Method for enhancing anti-tumor effect of adenovirus vaccine

Abstract

According to the method for enhancing the anti-tumor effect of the adenovirus vaccine, AIM2 inflammasome is taken as a target spot, the effect of treating kidney cancer and other malignant tumors by the adenovirus vaccine is improved by reversing PD-L1 + DCs mediated immunosuppression, and a new way and theoretical guidance are provided for tumor treatment by combining the adenovirus vaccine with an immune checkpoint vaccine or an inhibitor.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, in particular to a method for enhancing the anti-tumor effect of adenovirus vaccine. BACKGROUND

[0002] Replication-defective adenovirus (Ad) vaccine has the advantages of high antigen expression efficiency, strong immunogenicity, no integration with host genes and high safety, and has a wide application prospect. At present, the research of Ad vaccine in the field of tumor has attracted more and more attention, and is one of the hotspots of tumor immunotherapy in recent years. In the process of tumor treatment, Ad vaccine can induce the body's immune system to produce antigen-specific immune response, and then inhibit the occurrence and development of tumor. When treating tumor, Ad vaccine can specifically attack and destroy tumor cells without damaging normal cells. Therefore, the therapeutic tumor Ad vaccine can be used in principle to treat advanced malignant tumors that are difficult to treat by conventional therapies such as surgical resection, radiotherapy and chemotherapy.

[0003] Although the research of Ad vaccine in the field of tumor has made some progress, it often faces the problems of poor therapeutic effect, easy drug resistance and immune escape of tumor, which ultimately leads to the recurrence and metastasis of tumor. Therefore, in order to improve the therapeutic effect of Ad vaccine, it is necessary to further study the cellular and molecular mechanisms of tumor drug resistance and recurrence, immune escape in the process of vaccine treatment. SUMMARY

[0004] In view of the above problems, the present application uses recombinant non-replicating adenovirus vaccine as a tool, and through in vitro experiments, it is confirmed that AIM2 inflammasome mediated by Ad vaccine can regulate PD-L1 + DCs and the immunosuppressive effect of PD-L1 + DCs on CD4 / CD8 T cell anti-tumor effect; from the molecular level, the molecular mechanism of Ad regulating PD-L1 + DCs dysfunction, including interfering TLR2 / 3 / 4, AIM2 inflammasome, NF-κB and other signaling pathways and downstream IL-1β, IL-18, CCL5 or CCL10 factors; from the in vivo study, the mechanism of AIM2 inflammasome dependent PD-L1 ＋ DCs mediated tumor immune escape affects the mechanism of Ad vaccine treatment; and discusses the formation and function of AIM2 inflammasome or PD-L1 as a target to intervene PD-L1 ＋ DCs, inhibit tumor cell immune escape, enhance the therapeutic effect of Ad vaccine, and provide potential drug targets and theoretical guidance for the clinical Ad vaccine treatment of tumor and the combined treatment of immune checkpoint vaccine or inhibitor.

[0005] To achieve the above purpose, the specific technical solutions provided by the present application are as follows:

[0006] The first aspect of the present application provides use of an AIM2 inflammasome inhibitor in the preparation of a product for enhancing the anti-tumor effect of an adenovirus vaccine.

[0007] In the present application, the AIM2 inflammasome (AIM2 inflammasome) is a molecular complex in the cytoplasm that recognizes double-stranded DNA, which is composed of AIM2, ASC and Caspase-1, and belongs to a protein platform in cells, which is mainly composed of a N-terminal heat protein domain (PYD) and a C-terminal HIN domain. After binding to double-stranded DNA, AIM2 oligomers are formed, and the ligand ASC (apoptosis-associated protein containing caspase recruitment domain) is aggregated by PYD-PYD interaction, which initiates the innate immune response by cleaving pro-caspase-1 and converting IL-1β and IL-18 into mature forms.

[0008] In the present application, the enhancement of the anti-tumor effect of the adenovirus vaccine refers to that the anti-tumor effect level of the adenovirus vaccine is increased by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, or more, preferably, the enhancement has a statistical difference (P<0.05) compared to the case where the AIM2 inflammasome inhibitor is not administered.

[0009] Further, the AIM2 inflammasome inhibitor includes an artificially synthesized or naturally occurring one.

[0010] Further, the AIM2 inflammasome inhibitor includes an agent that inhibits the formation of the AIM2 inflammasome complex, and / or one or more of an AIM2 inhibitor, a Caspase-1 inhibitor.

[0011] Further, the AIM2 inflammasome inhibitor inhibits the formation of the AIM2 inflammasome complex, inhibits the expression level of AIM2, inhibits the expression level of Caspase-1, and / or inhibits PD-L1 ＋ The function of the DC cell subpopulation is to enhance the anti-tumor effect of the adenovirus vaccine.

[0012] In the present invention, the term "expression level" refers to the amount, accumulation, or rate of a biological molecule. The expression level can be represented by the amount or rate of synthesis of messenger RNA (mRNA) encoded by a gene, the amount or rate of synthesis of a polypeptide or protein encoded by a gene, or the amount or rate of accumulation of a biological molecule in a cell or a biological fluid.

[0013] In the present invention, PD-L1 ＋ The DC cell subpopulation is a specific subpopulation of dendritic cells (DCs) that express a Programmed Death Ligand 1 (PD-L1) molecule.

[0014] Further, the tumor includes renal cancer, prostate cancer, liver cancer, lung cancer, colorectal cancer, cervical cancer, breast cancer, esophageal cancer, pancreatic cancer, nasopharyngeal cancer, oral cancer, laryngeal cancer, gastric cancer, thyroid cancer, bone cancer, melanoma, lymphoma, acute myeloid leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, endometrial cancer, ovarian cancer, skin cancer, multiple myeloma, glioma, or bladder cancer.

[0015] Further, the tumor is renal cancer.

[0016] In the present invention, AIM2 (Absent in melanoma 2) includes wild type, mutant, fragment, or a protein translated from the same. The term encompasses full-length, unprocessed AIM2, as well as any form of AIM2 that results from processing in the cell. The term encompasses naturally occurring variants of AIM2 (e.g., splice variants or allelic variants). The term encompasses, for example, the AIM2 gene, murine AIM2, and AIM2 from any other vertebrate source, including humans, mammals such as primates and rodents (e.g., mice and rats). As a preferred embodiment, in the present invention, AIM2 is a murine gene, Gene ID 383619.

[0017] Further, the AIM2 inhibitor includes a substance that inhibits the expression level of AIM2 mRNA and / or a substance that inhibits the expression level of AIM2 protein.

[0018] Further, the substance that inhibits the expression level of AIM2 mRNA includes one or more of shRNA, siRNA, antisense oligonucleotide, ribozyme targeting AIM2.

[0019] Further, the substance that inhibits the expression level of AIM2 protein includes one or more of monoclonal antibody, small molecule compound.

[0020] Further, the AIM2 inhibitor is shRNA targeting AIM2.

[0021] Further, the sequence of the shRNA targeting AIM2 is shown as SEQ ID NO: 1.

[0022] In the present application, Caspase-1, also known as CASP1, ICE, P45, IL1BC, includes wild type, mutant, fragment or its translationally expressed protein. The term encompasses full-length, unprocessed Caspase-1, as well as any form of Caspase-1 that results from processing in the cell. The term encompasses naturally occurring variants of Caspase-1 (e.g., splice variants or allelic variants). The term encompasses, for example, the Caspase-1 gene, murine Caspase-1, and Caspase-1 from any other vertebrate source, including human, mammalian, such as primates and rodents (e.g., mice and rats). As a preferred embodiment, in the present application, Caspase-1 is the murine gene, Gene ID 12362.

[0023] Further, the Caspase-1 inhibitor includes a substance inhibiting Caspase-1 mRNA expression level and / or a substance inhibiting Caspase-1 protein expression level.

[0024] Further, the substance inhibiting Caspase-1 mRNA expression level includes one or more of shRNA, siRNA, antisense oligonucleotide, ribozyme targeting Caspase-1.

[0025] Further, the substance inhibiting Caspase-1 protein expression level includes one or more of monoclonal antibody, small molecule compound.

[0026] Further, the Caspase-1 inhibitor is AC-YVAD-CMK.

[0027] AC-YVAD-CMK (Caspase-1 Inhibitor II) is a selective irreversible Caspase-1 (also known as Interleukin-1β converting enzyme, ICE) inhibitor, which achieves long-lasting inhibition by covalently modifying the cysteine residue in the active site of Caspase-1. The compound has the molecular formula of C 24 H 33 ClN4O8, CAS No. 178603-78-6, is a white to off-white solid at room temperature, and needs to be stored at -20℃ in a sealed container to maintain stability.

[0028] In the context of the present application, the adenovirus vaccine is a kind of vaccine that uses adenovirus as a carrier to introduce the gene encoding the target antigen into human cells, so that the cells express the antigen and trigger an immune response. The adenovirus vector includes a replication-defective adenovirus vector, a replication-competitive adenovirus vector, a conditional replication adenovirus vector, a full-genome deletion adenovirus vector, a chimeric adenovirus vector, a targeted adenovirus vector, and a regulatable expression adenovirus vector. The target antigen includes a viral surface protein, a conserved antigen, a tumor-associated antigen, or a combination of multiple antigens.

[0029] Further, the adenovirus vaccine includes a replication-defective adenovirus vector and genetic material encoding the target antigen.

[0030] Further, the replication-defective adenovirus vector is pCA13.

[0031] Further, the target antigen is CD137L or CAIX.

[0032] The second aspect of the present application provides a pharmaceutical composition for enhancing the anti-tumor effect of an adenovirus vaccine, which includes the AIM2 inflammasome inhibitor and / or the PD-L1 inhibitor described in the first aspect of the present application.

[0033] Further, the pharmaceutical composition further includes the adenovirus vaccine described in the first aspect of the present application.

[0034] Further, the PD-L1 inhibitor includes one or more of a monoclonal antibody or a small molecule compound.

[0035] Further, the monoclonal antibody includes one or more of durvalumab, atezolizumab, avelumab, and envafolimab.

[0036] Further, the pharmaceutical composition further includes a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, and / or an excipient.

[0037] The "pharmaceutically acceptable carrier or excipient" refers to a non-toxic solid, semi-solid, or liquid filler, diluent, encapsulating material, or any type of formulation aid.

[0038] Further, the pharmaceutically acceptable excipient includes one or more of a diluent, a filler, a binder, a wetting agent, a disintegrant, an emulsifying agent, a co-solvent, a solubilizer, an osmotic pressure regulator, a surfactant, a coating material, a coloring agent, a pH regulator, an antioxidant, or a bacteriostatic agent.

[0039] Further, the dosage form of the pharmaceutical composition includes an intravenous injection preparation, an in situ injection preparation, a subcutaneous injection preparation, a capsule preparation, a granule preparation, a sustained-release preparation, an oral preparation, a powder, or a pill.

[0040] The third aspect of the present application provides the use of the pharmaceutical composition of the second aspect of the present application in the preparation of a tumor treatment product, wherein the tumor includes renal cancer, prostate cancer, liver cancer, lung cancer, colorectal cancer, cervical cancer, breast cancer, esophageal cancer, pancreatic cancer, nasopharyngeal cancer, oral cancer, laryngeal cancer, gastric cancer, thyroid cancer, bone cancer, melanoma, lymphoma, acute myeloid leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, endometrial cancer, ovarian cancer, skin cancer, multiple myeloma, glioma or bladder cancer.

[0041] Further, the tumor is renal cancer.

[0042] Advantages and beneficial effects of the present application: The tumor immune escape regulation mechanism provided by the present application provides a new discovery of Ad vaccine in the field of tumor immune escape treatment, deepens the scientific understanding of the mechanism of tumor immune escape mediated by PD-L1+DCs, and helps to explain the mechanism of recurrence and metastasis in the treatment of renal cancer and other malignant tumors from a new perspective. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 Figure 1 is a result graph of Ad-CD137L / CAIX vaccine promoting the induction of DCs and the expression of PD-L1 on the surface of DCs, wherein A is the statistical analysis of the expression of CD11c + DCs ratio in the mouse spleen and TIMCs after immunization with Ad vaccine; B-D are the statistical analysis of the expression of CD80 (B), CD86 (C) and MHC-II molecules (D) on the surface of CD11c + DCs; E is the expression of PD-L1 on the surface of CD11c + DCs in the mouse spleen detected by flow cytometry; F is the expression of PD-L1 + CD11c + cell percentage statistical graph; G is the expression of PD-L1 on the surface of CD11c + DCs in TIMCs detected by flow cytometry; H is the expression of PD-L1 + CD11c + cell percentage statistical graph.

[0044] Figure 2 Figure 2 is a result graph of blocking PD-L1 to enhance the anti-tumor effect of CD8 + T cells induced by Ad-CD137L / CAIX vaccine, wherein A-B are the flow cytometry detection of PD-L1 + CD11c +Statistical graph of the proportion of cells; C is the statistical graph of tumor volume at different treatment time points; D is the statistical graph of tumor volume 56 days after tumor inoculation; E is the statistical graph of tumor weight; F is the statistical graph of tumor inhibition rate; G is the statistical graph of CD8 + The proportion of T cells; H is the immunohistochemical detection of CD8 + Representative images of T cells.

[0045] Figure 3 To block PD-L1 + DCs promote the induction of polyfunctional CD8 + Figure 1 shows the results of T cell anti-tumor immune response, where AB represents flow cytometry detection of IFN-γ in spleen (A) or tumor tissue (B) after combined treatment with Ad-CD137L / CAIX vaccine and PD-L1 monoclonal antibody. + CD8 + T, IL-2 + CD8 + T, TNF-α + CD8 + The proportion of T cells; CD is the flow cytometry detection of IFN-γ in spleen (C) or tumor tissue (D) + TNF-α + IFN-γ + IL-2 + IL-2 + TNF-α + IFN-γ + IL-2 + TNF-α + CD8 + The proportion of T cells; EF is a pie chart for statistical analysis of single, bi and trifunctional CD8 + The percentage of each T cell; G is EdU experiment to detect CD8 + T cell proliferation statistics; H is the CTL killer cell index statistics.

[0046] Figure 4Figure for Ad-CD173L / CAIX induced AIM2 inflammasome activation positively correlated with PD-L1 expression. After Ad vaccine treatment, tumor tissue DCs were isolated for analysis. A, Western blot detection of inflammasome components AIM2, ASC, Pro-caspase-1, Pro-IL-1β expression; B, expression ratio statistics chart of A relative to GAPDH; C, Caspase-1 activity statistics chart; D, ELISA detection of IL-1β expression level statistics chart; E-H, correlation statistics analysis of PD-L1 mRNA expression and inflammasome components AIM2 (E), ASC (F), Caspase-1 (G), IL-1β (H) mRNA expression.

[0047] Figure 5 Blocking AIM2 inflammasome to reduce Ad vaccine induced PD-L1 ＋ DCs, increase functional CD8 + T cell immune response. A, Western blot detection of AIM2, ASC, Pro-caspase-1, Pro-IL-1β expression; B, expression ratio statistics chart of each component relative to GAPDH; C, Caspase-1 activity statistics chart; D, ELISA detection of IL-1β expression level statistics chart; E, flow cytometry detection of PD-L1 expression on the surface of DCs after treatment; F, PD-L1 + DCs proportion statistics chart; G, co-culture of DCs and CD8 + T cells, EdU experiment to detect CD8 + T cell proliferation statistics chart; H, flow cytometry detection of polyfunctional CD8 ＋ T cells in co-culture system; H, flow cytometry detection of polyfunctional CD8

[0048] Figure 6 AIM2 inflammasome mediated PD-L1 + DCs affect the mode of Ad vaccine treatment effect. DETAILED DESCRIPTION

[0049] All kinds of reagents involved in the technical solutions and experimental processes described in the present application are common reagents or commercial reagents that can be clearly known and easily obtained by those skilled in the art based on their professional knowledge and conventional practice. The description of reagents in the present application is intended to clearly illustrate the material basis involved in the technical solutions, and those skilled in the art can successfully obtain and correctly use these reagents based on their professional accomplishment and industry common sense to achieve the technical purpose of the present application.

[0050] With reference to the drawings of the embodiments of the present application, the technical solutions in the embodiments of the present application will be described clearly and completely. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments of the present application, all the other embodiments obtained by those skilled in the art without creative work fall within the protection scope of the present application.

[0051] Embodiments

[0052] I. Materials and methods

[0053] 1. Material reagents: Renca cells (Nanjing Kebai Biological Technology Co., Ltd.), BALB / c mice (6-8 weeks old, Xuzhou Medical University Experimental Animal Center), PE-labeled anti-human CAIX antibody (R&D Systems, item number: FAB2188P), PE-labeled anti-mouse PD-L1 antibody (BioLegend, item number: 124308), APC-labeled anti-mouse CD11c antibody (BioLegend, item number: 117310), PerCP-Cy5.5-labeled anti-mouse CD8a antibody (BioLegend, item number: 100734), FITC-labeled anti-mouse CD11b antibody (BioLegend, item number: 101206), APC-labeled anti-mouse IFN-γ antibody (BioLegend, item number: 505810), FITC-labeled anti-mouse TNF-α antibody (BioLegend, item number: 506304), PE-labeled anti-mouse IL-2 antibody (BioLegend, item number: 503808), anti-mouse AIM2 antibody (Cell Signaling Technology, item number #63660), anti-mouse ASC antibody (Sigma-Aldrich, item number: 04-147), anti-mouse Pro-caspase-1 antibody (Cell Signaling Technology, item number: #24232), anti-mouse Pro-IL-1β antibody (Cell Signaling Technology, item number: #12426), anti-mouse GAPDH antibody (Cell Signaling Technology, item number: #2118), Caspase-1 inhibitor AC-YVAD-CMK (Sigma-Aldrich, item number: SML0429).

[0054] 2、Ad-CD137L / CAIX vaccine: The full-length fragment of mouse CD137L or human CAIX was obtained by PCR amplification from pEnCMV-CD137L or pcDNA3.1-hCAIX plasmid, respectively. The CD137L primer sequences were: forward primer 5'-TTAAGCTTATGGACAGCACACACTTGATGTGGAG-3' (SEQ ID NO: 2), reverse primer 5'-TGCTCTAGATTCCCATGGGTTGTCGGGTTTCAC-3' (SEQ ID NO: 3); the CAIX primer sequences were: forward primer 5'-TTAAGCTTATGGCTCCCCTGTGCCCCAGC-3' (SEQ ID NO: 4), reverse primer 5'-TGCTCTAGAGGCTCCAGTCTCGGCTACCTCTGCTG-3' (SEQ ID NO: 5). The PCR products were cloned into the shuttle vector pCA13 through Hind III and Xba I enzyme sites to construct the pCA13-CD137L or pCA13-CAIX plasmid. Subsequently, the constructed plasmid was co-transfected with the pPE3 backbone plasmid into HEK293 cells to obtain the recombinant adenovirus Ad-CD137L or Ad-CAIX through homologous recombination. The control virus Ad-Ctrl was also constructed in HEK293 cells. About 9-14 days after transfection, the plaque formed by virus infection in HEK293 cells was observed. Subsequently, the large-scale purification of adenovirus was performed by cesium chloride density gradient ultracentrifugation, and the virus titer was determined by plaque assay in HEK293 cells.

[0055] 3、Mouse renal cancer model: In the subcutaneous transplantation model, 2 × 10 5 hCAIX-Renca cells were suspended in 100 μl PBS and injected subcutaneously into the right groin of the mice (solid tumor model). In the vaccine immunization experiment, the subcutaneous tumor model mice were randomly divided into four groups on the 7th day after tumor inoculation, and 3 × 10 8PFU of Ad-Ctrl, Ad-CD137L, Ad-CAIX, or Ad-CD137L / CAIX vaccine were administered. Booster immunizations were then administered on days 7, 17, and 27. Tumor volume was measured weekly using a digital caliper and calculated using the formula V (mm³) = (length × width²) / 2. Mice were sacrificed on day 42, dissected, photographed, and tumors weighed. Tumor tissue was removed from the mice and gently homogenized to release single cells. The resulting cell suspension was filtered through a 70 μm cell sieve to remove tissue debris and obtain a single-cell suspension. Erythrocytes were lysed using ACK lysis buffer. Tumor-infiltrating lymphocytes were then isolated from the single-cell suspension using 33.33% Percoll (VICMED Biotechnology Co., Ltd., Catalog No. VIC1555) density gradient centrifugation for subsequent experimental analysis.

[0056] 2. Experimental Results

[0057] 1. Ad vaccine induces the functional maturation of DCs cells and the expression of PD-L1 on their surface.

[0058] To investigate the characteristics of DCs induced by Ad vaccines, flow cytometry was first used to detect the number of DCs and the expression of their functional maturation molecules. Compared with the control group, Ad-CD137L / CAIX vaccine significantly induced an increase in the proportion of DCs in the spleen and tumor tissues ( Figure 1 A in the figure), and promotes the expression of CD80, CD86, and MHC-II molecules ( Figure 1 These results indicate that Ad-CD137L / CAIX vaccine can effectively induce the increase in the proportion of DCs cells and their functional maturation. Further studies found that the expression of PD-L1 on the surface of DCs induced by Ad vaccine was significantly increased, among which PD-L1 + The proportion of DCs was the highest in the Ad-CD137L / CAIX vaccine group ( Figure 1 These results suggest that Ad-CD137L / CAIX vaccine promotes PD-L1 expression while inducing DCs cell maturation. + Formation and infiltration of DCs.

[0059] 2. Blocking PD-L1 + DCs enhance the therapeutic effect of Ad-CD137L / CAIX vaccine.

[0060] During the treatment of renal cancer with Ad-CD137L / CAIX vaccine, PD-L1 in the tumor microenvironment is activated. + In order to study the infiltration of PD-L1 +To investigate whether DCs affect the therapeutic effect of the vaccine, we used PD-L1 monoclonal antibody to block PD-L1. + The results of flow cytometry experiments showed that PD-L1 monoclonal antibody could effectively delete PD-L in the spleen or tumor tissue of immunized mice. + DCs Figure 2 AB in the figure); 56 days after tumor inoculation, Ad-CD137L / CAIX vaccine can inhibit tumor progression but cannot completely eliminate tumor growth, while Ad-CD137L / CAIX vaccine combined with PD-L1 monoclonal antibody treatment can completely eliminate tumor growth ( Figure 2 Further studies have shown that combined therapy promoted the expression of CD8 + The increase and infiltration of T cells ( Figure 2 GH in the + T cell anti-tumor immune response. These results indicate that PD-L1 + DCs are important immunosuppressive cells that attenuate the therapeutic effects of Ad-CD137L / CAIX vaccine.

[0061] 3. Blocking PD-L1 + DCs enhance the multifunctional CD8 + T cell anti-tumor immune response.

[0062] Multifunctional CD8 + T cell immune response plays an important role in the anti-tumor process, so it is necessary to study PD-L1 + Do DCs inhibit the multifunctional CD8 + Compared with the control group, the IFN-γ expression in the spleen and tumor tissues of the Ad-CD137L / CAIX and PD-L1 monoclonal antibody combination treatment group was significantly higher than that of the control group. + CD8 + T, IL-2 + CD8 + T, TNF-α + CD8 + The proportion of T cells increased significantly ( Figure 3 Similarly, IFN-γ + TNF-α + IFN-γ + IL-2 + IL-2 + TNF-α + IFN-γ + IL-2 + TNF-α + CD8+ The proportion of T cells also increased significantly in the combined treatment group ( Figure 3 Statistical analysis of these functional subpopulations revealed that bifunctional and trifunctional CD8 + The proportion of T cell subsets increased significantly ( Figure 3 EF in the PD-L1 + DCs promote Ad-CD137L / CAIX-induced multifunctional CD8 + In addition, blocking PD-L1 + After DCs are activated, CD8 + T cell proliferation was significantly increased ( Figure 3 G in), while enhancing the killing effect of CD8 T cells on tumor target cells ( Figure 3 These results suggest that blocking PD-L1 + DCs enhance the multifunctional CD8 + T cell anti-tumor immune response.

[0063] 4. Ad-CD137L / CAIX-induced AIM2 inflammasome activation was positively correlated with the expression of PD-L1 on the surface of DCs.

[0064] After Ad vaccine treatment of renal cancer mice, DCs were isolated from tumor tissues and Western blot analysis was performed to detect AIM2 inflammasome activation. The results showed that compared with the control group, the expression of AIM2, ASC, Pro-caspase-1, and Pro-IL-1β in DCs in the Ad vaccine group was increased, especially in the Ad-CD137L / CAIX group ( Figure 4 AB in), suggesting that Ad vaccine can induce the activation of AIM2 inflammasome ( Figure 4 In addition, the activity of Caspase-1 and the level of IL-1β increased most significantly in the Ad-CD137L / CAIX group, further confirming that the Ad-CD137L / CAIX group induced inflammasome activation ( Figure 4 To investigate whether Ad vaccine-induced AIM2 inflammasome activation is associated with PD-L1 expression on the surface of DCs, correlation analysis was performed to analyze the relationship between AIM2, ASC, Caspase-1, and IL-1β mRNA expression and PD-L1 mRNA expression in DCs treated with Ad-CD137L / CAIX. The results showed that PD-L1 expression was positively correlated with AIM2, Caspase-1, and IL-1β expression, but not with ASC expression. These results suggest that Ad-CD137L / CAIX-induced AIM2 inflammasome activation is positively correlated with PD-L1 expression on the surface of DCs.

[0065] 5、Block AIM2 inflammasome activation inhibits the expression of PD-L1 on DCs surface, increases the anti-tumor effect of specific CD8 T cells.

[0066] To further investigate whether AIM2 inflammasome activated by Ad vaccine regulates the expression and function of PD-L1 on DCs surface, AIM2 inflammasome activation was intervened in vitro, and the expression of PD-L1 on DCs surface was observed. + Function and characteristics of DCs. After being treated with AIM2 shRNA (GCCATGTGGAACAATTGTGAA, SEQ ID NO: 1) or Caspase-1 inhibitor AC-YVAD-CMK (Sigma-Aldrich, SML0429), DCs infiltrated in tumor tissues of Ad-CD137L / CAIX immunized mice were isolated, and the activation of AIM2 inflammasome in DCs was detected. Compared with the control group, down-regulation of AIM2 or use of inflammasome inhibitor can significantly inhibit the expression of AIM2, ASC, Pro-caspase-1, Pro-IL-1β, the components of inflammasome (A-B in Figure 5 Correspondingly, down-regulation of AIM2 or inhibition of Caspase-1 by inhibitor also effectively inhibits the production of Caspase-1 and IL-1β, the downstream products of inflammasome (C-D in Figure 5 These results show that down-regulation of AIM2 or inhibition of Caspase-1 by inhibitor can effectively inhibit the activation of AIM2 inflammasome. Further research found that down-regulation of AIM2 or inhibition of Caspase-1 can effectively inhibit the expression of PD-L1 on DCs surface induced by Ad-CD137L / CAIX vaccine (C-D in Figure 5 + T cells specific to the antigen were co-cultured with DCs inhibited by AIM2 inflammasome, and under the stimulation of CAIX antigen, the proliferation of CD8 T cells was significantly increased, and the ability to secrete IFN-γ, IL-2 and TNF-α was also significantly increased. These results show that blocking the activation of AIM2 inflammasome can inhibit the expression of PD-L1 on DCs surface and promote the anti-tumor immune response of specific and multifunctional CD8 T cells.

[0067] In summary of the above experimental results, adenovirus vaccine (Ad vaccine) induces the activation of AIM2 inflammasome through TLRs signaling pathway, thereby regulating the expression of PD-L1 ＋ DCs mediated immune escape in the treatment of renal cancer, and the mode diagram is as follows Figure 6 ​The tumor immune escape regulation mechanism provided by the present research provides a new discovery of the Ad vaccine in the field of tumor immune escape treatment, deepens the scientific cognition of the tumor immune escape mechanism mediated by PD-L1+ DCs, and helps to explain the mechanism of recurrence and metastasis in the treatment of renal cancer and other malignant tumors from a new perspective.

[0068] The above description of the embodiments is only for understanding the method of the present application and its core idea. It should be noted that, for those skilled in the art, without departing from the principles of the present application, the present application can be improved and modified in several ways, and these improvements and modifications will also fall within the protection scope of the claims of the present application.

Claims

1. Application of AIM2 inflammasome inhibitors in the preparation of products that enhance the anti-tumor effects of adenovirus vaccines.

2. The use according to claim 1, characterized in that The AIM2 inflammasome inhibitors include those synthesized artificially or naturally occurring; Preferably, the AIM2 inflammasome inhibitor comprises an agent that inhibits the formation of the AIM2 inflammasome complex, and / or one or more of an AIM2 inhibitor and a Caspase-1 inhibitor; Preferably, the AIM2 inflammasome inhibitor inhibits the formation of the AIM2 inflammasome complex, inhibits the expression level of AIM2, inhibits the expression level of Caspase-1 and / or inhibits PD-L1. ＋ DC cell subset function to enhance the anti-tumor effect of adenovirus vaccine; Preferably, the tumor comprises renal cancer, prostate cancer, liver cancer, lung cancer, colorectal cancer, cervical cancer, breast cancer, esophageal cancer, pancreatic cancer, nasopharyngeal cancer, oral cancer, laryngeal cancer, gastric cancer, thyroid cancer, bone cancer, melanoma, lymphoma, acute myeloid leukemia, acute lymphocytic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, endometrial cancer, ovarian cancer, skin cancer, multiple myeloma, glioma or bladder cancer; Preferably, the tumor is renal cancer.

3. The use according to claim 2, characterized in that The AIM2 inhibitors include substances that inhibit the expression level of AIM2 mRNA and / or substances that inhibit the expression level of AIM2 protein; Preferably, the substance that inhibits the expression level of AIM2 mRNA includes one or more of shRNA, siRNA, antisense oligonucleotide, and ribozyme targeting AIM2; Preferably, the substance that inhibits the expression level of AIM2 protein includes one or more of monoclonal antibodies and small molecule compounds; Preferably, the AIM2 inhibitor is a shRNA targeting AIM2; Preferably, the sequence of the shRNA targeting AIM2 is shown as SEQ ID NO:

1.

4. The use according to claim 2, characterized in that The Caspase-1 inhibitors include substances that inhibit the expression level of Caspase-1 mRNA and / or substances that inhibit the expression level of Caspase-1 protein; Preferably, the substance that inhibits the expression level of Caspase-1 mRNA includes one or more of shRNA, siRNA, antisense oligonucleotide, and ribozyme targeting Caspase-1; Preferably, the substance that inhibits the expression level of Caspase-1 protein includes one or more of monoclonal antibodies and small molecule compounds; Preferably, the Caspase-1 inhibitor is AC-YVAD-CMK.

5. The use according to claim 1, characterized in that The adenovirus vaccine comprises a replication-defective adenovirus vector and genetic material encoding a target antigen; Preferably, the replication-defective adenoviral vector is pCA13; Preferably, the target antigens are CD137L and CAIX.

6. A pharmaceutical composition for enhancing the anti-tumor effect of adenovirus vaccine, characterized in that: The pharmaceutical composition comprises the AIM2 inflammasome inhibitor and / or PD-L1 inhibitor according to any one of claims 2 to 4; Preferably, the pharmaceutical composition further comprises the adenovirus vaccine as claimed in claim 5.

7. The pharmaceutical composition according to claim 6, characterized in that The PD-L1 inhibitor includes one or more of monoclonal antibodies and small molecule compounds; Preferably, the monoclonal antibodies include one or more of durvalumab, atezolizumab, sugemalimab, adebelimumab, and envoralizumab.

8. The pharmaceutical composition according to claim 6, characterized in that The pharmaceutical composition further comprises a pharmaceutically acceptable carrier, a pharmaceutically acceptable adjuvant and / or an excipient; Preferably, the pharmaceutically acceptable excipients include one or more of diluents, fillers, binders, wetting agents, disintegrants, emulsifiers, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH regulators, antioxidants or antibacterial agents.

9. The pharmaceutical composition according to claim 6, characterized in that The dosage forms of the pharmaceutical composition include intravenous injection preparations, in situ injection preparations, subcutaneous injection preparations, capsule preparations, granule preparations, sustained-release preparations, oral preparations, powders or pills.

10. Use of the pharmaceutical composition according to any one of claims 6 to 9 in the preparation of a tumor treatment product, characterized in that: The tumor includes renal cancer, prostate cancer, liver cancer, lung cancer, colorectal cancer, cervical cancer, breast cancer, esophageal cancer, pancreatic cancer, nasopharyngeal cancer, oral cancer, laryngeal cancer, gastric cancer, thyroid cancer, bone cancer, melanoma, lymphoma, acute myeloid leukemia, acute lymphocytic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, endometrial cancer, ovarian cancer, skin cancer, multiple myeloma, glioma or bladder cancer; Preferably, the tumor is renal cancer.

Images