGAAG 3'; (1.3) Sequencing the PCR amplification products to determine the genotype.

4. The breeding method according to claim 3, characterized in that, The nucleotide sequences of the PCR amplification products are shown in SEQ ID NO.1 and SEQ ID NO.2, and the lengths of the PCR products are 212 bp and 246 bp, respectively.

Images