A hydrogel preparation, a preparation method and application in repairing sperm damage
By constructing a recombinant plasmid to express the SKAP2 protein and encapsulating it in milk exosomes, a hydrogel formulation was prepared, which solved the problem of decreased sperm motility caused by heavy metals, organic pollutants and aging, significantly improved sperm motility and inhibited the activity of matrix metalloproteinase 1.
Patent Information
- Application Number
- CN202510950910.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-10
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2045-07-10
AI Technical Summary
There is a lack of effective methods in the current technology to improve the problem of decreased sperm motility caused by factors such as heavy metals, organic pollutants and aging, especially for the repair of asthenospermia.
By constructing a recombinant plasmid to express the SKAP2 protein, encapsulating it in milk exosomes, and incorporating it into a hydrogel formulation, sperm motility can be improved through skin application. The specific steps include plasmid construction, protein purification, and hydrogel preparation.
It significantly improves sperm motility in patients with asthenospermia caused by heavy metal lead, organic endocrine disruptors such as phthalates, and aging, and inhibits the activity of matrix metalloproteinase 1, thus achieving an anti-wrinkle effect.
Smart Images

Figure CN120788985B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of hydrogel preparation, in particular to a hydrogel preparation, a preparation method and application in repairing sperm damage. BACKGROUND
[0002] There are many reasons for the decline in semen quality, including heavy metal and organic pollutant pollution, high temperature, aging and mental stress and many other factors; the decline in semen quality includes reduced sperm motility, reduced sperm count and increased deformity, and so far there is no targeted method to improve sperm quality. In order to improve the symptoms of asthenospermia and improve sperm motility, a hydrogel preparation is developed, which can significantly improve the problem of reduced sperm motility caused by heavy metal lead, phthalate DBP, high temperature and aging, and significantly improve sperm motility. SUMMARY
[0003] The present application aims to overcome the shortcomings of the prior art, and provides a hydrogel preparation, a preparation method and application in repairing sperm damage. The SKAP2 protein is expressed by constructing an expression vector with a plasmid, and milk exosomes are extracted, and then the SKAP2 protein is wrapped into the milk exosomes. The exosomes containing the SKAP2 protein are then fused into the hydrogel preparation. The preparation can significantly improve the sperm motility of asthenospermia mice by skin application, and achieves the effect of improving the sperm motility of asthenospermia caused by heavy metal lead, organic endocrine disruptor phthalate, high temperature and aging, and solves the problem of no effective repair preparation for asthenospermia in the prior art.
[0004] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:
[0005] A preparation method of a hydrogel preparation, comprising the following steps:
[0006] Step 1, construct a recombinant plasmid;
[0007] The SKAP2 gene is connected with the PEGX-6P-1 carrier by a recombinant method to obtain a recombinant plasmid;
[0008] Step 2, plasmid transformation;
[0009] The plasmid is added to the competent cells to obtain competent cells containing the plasmid, and after bacterial culture and induction expression, the supernatant is collected by centrifugation;
[0010] Step 3, protein purification;
[0011] The collected supernatant is added to GST-beads, washed and eluted to obtain an eluate containing the SKAP2 protein, and the SKAP2 protein is obtained after post-treatment;
[0012] Step 4: Prepare mEXOs-encapsulated SKAP2 protein;
[0013] Milk exosomes mEXOs were mixed with SKAP2 protein in PBS to obtain a mixture; the mixture was then treated with sound waves and incubated to obtain mEXOs encapsulating SKAP2 protein.
[0014] Step 5: Prepare the SKAP2 hydrogel formulation;
[0015] Dissolve trehalose dihydrate in water by stirring, add mEXOs to encapsulate SKAP2 protein and continue stirring, add CMC, stir and let stand, repeat several times to obtain hydrogel formulation.
[0016] Preferably, in step one: the SKAP2 gene sequence is shown in SEQ ID NO.1:
[0017]
[0018] Preferably, in step one, the specific steps for recombining the connections include:
[0019] S1. The SKAP2 gene was amplified by PCR to obtain fragment PCR products;
[0020] Add the MIX mixture to the working solution and mix well to obtain the first-round reaction system;
[0021] The MIX mixture is the full-length fragment of the SKAP2 gene (1104 bp);
[0022] The reaction system of round I was subjected to PCR amplification to obtain the product of round I;
[0023] The first primer, the tail primer, the product of round I, and the working solution were mixed to obtain the reaction system of round II.
[0024] The sequence of the first primer is shown in SEQ ID NO.2: GATCTGGAAGTTCT GTTCCAGGGGCCCCTGGGATCCCCTAATCCGAGCAGTACCAGC AGTCC,
[0025] The sequence of the tail primer is shown in SEQ ID NO.3: ATATCGGCGGTAGCCAT CATCATCATCACCATTAACTCGAGCGGCCGCATCGTGACTGACT GACGATCTGC;
[0026] The second-round reaction system was subjected to PCR amplification to obtain fragment PCR products;
[0027] S2. The fragment PCR product was recombined into the vector pGEX-6P-1 (BamHI-XhoI digested vector) by recombination to obtain the full-length SKAP2 gene and construct the recombinant plasmid.
[0028] Preferably, in step two, the plasmid transformation process specifically includes:
[0029] S1, transformation of competent cells;
[0030] The full-length SKAP2 gene recombinant plasmid was added to competent cells that had been thawed on ice and mixed thoroughly. After being placed on ice, the cells were subjected to heat shock and then transferred to ice to obtain competent cells containing the plasmid.
[0031] The LB medium after high pressure treatment was added to competent cells containing plasmids and cultured at 37°C and 220 rpm for 1 h. After the culture was completed, SKAP2 protein expression bacterial solution was obtained.
[0032] S2. Bacterial Culture and Collection
[0033] Spread the SKAP2 protein expression bacterial culture onto a plate and culture it. After the culture is complete, continue culturing. When the OD value of the bacterial culture rises to the specified range, add the inducer IPTG and culture it again at 22℃ and 210rpm for 18h. After the culture is complete, centrifuge, collect the centrifuged precipitate, resuspend, break it up, centrifuge again, and collect the supernatant.
[0034] Preferably, in step S1 of step two: the competent cells are competent cells BL21(DE3).
[0035] Preferably, in step S2 of step two: the OD value of the bacterial solution is specified to be in the range of 0.6-0.8; and the final concentration of the inducer IPTG is 0.5mM.
[0036] Preferably, in step four: the mass ratio of milk exosomes mEXOs to SKAP2 protein is 1:1; the final concentration of mEXOs in the mixture is 4 μg / mL.
[0037] Preferably, in step four: the acoustic treatment is set to: amplitude 20%, six 30-second switching cycles, with a 2-minute cooling time between each cycle; the incubation conditions are: incubation at 37°C for 60 minutes to restore the exosome membrane.
[0038] Preferably, in step four, the milk exosomes mEXOs are prepared by the following steps:
[0039] Milk was pretreated by centrifugation. The pretreated milk was then subjected to low-speed centrifugation, high-speed centrifugation, and ultra-speed centrifugation in sequence, followed by washing and resuspending to obtain milk exosomes mEXOs.
[0040] Preferably, in step four, when preparing milk exosomes mEXOs: the low-speed centrifugation operation includes: centrifuging at 4℃ and 3000g for 10 min, and taking the intermediate layer clear liquid; the high-speed centrifugation operation includes: centrifuging at 4℃ and 10000g for 30 min, discarding the precipitate, and taking the supernatant; the ultracentrifugation operation includes: centrifuging at 4℃ and 100000g for 60-90 min, precipitating the exosomes;
[0041] The washing and resuspension process includes: resuspending the precipitate with PBS, centrifuging again at 100,000 g for 60 min to remove impurities, and then resuspending and washing the precipitate again with PBS.
[0042] Preferably, in step five: the ratio of trehalose dihydrate, water, and mEXOs-encapsulated SKAP2 protein is 4g:80mL:2mL; and the content of CMC in the cosmetic composition is 0.1-4wt%.
[0043] This invention discloses a hydrogel formulation prepared using the above-described method for preparing hydrogel formulations.
[0044] This invention discloses the application of the hydrogel formulation described above in repairing sperm damage.
[0045] Compared with the prior art, the beneficial effects of the present invention are as follows: The hydrogel preparation prepared by the present invention significantly improves the sperm motility of mice with asthenospermia through skin application, and achieves the effects of improving the decline in sperm motility caused by heavy metal lead, organic endocrine disruptor phthalate (DBP), high temperature and aging. Compared with the poisoning model group, the sperm motility index of the poisoning + application intervention group is significantly improved, and the preparation can inhibit the activity of matrix metalloproteinase 1 (MMP1) to achieve an anti-wrinkle effect. Attached Figure Description
[0046] Figure 1 This is an HE staining result of frozen testicular tissue sections from mice in the control group, lead-poisoned group, and lead-poisoned group + smear group after the poisoning experiment in Example 2.
[0047] Figure 2 This is a bar chart showing the average level of epididymal sperm quality parameters in mice from the control group, lead-poisoned group, and lead-poisoned + smear intervention group when detecting mouse semen parameters in Example 2.
[0048] Figure 3 This is a bar chart showing the average level of epididymal sperm quality parameters in mice in the control group, DBP-treated group, and DBP-treated + smear intervention group when detecting mouse semen parameters in Example 2.
[0049] Figure 4 This is a bar chart showing the average level of epididymal sperm quality parameters in mice from the control group, high-temperature group, and high-temperature + treatment group when detecting mouse semen parameters in Example 2.
[0050] Figure 5 This is a bar chart showing the average level of epididymal sperm quality parameters in mice from the control group, aging group, and aging + treatment group when detecting mouse semen parameters in Example 2.
[0051] Figure 6 This refers to the PCR amplification results of the SKAP2 gene in Example 1;
[0052] Figure 7 This is the PCR identification result of the SKAP2 gene bacterial culture in Example 1;
[0053] Figure 8 This is the result of double enzyme digestion identification of the recombinant plasmid in Example 1. Detailed Implementation
[0054] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.
[0055] Example 1
[0056] This embodiment discloses a method for preparing a hydrogel formulation, including the following steps:
[0057] Step 1: Construct recombinant plasmids;
[0058] The SKAP2 gene was ligated into the pEGX-6P-1 vector using a recombination method to obtain a full-length SKAP2 recombinant plasmid.
[0059] The SKAP2 gene sequence is shown in SEQ ID NO.1:
[0060]
[0061] The specific steps for reconnecting the links include:
[0062] 1.1 The SKAP2 gene was amplified by PCR to obtain fragment PCR products;
[0063] Mix 34.5 μL of sterile water, 10 μL of 5×Buffer, and 1 μL of 10 mM dNTPs to obtain the working solution;
[0064] Add 2 μL of MIX mixture to the working solution and mix well to obtain the first round of reaction system;
[0065] The MIX mixture contains the full-length fragment of the SKAP2 gene (1104 bp).
[0066] The reaction system of round I was subjected to PCR amplification to obtain the product of round I;
[0067] The PCR reaction procedure is as follows:
[0068]
[0069] Mix 2 μL of the first primer, 2 μL of the tail primer, 2 μL of the first-round product, and 94 μL of the working solution to obtain the second-round reaction system;
[0070] The sequence of the first primer is shown in SEQ ID NO.2: GATCTGGAAGTT CTGTTCCAGGGGCCCCTGGGATCCCCTAATCCGAGCAGTACCAG CAGTCC,
[0071] The sequence of the tail primer is shown in SEQ ID NO.3: ATATCGGCGGTAGCCAT CATCATCATCACCATTAACTCGAGCGGCCGCATCGTGACTGACT GACGATCTGC;
[0072] The second-round reaction system was subjected to PCR amplification to obtain fragment PCR products;
[0073] The PCR reaction procedure is as follows:
[0074]
[0075] Furthermore, the brightness and size of the PCR product bands were detected by agarose gel electrophoresis, and the product size was 1104 bp.
[0076] 1.2 The fragment PCR product was recombined into the vector pGEX-6P-1 (BamHI-XhoI digested vector) by recombination to obtain the full-length SKAP2 gene and construct the recombinant plasmid.
[0077] The preparation of the BamHI-Xho enzyme digestion vector includes the following steps:
[0078] Mix 3 μL of pGEX-6P-1 plasmid, 0.5 μL of BamHI, 0.5 μL of XhoI, 1 μL of 10× digestion buffer, and 5.5 μL of ddH2O to obtain the digestion system; react the digestion system at 37℃ for 20 min to obtain the BamHI-Xho digestion vector.
[0079] Furthermore, the correctness of the restriction bands was determined by gel electrophoresis based on the Snapgene simulated restriction map;
[0080] The recombination method includes the following steps:
[0081] 5 μL of fragment PCR product, 5 μL of vector pGEX-6P-1, and 10 μL of 2× recombinase Mix (seamless assembly MIX) were mixed to obtain a total reaction system of 20 μL. The mixture was ligated at 52℃ for 30 min to obtain a recombinant plasmid containing the SKAP2 gene with a concentration of 100 ng / μL plasmid vector pGEX-6P-1.
[0082] Take 2 μL of recombinant plasmid containing the SKAP2 gene at a plasmid concentration of 100 ng / μL, add it to 100 μL of competent DH5α cells, mix well, place on ice for 3 min, incubate in a water bath at 42℃ for 90 s, transfer to an ice bath and place for 3 min, add 800 μL of LB medium at 37℃, shake in a shaker at 200 rpm at 37℃ for 40 min to obtain a bacterial suspension "with ampicillin resistance";
[0083] Further verification of the recombinant includes the following steps:
[0084] Prepare agar plates containing ampicillin resistance (containing ampicillin antibiotic 1:1000); take 100 μL of recombinant plasmid containing the SKAP2 gene of plasmid vector pGEX-6P-1 at a concentration of 100 ng / μL, spread it evenly on the agar plate containing ampicillin resistance, spread the bacterial solution on the surface of the plate with a sterile glass spreader, incubate the plate at 37℃ for 15 min, then invert the plate and incubate at 37℃ for 14 h. After the incubation is completed, pick bacteria from the plate, shake the bacteria at 250 r / min at 37℃ for 14 h, take the bacterial solution for PCR, and send the positive clone bacterial solution for sequencing;
[0085] Furthermore, the identification of the clone plasmid includes the following steps: PCR amplification of the SKAP2 gene fragment, screening for positive clones using the "ampicillin-resistant" bacterial culture PCR method, and obtaining positive bacterial cultures;
[0086] The sequence of the upstream primer is shown in SEQ ID NO.4: CCTAATCCGAG CAGTACCAGCAGT.
[0087] The sequence of the downstream primer is shown in SEQ ID NO.5: TAGCCATCATCATCAT CACCATTAA;
[0088] The amplified fragment is 1104 bp in length;
[0089] The PCR reaction system consisted of the following components: a 20 μL system, including 0.5 μL of upstream and downstream primers, 2 μL of "ampicillin-resistant" bacterial culture, 0.5 μL of 5 U / μL polymerase, 2 μL of 10x PCR Buffer, and 15 μL of ddH2O.
[0090] The PCR reaction procedure is as follows: (1) 96℃ pre-denaturation for 3 min, (2) 95℃ denaturation for 15 s, (3) 58℃ annealing for 15 s, (4) 72℃ extension for 20 s, (5) cycle (2)-(4) for a total of 23 cycles, (6) 72℃ final extension for 1 min.
[0091] The positive bacterial culture was shaken at 37℃, the cloning plasmid was extracted, sequenced, and then double-digested with restriction endonuclease BamHI-XhoI. The BamHI-XhoI restriction site is GGATCC, and the XhoI restriction site is CTCGAG, obtaining two fragments of 4960bp and 1110bp, which were then detected.
[0092] Step 2: Plasmid transformation;
[0093] 2.1 Transformation of competent cells;
[0094] Take 1 μL of the full-length SKAP2 gene to construct 1 μL of recombinant plasmid, add it to 100 μL of competent BL21(DE3) cells that have been thawed on ice, mix well, place on ice for 30 min, then transfer to a 42℃ water bath for 90 s heat shock, and quickly transfer to ice for 3 min to obtain competent cells containing the plasmid.
[0095] 800 μL of autoclaved LB medium was added to competent cells containing plasmid in a clean bench and cultured at 37°C and 220 rpm for 1 h. After the culture was completed, SKAP2 protein expression bacterial culture was obtained.
[0096] 2.2 Bacterial culture and collection;
[0097] Take LB agar culture dishes in the clean bench, pour 10 mL of agar culture medium (containing ampicillin antibiotic 1:1000) into each dish, and let it solidify to obtain solidified LB agar culture plates.
[0098] Take 100 μL of SKAP2 protein expression bacterial culture and spread it on a solidified LB agar plate. When the bacterial culture is almost dry, invert it and incubate it in a 37℃ constant temperature incubator for 12 h. After the culture is completed, pick the bacteria and place them in a 20 ml test tube containing 5 ml of LB medium (containing ampicillin antibiotic 1:1000). Shake gently at 37℃ and 220 rpm for 3 h to obtain the shaken bacterial culture.
[0099] Add 1 mL of small-scale bacterial culture to 100 mL of LB medium (containing ampicillin antibiotic 1:1000), incubate at 37℃ and 220 rpm for 3 h. When the OD value of the bacterial culture rises to the specified range, add IPTG inducer to make the final concentration of IPTG 0.5 mM. Incubate at 22℃ and 210 rpm for 18 h. After the culture is completed, centrifuge at 18000 g for 20 min, collect the centrifuged precipitate, resuspend the centrifuged precipitate with resuspension, break it up, centrifuge at 18000 g for 20 min, and collect the supernatant.
[0100] The specified range for the OD value of the bacterial suspension is 0.6-0.8; the resuspension contains 50mM Kcl and 25mM Tris, and the pH value is 8.0; 100mL of bacterial suspension corresponds to 3.5mL of resuspension.
[0101] Step 3: Protein purification;
[0102] Take the collected supernatant, add GST-beads, add 1 mL of solid-volume beads to 1 L of bacterial culture, pass through the column, after passing through the column, wash with 10 times the column volume of washing buffer, after washing with 10 times the column volume of elution buffer to obtain the elution buffer containing SKAP2 protein, post-process to obtain SKAP2 protein.
[0103] The washing solution contains 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4; the washing solution has a pH of 7.4 and is prepared by filtration using a 0.22 or 0.45 syringe filter; the eluent is GST eluent, which is prepared by mixing the equilibration solution with reduced glutathione, and the eluent contains 10 mM of reduced glutathione.
[0104] Step 4: Prepare mEXOs-encapsulated SKAP2 protein;
[0105] 4.1 Preparation of milk exosomes mEXOs;
[0106] The milk was pretreated by centrifugation at 4°C to remove fat and cell debris.
[0107] Pretreated milk was subjected to low-speed centrifugation, high-speed centrifugation, and ultra-speed centrifugation in sequence, washed, resuspended, and filtered to obtain milk exosomes mEXOs.
[0108] The low-speed centrifugation operation includes: centrifuging at 4℃ and 3000g for 10 minutes, and taking the supernatant; the high-speed centrifugation operation includes: centrifuging at 4℃ and 10000g for 30 minutes, discarding the precipitate, and taking the supernatant; the ultracentrifugation operation includes: centrifuging at 4℃ and 100000g for 60-90 minutes to precipitate exosomes.
[0109] The washing and resuspension process includes: resuspending the precipitate with PBS, centrifuging again at 100,000 g for 60 min to remove impurities, and then resuspending the precipitate again with PBS.
[0110] 4.2 Preparation of milk exosomes mEXOs encapsulating SKAP2 protein;
[0111] Milk exosomes mEXOs and SKAP2 protein prepared in step 3 were mixed in PBS at pH 7.4 at a mass ratio of 1:1, and the final concentration of mEXOs in the mixture was 4 μg / mL.
[0112] The mixture was treated with acoustic waves with the following settings: 20% amplitude, 6 on / off cycles of 30 seconds each, and a 2-minute cooling time between each cycle. After acoustic treatment, the unencapsulated SKAP2 protein in the supernatant was measured at 260 nm using a microplate reader. The mixture was then incubated at 37°C for 60 minutes to restore the exosome membrane, resulting in mEXOs-encapsulated SKAP2 protein.
[0113] Step 5: Prepare the SKAP2 hydrogel formulation;
[0114] Dissolve 4g of trehalose dihydrate in 80mL of water under sterile conditions. Add 2mL of mEXOs to encapsulate SKAP2 protein and stir for 10min. Add CMC in 5 portions, 0.6g each time, and stir for 30min each time. Let stand for 30min after stirring. Repeat 4 times until there are no visible bubbles in the solution and it is transparent, viscous and colorless to obtain SKAP2 hydrogel formulation.
[0115] The total protein concentration of mEXOs-encapsulated SKAP2 protein in the cosmetic composition was 225 ug / mL.
[0116] Example 2
[0117] This embodiment discloses a method for establishing a mouse model of chronic lead and DBP exposure, including the following steps:
[0118] Step (1): Prepare reagents;
[0119] 1.1 Preparation of lead acetate poisoning solution: Weigh 167.00g of anhydrous lead acetate and dissolve it in 1L of water to obtain a 167g / L lead acetate solution;
[0120] 1.2 Preparation of DBP solution: Weigh 2.83g of dibutyl phthalate (DBP) and dissolve it in 25mL of corn oil to obtain DBP solution;
[0121] Step (2): Establish a chronic lead poisoning model and a DBP poisoning model;
[0122] 2.1 Selecting experimental subjects;
[0123] The experiment was conducted on SPF-grade (5 months old) C57 mice weighing 25-32g. In the laboratory environment, the environmental conditions were maintained at room temperature of 25℃, relative humidity between 40-60%, and light-dark cycle of 12h (light on at 8:00 am and light off at 8:00 pm). Animal husbandry was strictly carried out in accordance with the Manual of Experimental Animal Experiment Committee of Army Medical University.
[0124] 2.2 Construction of lead exposure and DBP exposure models;
[0125] The mice selected in section 2.1 were randomly divided into five groups of six each. A chronic lead poisoning model was established by adding lead acetate to drinking water at a dose of 0.5 g / kg body weight, administered by gavage once a day for 21 consecutive days. A DBP poisoning model was established by adding DBP dissolved in corn oil to drinking water at a dose of 500 mg / kg body weight, administered by gavage once a day for 21 consecutive days. The five poisoning groups were: control group, lead poisoning group, lead poisoning + topical intervention group, DBP poisoning group, and DBP poisoning + topical intervention group.
[0126] Blood lead concentration was used as an indicator of exposure, and the diet and growth and development of mice were observed and recorded.
[0127] The body weight, heart, liver, spleen, lungs, kidneys, brain, testes, and epididymis of mice were observed. The weights of mouse tissues and organs are shown in Table 1.
[0128] Table 1. Organ weight and organ coefficient in mice modeling lead and DBP exposure.
[0129]
[0130]
[0131] Note: If the distribution is normal, use one-way ANOVA; if it is not normal, use nonparametric tests.
[0132] i: Control group, Pb, Pb+TC; o: Control group, DBP, DBP+TC
[0133] Table 1 shows that the results of the analysis of variance indicate that although the weights of these organs differed from those of the control group, the differences were not statistically significant (all p>0.05). The spleen weight of mice in the DBP-exposed + topical intervention group was greater than that of mice in the DBP-exposed group and significantly greater than that of mice in the control group (although p=0.074). The visceral coefficient of the mice was analyzed. The visceral coefficient is calculated as: visceral coefficient = tissue / organ weight / animal body weight. The results showed that the bilateral epididymal coefficients of mice in the DBP-exposed group and the DBP-exposed + topical intervention group were significantly smaller than those of the control group (p=0.008), indicating that DBP causes greater damage to the epididymis than lead, resulting in a relative reduction in epididymal weight. The kidney coefficients of mice in the lead-exposed group and the lead-exposed + topical intervention group were greater than those of the control group (although p=0.095).
[0134] Furthermore, the mice subjected to the poisoning experiment were analyzed, including:
[0135] (1) Testicular tissue sections and HE staining
[0136] 1.1 Tissue fixation: Fresh testicular tissue was dissected from mice after the poisoning experiment and immediately placed in tissue fixation solution or a special fixation solution corresponding to the tissue for 24 hours. The tissue was then stored and transported at room temperature. The tissue was removed from the fixation solution and the target tissue was trimmed and smoothed with a scalpel.
[0137] Fresh testicular tissue was dissected from mice after the poisoning experiment. The surface moisture of the tissue was absorbed with filter paper or gauze, and then flash-frozen in liquid nitrogen for 15 seconds. The tissue was then transferred to a -80°C freezer for storage and transported on dry ice to ensure that the samples remained in dry ice throughout the entire process before arriving at the laboratory, preventing the tissue from freezing and thawing. The tissue was then removed from the dry ice or the -80°C freezer and the target area was trimmed and smoothed with a scalpel.
[0138] 1.2 Dehydration: The trimmed and fixed tissue was placed in a 15 wt% sucrose solution and dehydrated at 4°C until it settled to the bottom. Then it was transferred to a 30 wt% sucrose solution and dehydrated at 4°C until it settled to the bottom.
[0139] Fresh tissue does not require dehydration.
[0140] 1.3 Embedding: Take out the dehydrated tissue, use filter paper to slightly dry the surface water, place it on the embedding stage with the cut side facing up, drop OCT embedding agent around the tissue, place the embedding stage on the quick-freezing stage for rapid freezing and embedding, and the tissue can be sectioned after the OCT turns white and hard.
[0141] Fresh tissue can be directly frozen sectioned without fixation and dehydration. The tissue at the target site can be trimmed and embedded in OCT embedding agent and sectioned directly with a scalpel.
[0142] 1.4. Frozen sectioning: Fix the embedding stage on the microtome, first make a rough cut to smooth the tissue surface, and then start sectioning. The section thickness is 8-10μm. Place a clean glass slide on top of the cut tissue section to attach the tissue to the glass slide. After labeling, store at -20℃ for later use.
[0143] 1.5 HE staining:
[0144] Dewax the sections until they are hydrated, then stain them with hematoxylin and eosin in sequence. After dehydration and clearing, the sections are mounted and the staining is complete.
[0145] In the staining results, the cell nucleus appears dark blue, while the cytoplasm, collagen fibers, etc., appear pink.
[0146] HE staining results of frozen testicular tissue sections from mice after the poisoning experiment are as follows: Figure 1 As shown;
[0147] Depend on Figure 1 It was found that in the control group, 5-7 layers of spermatogenic cells were visible in the seminiferous tubules, with cells exhibiting polarity and arranged neatly; a small number of short, spindle-shaped supporting cells were visible between the spermatogenic cells; spermatogenesis was visible in the middle of the lumen; in the lead poisoning group, the number of spermatogenic cells in the seminiferous tubules was significantly reduced, with only 3-4 layers, and a small number of sperm were visible in the middle of the lumen; in the lead poisoning group + smear group, compared with the lead poisoning group, the number of spermatogenic cells in the seminiferous tubules increased, mostly to 5-6 layers, with a slight increase in the tubular wall, and spermatogenesis was visible in the lumen;
[0148] (2) Detection of mouse semen parameters
[0149] After euthanizing the mice, the bilateral epididymal tails were longitudinally cut and placed on a 6-well plate containing 1 mL of HTF. The plate was kept at a constant temperature of 37°C for 2 min, and the epididymal tails were gently blown five times with a pipette to obtain the sample.
[0150] The above procedure is to ensure that the sperm can be completely freed from the tail of the epididymis;
[0151] Take 20 μL of epididymal tail fluid sample and add it to 1 mL of HTF culture medium. Place the sample in an EP tube and prepare it in advance in a 37°C water bath. After shaking and mixing, quickly take out 40 μL of the mixture and add it to a disposable sperm analysis plate. Then, use the automated sperm detection and analysis system (CASA) to detect the semen. 500 sperm are counted for each mouse.
[0152] Among them, the sperm motility-related indicators are: percentage of progressively motile sperm (PR), percentage of progressively motile and non-progressively motile sperm (PR+NP), percentage of hyperactivated sperm, mean curvilinear velocity (VCL) (μm / s), mean linear velocity (VSL) (μm / s), mean path velocity (VAP) (μm / s), forward motility (STR) (%), mean lateral swing amplitude (ALH) (μm), and mean whiplash frequency (BCF) (Hz).
[0153] After the tests were completed, the results were comprehensively statistically analyzed using SPSS 26.0 and R 4.2.1. For continuous variables conforming to a normal distribution, the mean ± standard deviation (Mean ± SD) was used for description, and the differences between the two groups were compared using t-tests. Further pairwise comparisons were performed between groups. If the variances of the groups were equal, the LSD method was used for comparison; if the variances were unequal, the Dunnett-t method was used. For data that did not conform to a normal distribution, the median (M) and quartiles (P25, P75) were used for description, and the Kruskal-Wallis H statistical method was used to compare the differences between the two groups. The results are shown in Table 2 and... Figure 2 , Figure 3 As shown:
[0154] Table 2. Average levels of epididymal sperm quality parameters in mice with lead and DBP exposure models.
[0155]
[0156]
[0157] Note: One-way ANOVA is used for samples conforming to a normal distribution; nonparametric tests are used for samples not conforming to a normal distribution.
[0158] a: Comparison with the control group; c: Pairwise comparison between dosage groups; i: Control group, Pb, Pb+TC; o: Control group, DBP, DBP+TC
[0159] **P<0.01, *P<0.05
[0160] Table 2 shows that the analysis of sperm quality parameters in the epididymis of mice revealed that, compared with the control group, the percentage of progressively motile sperm in the lead-poisoned group, the lead-poisoned + smear intervention group, and the DBP-poisoned group was significantly lower (all p < 0.05); the percentage of non-progressive motile sperm in the lead-poisoned group, the lead-poisoned + smear intervention group, and the DBP-poisoned group was significantly lower than that in the control group (all p < 0.01); multiple sperm quality parameters in the DBP-poisoned group were significantly lower than those in the control group (all p < 0.01); and multiple sperm quality parameters in the DBP-poisoned + smear intervention group were significantly higher than those in the control group (all p < 0.01).
[0161] Example 3
[0162] This embodiment discloses a method for establishing a mouse hyperthermia model and an aging model, including the following steps:
[0163] Step (1): Select experimental subjects;
[0164] The control group consisted of 5-month-old mice housed in an animal room at 25°C with ample water and food, and no intervention. The high-temperature intervention group and high-temperature treatment group consisted of 5-month-old mice, while the aging treatment group and aging group consisted of 19-month-old mice.
[0165] Step (2): Construction of high temperature model and aging model;
[0166] 2.1 High-Temperature Model Construction;
[0167] The temperature and humidity of the HOPE-MED 8050D mini extreme environment simulation chamber were set to 37.5℃ and 60%, respectively, with a light intensity of 50%. Mice were placed in the chamber for 2 hours after preheating to 37.5℃ and 60% humidity, with ample water and food provided for free access. This was repeated once daily from Monday to Saturday, with 24-hour intervals between each placement. Immediately after the high-temperature treatment, the mice were removed and allowed to return to room temperature for one hour. Gel was then applied to the scrotal skin area of the high-temperature intervention group, while the high-temperature group received no application. The mice were then returned to the animal house. After four weeks of high-temperature intervention, the intervention was discontinued, while the high-temperature treatment group continued the treatment for another 3 weeks. The high-temperature group received no other interventions. Each group consisted of 6-8 mice; one mouse in the high-temperature group died during the high-temperature treatment.
[0168] 2.2 High-Temperature Model Construction;
[0169] The hydrogel preparation prepared in Example 1 was applied to the scrotal skin of the aging treatment group once a day from Monday to Saturday, with an interval of 24 hours between each application. After treatment, the mice were returned to the animal room. Three mice in the aging treatment group and two mice in the aging group died due to aging.
[0170] Table 3. Organ weight and organ coefficient in mice in the high-temperature and aging groups.
[0171]
[0172]
[0173] Kidney coefficient
[0174]
[0175] Note: ANOVA was used for normal distributions, and Kruskal-Waillls was used for non-normal distributions. In the aging treatment study, there were differences in sperm hyperactivation levels among the three groups (P = 0.081), with the aging treatment group showing significantly higher hyperactivation than the aging group (P < 0.05). The aging treatment group also showed significantly higher VSL levels than the aging group (P < 0.05), but there were no significant differences in VSL levels among the three groups (P = 0.108). In the high-temperature treatment study, there were statistically significant differences in hyperactivation, VSL, STR, and BCF among the three groups (P < 0.05). The high-temperature group showed significantly higher hyperactivation, VSL, STR, and BCF levels than the control group (P < 0.05). There were also differences in PR, PRNP, VCL, VAP, and ALH levels among the three groups (P < 0.1), with the high-temperature group showing higher PR, PRNP, VCL, VAP, and ALH levels than the control group (P < 0.05).
[0176] Table 4. Average levels of epididymal sperm quality parameters in mice in the high-temperature and aging groups.
[0177]
[0178]
[0179] Note: ANOVA is used for normal distributions, and Kruskal-waillstest is used for non-normal distributions.
[0180] a: Comparison with the control group; c: Pairwise comparison of dosage groups; i: Control group, aging treatment group, aging group; o: Control group, high temperature treatment group, high temperature group
[0181] **P<0.01, *P<0.05
[0182] From Table 4, Figures 4-5 Analysis of sperm quality parameters in the epididymis of mice showed that, compared with the control group, the percentage of progressively motile sperm (PR), PR+NP, hyperactivated sperm, VCL, VSL, VAP, and STR were significantly lower in the high-temperature group (all p<0.01). All sperm parameters in the high-temperature treatment group were improved compared with the high-temperature group, especially the sperm hyperactivated rate and STR were significantly increased (all p<0.05). All sperm parameters in the aging group were lower than those in the control group, while the hyperactivated sperm rate in the aging treatment group was significantly higher than that in the aging group, with statistically significant differences (p<0.05).
[0183] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.
Citation Information
Patent Citations
Cosmetic composition, preparation method and application of cosmetic composition in anti-aging and anti-wrinkle skin
CN120771073A