Immunogenic compositions and methods for inducing immune response against varicella zoster virus

Abstract

The present disclosure provides methods of inducing an immune response against varicella zoster virus (VZV) in a human subject. The methods provided herein comprise administering to a human subject an immunogenic composition (e.g., a vaccine) comprising an RNA molecule formulated in a lipid nanoparticle. The disclosure also relates to the use of the immunogenic composition for the prevention or treatment of herpes zoster in a human subject.

Description

[0001] Reference to Sequence Listing

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML file named “PC072942A Sequence Listing.xml” was created on January 8, 2024, and is 791 KB in size. BACKGROUND

[0003] Herpes Zoster (HZ), also known as shingles, is caused by reactivation of varicella zoster virus (VZV), also known as human herpes virus 3 (HHV-3), in individuals who have had a primary infection (varicella or “chickenpox”). A substantial proportion of individuals (~33%) will develop HZ in their lifetime, and many will experience painful post-herpetic neuralgia (PHN). The risk of developing HZ is highest in older adults and can lead to decreased quality of life and increased economic burden on the healthcare system. Two vaccines have been developed and licensed in many countries for the prevention of HZ. The first is ZOSTAVAX® (Merck & Co., Inc., Kenilworth, NJ, USA), which is a live attenuated VZV vaccine. ZOSTAVAX® was approved by the US FDA in 2006 for the prevention of HZ in adults 60 years of age and older. ZOSTAVAX® is indicated for the prevention of HZ in adults 60 years of age and older. ZOSTAVAX® is not indicated for the prevention of HZ in younger adults. However, as of November 2020, is no longer sold in the United States. The second is SHINGRIX® (GlaxoSmithKline, Rockville, MD, USA), which is an AS01 B adjuvanted VZV gE subunit protein vaccine. SHINGRIX® was approved by the US FDA in 2017 for the prevention of HZ in adults 50 years of age and older. SHINGRIX® is indicated for the prevention of HZ in adults 50 years of age and older. SHINGRIX® is not indicated for the prevention of HZ in younger adults.

[0004] While vaccines have been approved for the prevention of HZ, the incidence of HZ continues to rise. Furthermore, HZ vaccines have not been widely adopted in many countries, and there are other limitations, such as contraindications in immunosuppressed populations, and poorer tolerability safety compared to other adult vaccines. Thus, there remains an unmet medical need for improved tolerability and availability of HZ vaccines. SUMMARY

[0005] The present disclosure provides a method of inducing an immune response against varicella zoster virus (VZV) in a human subject, the method comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE binding antibodies are induced in the subject. Also provided is a method of preventing, treating, ameliorating, and / or reducing the risk of an infection, disease, or condition associated with VZV in a human subject, the method comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE binding antibodies are induced in the subject. In one aspect, the present disclosure provides a method of preventing herpes zoster in a human subject, the method comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE binding antibodies are induced in the subject. In another aspect, the present disclosure provides a method of preventing post-herpetic neuralgia in a human subject, the method comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE binding antibodies are induced in the subject.

[0006] In some aspects, the geometric mean concentration (GMC) of VZV gE antibodies in the subject is higher at about 1 month after the first dose than the GMC of VZV gE antibodies in the subject at baseline.

[0007] In some aspects, the GMC of VZV gE antibodies in the subject at about 1 month after the first dose is at least 25,000, 30,000, 35,000, 40,000, 45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000 mIU / mL or more.

[0008] In some aspects, a dose response is observed in the subject at about 1 month after the first dose.

[0009] In some aspects, the GMC of VZV gE antibodies in the subject is at least 1.1x (i.e., 1.1-fold), 1.2x, 1.3x, 1.4x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 15x, 20x, 25x, 30x, 35x, 40x, 45x, 50x, 55x, 60x, 65x, 70x, 75x, 80x, 85x, 90x, 95x, or 100x of the baseline at about 1 month after the first dose. In some aspects, the GMC of VZV gE antibodies in the subject is at least 5x, 10x, 15x, 20x, 25x, 30x, 35x, or 40x of the baseline at about 1 month after the first dose.

[0010] In some aspects, the percentage of subjects with at least a 4-fold increase in GMC at about 1 month after the first dose is at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0011] In some aspects, the geometric mean fold rise (GMFR) of VZV gE antibodies at about 1 month after the first dose is about 15, 20, 25, 30, 35, or 40 or more. In some aspects, the GMFR of VZV gE antibodies at least about 1 month after the first dose is about 16, 18, 20, 28, 33, 38, or 43.

[0012] In some aspects, the second dose is administered after the first dose.

[0013] In some aspects, the GMC of VZV gE antibodies in the subject at about 1 month after the second dose is higher than the GMC of the antibodies in the subject at baseline and at 1 month after the first dose.

[0014] In some aspects, the GMC of VZV gE antibodies in the subject at 1 month after the second dose is at least 35,000, 40,000, 45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000, 90,000, 95,000, 100,000, 105,000, 110,000, or 115,000 mIU / mL or more.

[0015] In some aspects, a dose response is observed in the subject at about 1 month after the second dose.

[0016] In some aspects, the GMC of VZV gE antibodies in the subject is at least 1.1x (i.e., 1.1 times), 1.2x, 1.3x, 1.4x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 15x, 20x, 25x, 30x, 35x, 40x, 45x, 50x, 55x, 60x, 65x, 70x, 75x, 80x, 85x, 90x, 95x, or 100x of the baseline at about 1 month after the second dose. In some aspects, the GMC of VZV gE antibodies in the subject is at least 5x, 10x, 20x, 25x, 30x, 35x, 40x, 45x, 50x, 55x, or 60x of the baseline at about 1 month after the second dose.

[0017] In some aspects, the percentage of subjects with at least a 4-fold increase in GMC at about 1 month after the second dose is at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0018] In some aspects, the geometric mean fold rise (GMFR) of VZV gE antibodies at about 1 month after the second dose is at least 25, 30, 35, 40, 45, 50, 60, 65, 70, or 75 or more. In some aspects, the GMFR of VZV gE antibodies at about 1 month after the second dose is about 25, 36, 52, 54, 55, or 76.

[0019] In some aspects, the GMC of VZV gE antibodies in the subject at about 1 month after the first dose is about 1.1 times, 1.2 times, 1.3 times, or 1.4 times the GMC of VZV gE antibodies in a human subject at about 1 month after the first dose. In some aspects, the GMC of VZV gE antibodies in the subject at about 1 month after the first dose is about 1.1 times, 1.2 times, 1.3 times, or 1.4 times the GMC of VZV gE antibodies in a human subject at about 1 month after the first dose.

[0020] In some aspects, the GMC of VZV gE antibodies in the subject at about 1 month after the second dose is about 1.1 times the GMC of VZV gE antibodies in a human subject at about 1 month after the second dose. In some aspects, the GMC of VZV gE antibodies in the subject at about 1 month after the second dose is about 1.1 times the GMC of VZV gE antibodies in a human subject at about 1 month after the second dose.

[0021] In some aspects, the GMFR at about 1 month after the first dose is about 1.1 times, 1.2 times, or 1.3 times the GMFR in a human subject at about 1 month after the first dose. In some aspects, the GMFR at about 1 month after the first dose is about 1.1 times, 1.2 times, or 1.3 times the GMFR in a human subject at about 1 month after the first dose.

[0022] In some aspects, the GMFR at about 1 month after the second dose is about 1.1 times the GMFR in a human subject at about 1 month after the second dose. about 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.6 fold, 1.7 fold, 1.8 fold, or 1.9 fold of the GMFR in the human subject at 1 month post.

[0023] In some aspects, the GMFR at about 1 month post first dose is about 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.6 fold, 1.7 fold, 1.8 fold, or 1.9 fold of the GMFR at 1 month post second dose. The GMFR in the human subject at 1 month post is similar.

[0024] In one aspect, the immunogenic composition is administered in a single dose. In one aspect, the immunogenic composition is administered in a single dose or a two-dose regimen. In one aspect, the second dose is administered about 2 months after the first dose. In another aspect, the second dose is administered about 6 months after the first dose. In one aspect, the immunogenic composition is administered at a dose of about 1 pg, 15 pg, 30 pg, 45 pg, 60 pg, 75 pg, 90 pg, 100 pg, or more per administration. In one aspect, the immunogenic composition is administered at a dose range of about 1 pg to 90 pg or more per administration. In one aspect, the immunogenic composition is administered at a dose range of about 15 pg to 90 pg or more per administration.

[0025] In one aspect, the subject is an adult. In one aspect, the subject is an adult who is 18 years of age or older, about 20 years of age or older, about 30 years of age or older, about 40 years of age or older, about 45 years of age or older, about 50 years of age or older, about 55 years of age or older, about 60 years of age or older, about 65 years of age or older, about 70 years of age or older.

[0026] The present disclosure provides methods in which the immunogenic composition induces VZV gE binding antibodies and / or cell-mediated immune responses. In one aspect, the immunogenic composition is administered as a vaccine. In one aspect, the immunogenic composition is administered by intramuscular injection. In some aspects, the immunogenic composition is frozen / liquid. In some aspects, the immunogenic composition is lyophilized.

[0027] In one aspect, the VZV gE polypeptide is full-length, truncated, fragment, or variant thereof. In one aspect, the VZV gE polypeptide comprises at least one mutation. In one aspect, the VZV gE polypeptide has at least 90%, 95%, 96%, 97%, 98%, or 99% identity to an amino acid sequence selected from any one of SEQ ID NOs: 1-11. In one aspect, the VZV gE polypeptide comprises an amino acid sequence selected from any one of SEQ ID NOs: 1-11. In one aspect, the VZV gE polypeptide comprises the amino acid sequence of SEQ ID NO: 1. In one aspect, the VZV gE polypeptide comprises the amino acid sequence of SEQ ID NO: 5. In one aspect, the VZV gE polypeptide comprises the amino acid sequence of SEQ ID NO: 4.

[0028] In one aspect, the VZV gE polypeptide is transcribed from a nucleic acid sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to any one of the sequences selected from the group consisting of SEQ ID NOs: 12-145. In one aspect, the VZV gE polypeptide is transcribed from a nucleic acid sequence comprising any one of the sequences selected from the group consisting of SEQ ID NOs: 12-145. In one aspect, the VZV gE polypeptide is transcribed from a nucleic acid sequence comprising SEQ ID NO: 14. In one aspect, the VZV gE polypeptide is transcribed from a nucleic acid sequence comprising SEQ ID NO: 23. In one aspect, the VZV gE polypeptide is transcribed from a nucleic acid sequence comprising SEQ ID NO: 19.

[0029] In one aspect, the RNA molecule comprises a nucleic acid sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to any one of the sequences selected from the group consisting of SEQ ID NOs: 146-279. In one aspect, the RNA molecule comprises a nucleic acid sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to any one of the sequences selected from the group consisting of SEQ ID NOs: 146-279. In one aspect, the RNA molecule comprises a nucleic acid sequence selected from any one of the group consisting of SEQ ID NOs: 146-279. In one aspect, the RNA molecule comprises a nucleic acid sequence selected from SEQ ID NO: 148. In one aspect, the RNA molecule comprises a nucleic acid sequence selected from SEQ ID NO: 157. In one aspect, the RNA molecule comprises a nucleic acid sequence selected from SEQ ID NO: 153.

[0030] In one aspect, the VZV gE polypeptide is localized to the trans-Golgi network (TGN). In another aspect, the VZV gE polypeptide is secreted (localized to the supernatant). In another aspect, the VZV gE polypeptide is localized to the cell membrane (surface expression).

[0031] In one aspect, the RNA molecule comprises a 5' untranslated region (5' UTR) comprising a sequence selected from any one of SEQ ID NOs: 281, 312, or 313. In one aspect, the RNA molecule comprises a 3' untranslated region (3' UTR) comprising a sequence selected from any one of SEQ ID NOs: 284, 314, or 317. In one aspect, the RNA molecule comprises a polyadenylate tail comprising a sequence selected from any one of SEQ ID NOs: 287 or 315. In one aspect, the RNA molecule comprises a modified RNA, wherein uridines are replaced with N1-methyl pseudouridines (Ψ).

[0032] The methods of the present disclosure further provide administering an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (LNP). In one aspect, the lipid nanoparticle comprises at least one of a cationic lipid, a PEGylated lipid, a neutral lipid, and a sterol or sterol analog. In one aspect, the cationic lipid is (4-hydroxybutyl)azanium; diazyl)bis(hexane-6,1- diyl)bis(2-hexyldecanoate) (ALC-0315). In one aspect, the PEGylated lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159). In one aspect, the neutral lipid is l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In one aspect, the sterol or sterol analog is cholesterol.

[0033] The methods of the present disclosure further provide methods of administering an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule encodes a VZV gE polypeptide comprising an amino acid sequence selected from any one of SEQ ID NOs: 1 to 11.

[0034] The methods of the present disclosure further provide methods of administering an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises a nucleic acid sequence selected from any one of SEQ ID NOs: 146 to 279.

[0035] The methods of the present disclosure further provide methods of administering an immunogenic composition comprising an RNA molecule encoding a VZV gE protein produced from codon-optimized (CO) DNA. In some aspects, the codon-optimized DNA comprises a G / C content of about 58% (COl). In some aspects, the codon-optimized DNA comprises a G / C content of about 66% (CO2). In some aspects, the codon-optimized DNA comprises a G / C content of about 62% (CO3).

[0036] The methods of the present disclosure further provide methods of administering an immunogenic composition comprising about 5 to 15 mM Tris buffer, 200 to 400 mM sucrose, at a pH of about 7.0 to 8.0. In some aspects, the immunogenic composition comprises 10 mM Tris buffer and 300 mM sucrose, at a pH of about 7.4. In some aspects, the immunogenic composition is lyophilized. In some aspects, the immunogenic composition is reconstituted with 0.9% sodium chloride.

[0037] In some aspects, the immunogenic compositions of the present disclosure can be used with or administered in conjunction with one or more other vaccines. In some aspects, the VZV modRNA vaccine can be administered in conjunction with an influenza vaccine, a pneumococcal vaccine (e.g., a pneumococcal conjugate vaccine (PCV), such as the Prevnar vaccine), a tetanus vaccine, a diphtheria vaccine, a pertussis vaccine (e.g., Tdap), a respiratory syncytial virus (RSV) vaccine, and / or a COVID-19 vaccine. BRIEF DESCRIPTION OF DRAWINGS

[0039] Figure 1 Wild-type (WT) varicella zoster virus (VZV) gE protein (gE WT) and variant VZV gE proteins are schematically shown, where SP refers to a signal peptide sequence, extracellular domain refers to a peptide sequence corresponding to the portion of the protein that extends into the extracellular space, TM refers to a transmembrane peptide sequence corresponding to the portion of the protein that spans the cell membrane, and CT refers to a cytoplasmic tail peptide sequence corresponding to the portion of the protein that extends into the cytoplasm. VZV gE protein variants with cytoplasmic tail modifications are designated ms4, ms5, ms8, ms9, ms10, ms11, and ms12. Secreted VZV gE protein variants with TM modifications are designated ms3 and ms6. VZV gE RNA constructs encoding VZV gE proteins were generated from codon-optimized (CO) DNA, where CO1 indicates a CO construct with a G / C content of about 58%, CO2 indicates a CO construct with a G / C content of about 66%, and CO3 indicates a CO construct with a G / C content of about 62%.

[0040] Figure 2 GMCs of gE-binding IgG antibodies assessed at Day 1 / 1stdose (n ~ 50), 1 month post-1stdose (1M-PD1) (n ~ 50), 2nddose (D2) / 2 months post-1stdose (2M-PD1) (n ~ 15), and 1 month post-2nddose (1M-PD2) (n ~ 15) for participants who received 2 doses (0 month and 2 month schedule) of lyophilized VZV modRNA Candidate 1 at 15 pg, 30 pg, or 60 pg are shown. A dose response was observed at 1M-PD1 and 1M-PD2.

[0041] Figure 3 GMCs of gE-binding IgG antibodies assessed at Day 1 / 1stdose (n ~ 50), 1 month post-1stdose (1M-PD1) (n ~ 50), 2nddose (D2) / 2 months post-1stdose (2M-PD1) (n ~ 15), and 1 month post-2nddose (1M-PD2) (n ~ 15) for participants who received 2 doses (0 month and 2 month schedule) of lyophilized VZV modRNA Candidate 1 at 15 pg, 30 pg, or 60 pg are shown. A dose response was observed at 1M-PD1 and 1M-PD2. Participants receiving 2 doses (0-month and 2-month schedule) were evaluated for gE-binding IgG antibody concentrations (GMC) at Day 1 / 1st dose (n ~ 50), 1 month after 1st dose (1M-PD1) (n ~ 50), 2nd dose (D2) / 2 months after 1st dose (2M-PD1) (n ~ 15), and 1 month after 2nd dose (1M-PD2) (n ~ 15). A robust immunogenic response was observed for participants receiving the VZV modRNA vaccine.

[0042] Figure 4 Participants receiving 1 dose (single dose) of 90 pg lyophilized VZV modRNA candidate 1 (n ~ 15) are shown for GMFR of gE-binding IgG antibodies at 1 month after 1st dose (1M-PD1), and participants receiving 15 pg, 30 pg, or 60 pg lyophilized VZV modRNA candidate 1 (C1) or Participants receiving 2 doses (0-month and 2-month schedule) (n ~ 50) are shown for GMFR of gE-binding IgG antibodies at 1 month after 2nd dose (1M-PD2). GMFR observed at 1M-PD1 for participants receiving 90 pg VZV modRNA vaccine was similar to GMFR observed at 1M-PD2 for participants receiving

[0043] Detailed Description

[0044] The present disclosure provides a modRNA vaccine against varicella zoster virus (VZV) that elicits a robust glycoprotein E (gE)-binding antibody response in humans. The interim results from Phase 1 provided herein demonstrate that the VZV modRNA vaccine elicits high concentrations of gE-binding antibodies in humans.

[0045] The present disclosure provides immunogenic compositions for preventing herpes zoster (HZ) (i.e., shingles) in a human subject. The present disclosure also provides methods of preventing HZ in a human subject comprising administering an immunogenic composition described herein. The present disclosure also provides the use of an immunogenic composition described herein for preventing HZ in a human subject.

[0046] The present disclosure also provides immunogenic compositions for preventing post-herpetic neuralgia (PHN) in a human subject. The present disclosure provides methods of preventing PHN in a human subject comprising administering an immunogenic composition described herein. The present disclosure also provides the use of an immunogenic composition described herein for preventing PHN in a human subject.

[0047] ​In one aspect, the immunogenic composition comprises a varicella zoster virus (VZV) RNA molecule comprising RNA that is translatable into a protein in a recipient cell (as an active ingredient). In one aspect, the immunogenic composition comprises a VZV RNA molecule formulated in, encapsulated in, complexed with, bound to, or adsorbed to a lipid nanoparticle (LNP) (e.g., VZV RNA-LNP). In a preferred aspect, the VZV RNA-LNP comprises a modified RNA (modRNA) in which the uridines of the RNA molecule are replaced with N1-methylpseudouridines (Ψ). Thus, in a preferred aspect, the immunogenic composition is a VZV modRNA-LNP (used interchangeably with “VZV modRNA vaccine” or “VZV modRNA”).

[0048] The present disclosure also provides methods of eliciting an immune response against VZV in a human subject comprising administering an immunogenic composition described herein. The present disclosure further provides use of an immunogenic composition described herein for eliciting an immune response against VZV in a human subject.

[0049] The present disclosure further provides methods of inducing an immune response against VZV in a human subject comprising administering an immunogenic composition described herein. The present disclosure further provides use of an immunogenic composition described herein for inducing an immune response against VZV in a human subject.

[0050] The present disclosure also provides methods of preventing, treating, ameliorating, and / or reducing the risk of an infection, disease, or condition associated with VZV in a human subject comprising administering an immunogenic composition described herein. The present disclosure also provides use of an immunogenic composition described herein for preventing, treating, ameliorating, and / or reducing the risk of an infection, disease, or condition associated with VZV in a human subject.

[0051] The present disclosure provides methods of eliciting and / or inducing glycoprotein E (gE) antibodies in a human subject comprising administering an immunogenic composition described herein. The present disclosure further provides use of an immunogenic composition described herein for eliciting and / or inducing glycoprotein E (gE) antibodies in a human subject.

[0052] The present disclosure provides methods of eliciting and / or inducing a cell-mediated immune response in a human subject comprising administering an immunogenic composition described herein. The present disclosure also provides use of an immunogenic composition described herein for eliciting and / or inducing a cell-mediated immune response in a human subject.

[0053] The present disclosure provides methods of administering the immunogenic compositions described herein, wherein the compositions exhibit improved or comparable / similar safety, tolerability, reactivity, efficacy, antibody responses, cell-mediated immune responses, immunogenicity, and / or immunological persistence compared to existing HZ treatments / vaccines. The present disclosure also provides uses of the immunogenic compositions described herein, wherein the compositions exhibit improved or comparable / similar safety, tolerability, reactivity, efficacy, antibody responses, cell-mediated immune responses, immunogenicity, and / or immunological persistence compared to existing HZ treatments / vaccines.

[0054] For example, a Phase 1 study described herein compares the immune responses induced / elicited by the VZV modRNA vaccines of the present disclosure to Shingrix (GSK) is a two-dose adjuvanted vaccine consisting of recombinant VZV gE and AS01B adjuvant. Prescribing information for Shingrix is available at: https: / / www.fda.gov / media / 108597 / download.

[0055] The present disclosure provides methods or uses comprising administering the immunogenic compositions in a single administration (i.e., a single-dose regimen). The present disclosure further provides methods or uses comprising administering the immunogenic compositions twice (i.e., a two-dose regimen), for example, at day 0 and about day 7, day 0 and about day 14, day 0 and about day 21, day 0 and about day 28, day 0 and about day 60, day 0 and about day 90, day 0 and about day 120, day 0 and about day 150, day 0 and about day 180, day 0 and about 1 month later, day 0 and about 2 months later, day 0 and about 3 months later, day 0 and about 6 months later, day 0 and about 9 months later, day 0 and about 12 months later, day 0 and about 18 months later, day 0 and about 2 years later, day 0 and about 5 years later, or day 0 and about 10 years later.

[0056] The present disclosure also provides methods or uses comprising administering the immunogenic compositions twice (i.e., a two-dose regimen), for example, at day 1 and about day 7, day 1 and about day 14, day 1 and about day 21, day 1 and about day 28, day 1 and about day 60, day 1 and about day 90, day 1 and about day 120, day 1 and about day 150, day 1 and about day 180, day 1 and about 1 month later, day 1 and about 2 months later, day 1 and about 3 months later, day 1 and about 6 months later, day 1 and about 9 months later, day 1 and about 12 months later, day 1 and about 18 months later, day 1 and about 2 years later, day 1 and about 5 years later, or day 1 and about 10 years later.

[0057] ​In a preferred aspect, the immunogenic composition is administered in a single dose regimen. In another preferred aspect, the immunogenic composition is administered in a two-dose regimen at day 0 and about 2 months later. In another preferred aspect, the immunogenic composition is administered in a two-dose regimen at day 1 and about 2 months later. In another preferred aspect, the immunogenic composition is administered in a two-dose regimen at day 0 and about 6 months later. In another preferred aspect, the immunogenic composition is administered in a two-dose regimen at day 1 and about 6 months later. The present disclosure also provides for administration of at least one booster dose.

[0058] The present disclosure provides methods or uses comprising administering to a human subject an immunogenic composition at a dose of about 1 pg, 15 pg, 30 pg, 45 pg, 60 pg, 75 pg, 90 pg, 100 pg or more per administration. In one aspect, the immunogenic composition is administered to a human subject at a dose of about 15 pg, 30 pg, 60 pg, or 90 pg per administration. In some aspects, the immunogenic composition comprises a VZV modRNA described herein in a dose range of about 1 pg to 100 pg or more per administration. In some aspects, the immunogenic composition comprises a VZV modRNA described herein in a dose range of about 15 pg to 90 pg per administration. In some aspects, the immunogenic composition comprises a VZV modRNA described herein in a dose of about 15 pg, 30 pg, 60 pg, or 90 pg per administration.

[0059] In one aspect, the immunogenic composition comprises a VZV modRNA described herein in a dose of about 15 pg per administration. In one aspect, the immunogenic composition comprises a VZV modRNA described herein in a dose of about 30 pg per administration. In one aspect, the immunogenic composition comprises a VZV modRNA described herein in a dose of about 60 pg per administration. In one aspect, the immunogenic composition comprises a VZV modRNA described herein in a dose of about 90 pg per administration. In one aspect, the immunogenic composition comprises a VZV modRNA described herein in a dose of more than 90 pg per administration.

[0060] In one aspect, an effective amount of an immunogenic composition described herein is administered to a human subject to induce an immune response against VZV.

[0061] In one aspect, the effective amount is a single dose administration of an immunogenic composition comprising about 15 pg of a VZV modRNA described herein. In one aspect, the effective amount is a single dose administration of an immunogenic composition comprising about 30 pg of a VZV modRNA described herein. In one aspect, the effective amount is a single dose administration of an immunogenic composition comprising about 60 pg of a VZV modRNA described herein. In one aspect, the effective amount is a single dose administration of an immunogenic composition comprising about 90 pg of a VZV modRNA described herein.

[0062] In another aspect, the effective amount is a two dose administration of an immunogenic composition comprising about 15 pg of a VZV modRNA described herein. In one aspect, the effective amount is a two dose administration of an immunogenic composition comprising about 30 pg of a VZV modRNA described herein. In one aspect, the effective amount is a two dose administration of an immunogenic composition comprising about 60 pg of a VZV modRNA described herein. In one aspect, the effective amount is a two dose administration of an immunogenic composition comprising about 90 pg of a VZV modRNA described herein.

[0063] In some aspects, the immunogenic composition is administered in an injection volume of about 0.25 to 1 mL (e.g., about 0.25, 0.5, 1 mL). In some aspects, the immunogenic composition is present in a frozen / liquid (non-lyophilized) or lyophilized formulation. In some aspects, dilution with sterile 0.9% sodium chloride (normal saline) can be required.

[0064] In some aspects, the human subject is, is at least, or is at most, less than about 1 year old, about 1 year old or older, about 5 years old or older, about 10 years old or older, about 20 years old or older, about 30 years old or older, about 40 years old or older, about 50 years old or older, about 60 years old or older, about 70 years old or older. In some aspects, the human subject is about 50 years old or older. In some aspects, the human subject is an adult human who is 18 years old or older. In some aspects, the human subject is an adult human who is 45 years old or older, 50 years old or older, 55 years old or older, 60 years old or older, or 65 years old or older. In some aspects, the human subject is immunocompetent. In some aspects, the human subject is immunocompromised.

[0065] The immunogenic compositions provided herein are administered in an effective amount to induce an immune response against VZV. The methods or uses of the disclosure provide for administering an immunogenic composition, e.g., a VZV RNA-LNP (e.g., a VZV modRNA vaccine), comprising a RNA molecule, e.g., an immunogenic RNA polynucleotide encoding an amino acid sequence (e.g., an immunogenic antigen) that includes a varicella zoster virus (VZV) protein, an immunogenic variant thereof, or an immunogenic fragment of a VZV protein or an immunogenic variant thereof, e.g., an antigenic peptide or protein. Thus, the immunogenic antigen comprises an epitope of a VZV protein for inducing an immune response against VZV in a human subject. The RNA polynucleotide encoding the immunogenic antigen is administered to provide (upon expression of the polynucleotide by appropriate target cells) the antigen for inducing (e.g., stimulating, priming, and / or amplifying) an immune response, e.g., an antibody and / or an immune effector cell. In one aspect, the immune response to be induced in accordance with the disclosure is a B cell-mediated immune response, e.g., an antibody-mediated immune response. Additionally or alternatively, the immune response to be induced in accordance with the disclosure can be a T cell-mediated immune response, e.g., a cytokine immune response. In one aspect, the immune response is an anti-VZV immune response. In one aspect, the immune response is an anti-VZV gE immune response.

[0066] In one aspect, the immune response induces a VZV glycoprotein E (gE) antibody binding immune response. In some aspects, the immune response is measured by determining the level of gE binding antibodies in the subject (participant).

[0067] In some aspects, the immune response is measured by the geometric mean concentration (GMC) of glycoprotein E antibodies in a proportion of assessable immunogenic participants. For example, the GMC of glycoprotein E binding antibodies in each vaccine group before vaccination and at each collection time point.

[0068] In some aspects, the immune response is measured by the geometric mean fold rise (GMFR) of glycoprotein E binding antibodies in assessable immunogenic participants from before vaccination to each subsequent time point after each vaccination.

[0069] In some aspects, the immune response is measured by the proportion of assessable immunogenic participants with a vaccine response of glycoprotein E binding antibodies from baseline (before vaccination) to each subsequent time point after each vaccination. For example, the vaccine response can be defined as a >4-fold increase in gE IgG concentration from before vaccination to after vaccination to each subsequent scheduled time point after each vaccination.

[0070] In some aspects, the immune response is measured by the proportion of assessable immunogenic participants with a vaccine response of glycoprotein E binding antibodies from baseline (before vaccination) to each subsequent time point after each vaccination. For example, the vaccine response can be defined as a >4-fold increase in gE IgG concentration from before vaccination to after vaccination to each subsequent scheduled time point after each vaccination. The induced or elicited immune responses are compared to measure. For example, the immune response (e.g., GMC, GMFR, and / or vaccine response) induced by the immunogenic composition provided herein is compared to the immune response induced by the administration of The induced immune responses are compared.

[0071] The present disclosure provides the methods or uses described herein, which include administering an immunogenic composition comprising an RNA molecule and an RNA-LNP to induce an immune response in a human subject. In addition to the wild-type or codon-optimized sequence encoding the antigenic sequence, the RNA molecule can comprise one or more structural elements (5' cap, 5' untranslated region, 3' untranslated region, poly-adenosine tail) optimized for the maximum efficacy of the RNA in terms of stability and translation efficiency. In a preferred aspect, the RNA molecule comprises all of these elements. In a preferred aspect, each uridine of the RNA molecule is replaced by an N1 -methyl pseudouridine (Ψ) (e.g., modRNA).

[0072] The RNA molecule and the RNA-LNP can comprise at least one open reading frame (ORF) encoding a VZV glycoprotein. In some aspects, the VZV glycoprotein is VZV gE. In some aspects, the VZV polypeptide is a full-length, a truncation, a fragment, or a variant thereof. In some aspects, the VZV polypeptide comprises at least one mutation.

[0073] The RNA molecule and the RNA-LNP can comprise at least one ORF encoding a VZV polypeptide of Table 1. In some aspects, the VZV polypeptide has, has at least, or has at most 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to any of the amino acid sequences of Table 1 (e.g., any of SEQ ID NOs: 1-11). In some aspects, the VZV polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-11. In some aspects, the VZV polypeptide consists of any of the amino acid sequences of Table 1 (e.g., any of SEQ ID NOs: 1-11). In an aspect, the VZV polypeptide comprises the amino acid sequence of SEQ ID NO: 1. In an aspect, the VZV polypeptide comprises the amino acid sequence of SEQ ID NO: 1. In an aspect, the VZV polypeptide comprises the amino acid sequence of SEQ ID NO: 5. In an aspect, the VZV polypeptide comprises the amino acid sequence of SEQ ID NO: 5.

[0074] The RNA molecules and RNA-LNPs comprise at least one ORF transcribed from at least one DNA nucleic acid in Table 2. In some aspects, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence having, having at least, or having at most 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to any nucleic acid sequence in Table 2 (e.g., any one of SEQ ID NOs: 12-145). In some aspects, the RNA molecule is transcribed from a nucleic acid sequence selected from SEQ ID NOs: 12-145. In some aspects, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence consisting of any nucleic acid sequence in Table 2 (e.g., any one of SEQ ID NOs: 12-145). In one aspect, the RNA molecule is transcribed from the nucleic acid sequence of SEQ ID NO: 13. In one aspect, the RNA molecule is transcribed from the nucleic acid sequence of SEQ ID NO: 22. In one aspect, the RNA molecule is transcribed from the nucleic acid sequence of SEQ ID NO: 19.

[0075] The RNA molecules and RNA-LNPs comprise at least one ORF comprising an RNA nucleic acid sequence of Table 3. In some aspects, the RNA molecule comprises a nucleic acid sequence having, having at least, or having at most 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity to any nucleic acid sequence of Table 3 (e.g., any one of SEQ ID NOs: 146-279). In some aspects, the RNA molecule comprises a nucleic acid sequence selected from SEQ ID NOs: 146-279. In some aspects, the RNA molecule comprises a nucleic acid sequence consisting of any nucleic acid sequence in Table 3 (e.g., any one of SEQ ID NOs: 146-279). In some aspects, each uridine of any one of SEQ ID NOs: 146-279 is replaced with an N1-methyl pseudouridine (Ψ) (e.g., a modified RNA; modRNA).

[0076] In one aspect, the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148. In one aspect, the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157. In one aspect, the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 153.

[0077] In a preferred aspect, the RNA molecules (constructs) produced herein encode VZV gE wild type (WT) and gE variant proteins with cytoplasmic tail (CT) and / or transmembrane (TM) domain modifications. Figure 1Table 4. VZV gE proteins and descriptions

[0078] Table 4. VZV gE proteins and descriptions

[0079]

[0080]

[0081] The RNA molecules and RNA-LNPs can comprise a 5’ untranslated region (5’-UTR) and / or a 3’ untranslated region (3’-UTR). In some aspects, the RNA molecule comprises a 5’ untranslated region (5’-UTR). In some aspects, the 5’ UTR comprises a sequence selected from any one of SEQ ID NOs: 281 (SEQ ID NO: 280 - DNA; SEQ ID NO: 282 - RNA with Ψ) and 312-313. In some aspects, the 5’ UTR comprises a sequence with at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or greater identity to any one of SEQ ID NOs: 281 and 312-313. In some aspects, the 5’ UTR comprises a sequence selected from any one of SEQ ID NOs: 281 and 312-313. In some aspects, the 5’ UTR comprises a sequence consisting of any one of SEQ ID NOs: 281 and 312-313.

[0082] In some aspects, the RNA molecule and RNA-LNP comprise a 3’ untranslated region (3’-UTR). In some aspects, the 3’ UTR comprises a sequence selected from any one of SEQ ID NOs: 284 (SEQ ID NO: 283 - DNA; SEQ ID NO: 285 - RNA with Ψ), 314, and 317 (SEQ ID NO: 318 - RNA with Ψ). In some aspects, the 3’ UTR comprises a sequence with at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or greater identity to any one of SEQ ID NOs: 284, 314, and 317. In some aspects, the 3’ UTR comprises a sequence selected from any one of SEQ ID NOs: 284, 314, and 317. In some aspects, the 3’ UTR comprises a sequence consisting of any one of SEQ ID NOs: 284, 314, and 317.

[0083] The RNA molecule and the RNA-LNP can comprise a 5’ cap moiety. In some aspects, the 5’ cap moiety is (3’OMe)-m2 7,3’- O Gppp(m1 2’-O )ApG. The RNA molecule and the RNA-LNP can comprise a 3’ poly(A) tail. In some aspects, the poly(A) tail comprises a sequence selected from any one of SEQ ID NOs: 287 (SEQ ID NO: 286 - DNA; SEQ ID NO: 288 - RNA with Ψ) and 315 (SEQ ID NO: 316 - RNA with Ψ). In a preferred aspect, the poly(A) tail comprises a sequence selected from any one of SEQ ID NOs: 287 and 315 + / - 1 adenosine (A) or + / - 2 adenosine (A).

[0084] In some aspects, the RNA molecule comprises a 5’ UTR and a 3’ UTR. In some aspects, the RNA molecule comprises a 5’ cap, a 5’ UTR, and a 3’ UTR. In some aspects, the RNA molecule comprises a 5’ cap, a 5’ UTR, a 3’ UTR, and a poly(A) tail. In some aspects, the RNA molecule comprises a 5’ UTR, a 3’ UTR, and a poly(A) tail. In a preferred aspect, each uridine of any one of the 5’ UTR, the 3’ UTR, and the poly(A) tail is replaced with an N1-methyl pseudouridine (Ψ) (e.g., a modified RNA; modRNA).

[0085] The RNA molecule can comprise at least one open reading frame generated from a codon-optimized DNA. In some aspects, the open reading frame has a G / C content of at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, about 50% to 75%, or about 55% to 70%. In some aspects, the G / C content is about 58%, about 66%, or about 62%. The present disclosure further provides RNA molecules encoding VZV polypeptides localized to the cell membrane, localized to the Golgi, and / or anchored to the membrane and secreted. The present disclosure further provides RNA molecules comprising stabilized RNA. The present disclosure further provides RNA molecules comprising RNA with at least one modified nucleotide (e.g., modified RNA; modRNA). In some aspects, the modified nucleotide is pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4’-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-l-methyl-l-deaza-pseudouridine, 2-thio-l-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, or 2’-O-methyluridine. In some aspects, the modified nucleotide is N1-methylpseudouridine (Ψ).

[0086] The present disclosure further provides RNA molecules that are messenger RNA (mRNA) or self-replicating RNA. In some aspects, the RNA is mRNA.

[0087] The methods or uses of the present disclosure provide administering an immunogenic composition, e.g., a VZV RNA-LNP (e.g., a VZV modRNA vaccine), comprising an RNA molecule as described in Table 5. DNA sequences encoding VZV proteins are prepared and used in an in vitro transcription reaction to generate RNA. In vitro transcription of RNA is known in the art and is described herein. DNA templates are cloned into plasmid vectors with backbone sequence elements (T7 promoter, 5’ and 3’ untranslated regions, poly-A tail for improved RNA stability and translation efficiency). DNA is purified, quantified by spectrophotometry, and in vitro transcribed by T7 RNA polymerase in the presence of a trinucleotide cap 1 analog ((m2 7 ,3′-O )Gppp(m 2’-O )ApG) (TriLink) and using N1-methylpseudouridine (Ψ) in place of uridine (modified RNA; modRNA).

[0088] VZV RNA was generated from codon-optimized (CO) DNA for stability and higher protein expression. CO1 as used herein indicates about 58% G / C content, CO2 indicates about 66% G / C content, and CO3 indicates about 62% G / C content. Table 5 shows the RNA constructs of the disclosure and their corresponding sequences, including the 5' UTR, the open reading frame encoding the varicella zoster virus (VZV) polypeptide, the 3' UTR, and the poly(A) tail.

[0089] Table 5. VZV gE RNA constructs / molecules

[0090]

[0091]

[0092] *Poly(A) tail length can include +2 / -2 As or +1 / -1 A.

[0093] In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 146, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (gE WT). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 147, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (gE WT COl). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 148, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (gE WT CO2). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 149, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (ms3 COl). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 150, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (ms3 CO2). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 151, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (ms4 COl). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 152, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (ms4 CO2). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 153, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (ms5 COl).In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 154, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a polyadenylate tail of SEQ ID NO: 287 or 315 (ms5CO2). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 155, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a polyadenylate tail of SEQ ID NO: 287 or 315 (ms5 CO2 v2). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 156, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a polyadenylate tail of SEQ ID NO: 287 or 315 (ms6 CO1). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 157, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a polyadenylate tail of SEQ ID NO: 287 or 315 (ms6 CO2). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 158, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a polyadenylate tail of SEQ ID NO: 287 or 315 (ms8 CO1). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 159, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a polyadenylate tail of SEQ ID NO: 287 or 315 (ms9 CO1). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 160, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a polyadenylate tail of SEQ ID NO: 287 or 315 (ms9 CO2). In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 161, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a polyadenylate tail of SEQ ID NO: 287 or 315 (ms10 CO1).In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 162, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (mslO CO2). In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 163, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (mslO CO3). In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 164, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (msl l COl). In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 165, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (msl l CO2). In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 166, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (msl2 COl). In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 167, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-adenylated tail of SEQ ID NO: 287 or 315 (msl2 CO2).

[0094] In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 168, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 169, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 170, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 171, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 172, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 173, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 174, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of any one of SEQ ID NOs: 175-238, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315. In some aspects, the RNA molecule comprises a 5' UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 239, a 3' UTR of SEQ ID NO: 284 or 317, and / or a poly-A tail of SEQ ID NO: 287 or 315.In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of any one of SEQ ID NOs: 240-254, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly(A) tail of SEQ ID NO: 287 or 315. In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of any one of SEQ ID NOs: 255-267, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly(A) tail of SEQ ID NO: 287 or 315. In some aspects, the RNA molecule comprises a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of any one of SEQ ID NOs: 268-279, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly(A) tail of SEQ ID NO: 287 or 315. In some aspects, the VZV ORF further comprises a stop codon as described herein. In some aspects, the poly(A) tail length can comprise +1 / -1 A or +2 / -2 A. In some aspects, each uridine of the RNA molecule is replaced with an N1-methylpseudouridine (Ψ) (e.g., modified RNA; modRNA).

[0095] In one preferred aspect, the methods or uses of the disclosure provide for administration of an immunogenic composition, e.g., a VZV modRNA vaccine, comprising an RNA molecule comprising a 5’ UTR of SEQ ID NO: 281, a VZV ORF of SEQ ID NO: 148, a 3’ UTR of SEQ ID NO: 284, and a poly(A) tail of SEQ ID NO: 287 or 315, wherein each uridine of the RNA molecule is replaced by N1-methylpseudouridine (Ψ) (gE WT CO2; Candidate 1). In another preferred aspect, the methods or uses of the disclosure provide for administration of an immunogenic composition, e.g., a VZV modRNA vaccine, comprising an RNA molecule comprising a 5’ UTR of SEQ ID NO: 281, a VZV ORF of SEQ ID NO: 157, a 3’ UTR of SEQ ID NO: 284, and a poly(A) tail of SEQ ID NO: 287 or 315, wherein each uridine of the RNA molecule is replaced by N1-methylpseudouridine (Ψ) (ms6CO2; Candidate 2). In another preferred aspect, the methods or uses of the disclosure provide for administration of an immunogenic composition, e.g., a VZV modRNA vaccine, comprising an RNA molecule comprising a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 153, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly(A) tail of SEQ ID NO: 287 or 315, wherein each uridine of the RNA molecule is replaced by N1-methylpseudouridine (Ψ) (ms5CO1; Candidate 3).

[0096] The methods or uses of the disclosure provide for administration of an immunogenic composition, e.g., a VZV RNA-LNP (e.g., a VZV modRNA vaccine), comprising an RNA molecule formulated in, encapsulated in, complexed with, bound to, or adsorbed to a LNP. In some aspects, the LNP comprises at least one cationic lipid, a pegylated lipid, and at least one structural lipid (e.g., a neutral lipid and a sterol or sterol analog).

[0097] In some aspects, the lipid nanoparticle comprises a cationic lipid. In some aspects, the cationic lipid is (4-hydroxybutyl)azanium; diazanium; bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315).

[0098] In some aspects, the lipid nanoparticle comprises a polymer conjugated lipid. In some aspects, the lipid nanoparticle comprises a pegylated lipid, also referred to as a PEG-lipid. In some aspects, the pegylated lipid is a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide (e.g., PEG-CerC14 or PEG-CerC20), a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, a glycolipid including PEG-c-DOMG, PEG-c-DMA, PEG-s-DMG, N-[(methoxypolyethylene glycol)2000)carbamoyl]-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA), and PEG-2000-DMG, a PEGylated diacylglycerol (PEG-DAG) such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG), a PEGylated phosphatidylethanolamine (PEG-PE), a PEG succinic acid diacylglycerol (PEG-S-DAG) such as 4-O-(2',3'-di(tetradecyloxy)propyl-1-O-((o-methoxy(polyethoxy)ethyl) butanedioate (PEG-S-DMG), a PEGylated ceramide (PEG-cer), or a PEG dialkyloxypropyl carbamate such as o-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecyloxy)propyl) carbamate or 2,3-di(tetradecyloxy)propyl-N-(o-methoxy(polyethoxy)ethyl) carbamate. In some aspects, the pegylated lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159).

[0099] In some aspects, the lipid nanoparticle comprises at least one structural lipid, e.g., a neutral lipid. In some aspects, the neutral lipid is selected from 1,2-distearoyl-sn-glycero-3- phosphocholine (DSPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl- phosphatidylethanolamine (POPE), and dioleoyl-phosphatidylethanolamine 4-(N- maleimidomethyl)-cyclohexane-1 carboxylate (DOPE-mal), dipalmitoylphosphatidyl- ethanolamine (DPPE), dimyristylphosphoethanolamine (DMPE), distearoyl- phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1- trans PE, 1-stearoyl-2-oleoylphosphatidyethanolamine (SOPE), and / or 1,2-dioleoyl-sn- glycero-3-phosphoethanolamine (trans DOPE). In some aspects, the neutral lipid is 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0100] In some aspects, the lipid nanoparticle comprises a second structural lipid, e.g., a sterol or a sterol analog. In some aspects, the sterol or sterol analog is cholesterol.

[0101] In some aspects, the lipid nanoparticle has an average diameter of about 1 to about 500 nm.

[0102] In a preferred aspect, purified RNA (as described in Table 5) is formulated / encapsulated into a lipid nanoparticle (RNA-LNP) using an ethanol lipid mixture of an ionizable cationic lipid, a PEGylated lipid, and two structural lipids, and transferred into an aqueous buffer system by diafiltration to produce a lipid nanoparticle composition, as described herein. The RNA-LNP comprises a VZV RNA molecule, a cationic lipid ((4-hydroxybutyl)azanium; bis(hexadecan-6,1- diyl)bis(2-hexyldodecanoate)), a PEGylated lipid (2-[(polyethylene glycol)-2000]-N,N- dimyristylacetamide), and two structural lipids (1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and cholesterol), see Table 6.

[0103] Table 6. Lipid Formulation

[0104]

[0105]

[0106] In one preferred aspect, the methods or uses of the disclosure provide for administration of an immunogenic composition, e.g., a VZV modRNA vaccine, comprising an RNA molecule comprising a 5’ UTR of SEQ ID NO: 281, a VZV ORF of SEQ ID NO: 148, a 3’ UTR of SEQ ID NO: 284, and a poly(A) tail of SEQ ID NO: 287 or 315, wherein each uridine of the RNA molecule is replaced by N1-methylpseudouridine (Ψ), and an LNP comprising a cationic lipid ((4-hydroxybutyl)azanium; bis(hexadecan-6,1- diyl)bis(2-hexyloctanoate)), a PEGylated lipid (2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide), and two structural lipids (1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC]) and cholesterol) (gE WTCO2; Candidate 1). In another preferred aspect, the methods or uses of the disclosure provide for administration of an immunogenic composition, e.g., a VZV modRNA vaccine, comprising an RNA molecule comprising a 5’ UTR of SEQ ID NO: 281, a VZV ORF of SEQ ID NO: 157, a 3’ UTR of SEQ ID NO: 284, and a poly(A) tail of SEQ ID NO: 287 or 315, wherein each uridine of the RNA molecule is replaced by N1-methylpseudouridine (Ψ), and an LNP comprising a cationic lipid ((4-hydroxybutyl)azanium; bis(hexadecan-6,1- diyl)bis(2-hexyloctanoate)), a PEGylated lipid (2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide), and two structural lipids (1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC]) and cholesterol) (ms6CO2; Candidate 2). In another preferred aspect, the methods or uses of the disclosure provide for administration of an immunogenic composition, e.g., a VZV modRNA vaccine, comprising an RNA molecule comprising a 5’ UTR of SEQ ID NO: 281 or 312, a VZV ORF of SEQ ID NO: 153, a 3’ UTR of SEQ ID NO: 284 or 317, and / or a poly(A) tail of SEQ ID NO: 287 or 315, wherein each uridine of the RNA molecule is replaced by N1-methylpseudouridine (Ψ), and an LNP comprising a cationic lipid ((4-hydroxybutyl)azanium; bis(hexadecan-6,1- diyl)bis(2-hexyloctanoate)), a PEGylated lipid (2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide), and two structural lipids (1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC]) and cholesterol) (ms5 CO1; Candidate 3).

[0107] The methods or uses of the present disclosure provide for administration of an immunogenic composition, e.g., a VZV RNA-LNP (e.g., a VZV modRNA vaccine), comprising a RNA molecule / polynucleotide encoding a VZV polypeptide disclosed herein encapsulated in a LNP at about 0.01 to 0.18 mg / mL, in about 5 to 15 mM Tris buffer, 200 to 400 mM sucrose, at a pH of about 7.0 to 8.0.

[0108] The methods or uses of the present disclosure provide for administration of an immunogenic composition, e.g., a VZV RNA-LNP (e.g., a VZV modRNA vaccine), comprising a RNA molecule / polynucleotide encoding a VZV polypeptide disclosed herein encapsulated in a LNP at about 0.01 to 0.18 mg / mL, in about 5 to 15 mM Tris buffer, 200 to 400 mM sucrose, at a pH of about 7.0 to 8.0.

[0109] In particular aspects, the liquid RNA-LNP immunogenic composition comprises an RNA molecule / polynucleotide encoding a VZV polypeptide disclosed herein at a concentration of at least, at most, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, preferably about 0.01 to about 0.09 mg / mL, e.g., about 0.06 mg / mL, encapsulated in LNPs having a lipid composition comprising ((4-hydroxybutyl)azabicycloalkyl)bis(hexane-6,1-diyl)bis(2- hexyldecanoate) (ALC-0315) at a concentration of about 0.8 to 0.95 mg / mL, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159) at a concentration of about 0.05 to 0.15 mg / mL, l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) at a concentration of about 0.1 to 0.25 mg / mL, and cholesterol at a concentration of about 0.3 to 0.45 mg / mL. In some aspects, the liquid composition further comprises a Tris buffer composition comprising tromethamine at a concentration of about 0.1 to 0.3 mg / mL and Tris hydrochloride (HC1) at a concentration of about 1.25 to 1.4 mg / mL, and sucrose at a concentration of about 95 to 110 mg / mL. In some aspects, the immunogenic composition of the present disclosure comprises about 5 to 15 mM Tris buffer, 200 to 400 mM sucrose, at a pH of about 7.0 to 8.0. In some aspects, the immunogenic composition comprises 10 mM Tris buffer and 300 mM sucrose, at a pH of about 7.4.

[0110] In some aspects, the liquid RNA-LNP immunogenic composition comprises an RNA molecule / polynucleotide encoding a VZV polypeptide disclosed herein at a concentration of at least, at most, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, preferably about 0.01 to about 0.09 mg / mL, e.g., about 0.06 mg / mL, encapsulated in LNPs, and further comprises about 5 to 15 mM Tris buffer, 200 to 400 mM sucrose, at a pH of about 7.0 to 8.0. In some aspects, the liquid composition further comprises 10 mM Tris buffer and 300 mM sucrose, at a pH of about 7.4.

[0111] The frozen / liquid composition used in the studies described herein comprises 0.06 mg / mL RNA in 10 mM Tris buffer, 300 mM sucrose, at a pH of 7.4.

[0112] The liquid immunogenic compositions of the present disclosure can exist in a frozen suspension and are thawed and / or diluted prior to injection.

[0113] The methods or uses of the present disclosure provide for administering an immunogenic composition, e.g., a VZV RNA-LNP (e.g., a VZV modRNA vaccine), presented as a lyophilized (and then reconstituted) composition comprising a RNA molecule / polynucleotide encoding a VZV polypeptide disclosed herein at a concentration of at least, at most, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, preferably about 0.01 to about 0.18 mg / mL, e.g., about 0.06 mg / mL or 0.18 mg / mL, encapsulated in an LNP with a lipid composition comprising a cationic lipid at a concentration of about 0.8 to 0.95 mg / mL, a PEGylated lipid at a concentration of about 0.05 to 0.15 mg / mL, a first structural lipid at a concentration of about 0.1 to 0.25 mg / mL, and a second structural lipid at a concentration of about 0.3 to 0.45 mg / mL. In some aspects, the lyophilized composition further comprises a first buffer at a concentration of about 0.01 to 0.15 mg / mL, a second buffer at a concentration of about 0.5 to 0.65 mg / mL, a stabilizer at a concentration of about 35 to 50 mg / mL, and a salt diluent at a concentration of about 5 to 15 mg / mL for reconstitution. In particular aspects, the lyophilized composition is reconstituted in about 0.6 to 0.75 mL of salt diluent. In some aspects, the immunogenic composition of the present disclosure comprises about 5 to 15 mM Tris buffer, 200 to 400 mM sucrose, at a pH of about 7.0 to 8.0. In some aspects, the immunogenic composition comprises 10 mM Tris buffer and 300 mM sucrose, at a pH of about 7.4. The concentration in the lyophilized RNA-LNP composition is determined after reconstitution.

[0114] In particular aspects, the lyophilized (and then reconstituted) RNA-LNP composition comprises an RNA polynucleotide encoding a VZV polypeptide as disclosed herein at a concentration of at least, at most, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, preferably about 0.01 to about 0.18 mg / mL, for example about 0.06 mg / mL or about 0.18 mg / mL, encapsulated in LNPs of a lipid composition having a concentration of about 0.8 to 0.95 mg / mL ALC-0315, a concentration of about 0.05 to 0.15 mg / mL ALC-0159, a concentration of about 0.1 to 0.25 mg / mL DSPC, and a concentration of about 0.3 to 0.45 mg / mL cholesterol, and the composition further comprises a Tris buffer composition comprising tromethamine at a concentration of about 0.01 and 0.15 mg / mL and Tris HC1 at a concentration of about 0.5 and 0.65 mg / mL, sucrose at a concentration of about 35 to 50 mg / mL, and sodium chloride (NaCl) diluent at a concentration of about 5 to 15 mg / mL for reconstitution. In particular aspects, the lyophilized composition is reconstituted in about 0.6 to 0.75 mL sodium chloride. In some aspects, the immunogenic composition of the disclosure comprises about 5 to 15 mM Tris buffer, 200 to 400 mM sucrose, at a pH of about 7.0 to 8.0. In some aspects, the immunogenic composition comprises 10 mM Tris buffer and 300 mM sucrose, at a pH of about 7.4.

[0115] In some aspects, the lyophilized RNA-LNP immunogenic composition comprises an RNA molecule / polynucleotide encoding a VZV polypeptide as disclosed herein encapsulated in LNPs at a concentration of at least, at most, exactly 0.01, 0.15, 0.30, 0.43, 0.45, 0.60, 0.75, or 0.90 mg / mL or between any two of 0.01, 0.15, 0.30, 0.43, 0.45, 0.60, 0.75, or 0.90 mg / mL, preferably about 0.01 to 0.18 mg / mL, for example about 0.06 mg / mL or 0.18 mg / mL, and further comprises about 5 to 15 mM Tris buffer, 200 to 400 mM sucrose, at a pH of about 7.0 to 8.0. In some aspects, the lyophilized composition further comprises 10 mM Tris buffer and 300 mM sucrose at a pH of about 7.4, and is reconstituted with 0.9% sodium chloride diluent.

[0116] The lyophilized compositions used in the studies described herein comprise 0.06 mg / mL RNA after reconstitution or 0.18 mg / mL RNA after reconstitution, and 10 mM Tris buffer, 300 mM sucrose, and are reconstituted with 0.9% sodium chloride diluent.

[0117] The concentrations in the lyophilized RNA-LNP compositions are determined after reconstitution.

[0118] The immunogenic compositions are administered in injection volumes of about 0.25 to 1 mL (e.g., about 0.25, 0.5, 1 mL) as needed. In some aspects, dilution with sterile 0.9% sodium chloride (normal saline) can be needed.

[0119] The VZV RNA molecules / constructs and RNA-LNPs evaluated in the clinical studies described in the examples herein include modified RNA (modRNA) comprising an RNA sequence in which all uridines are replaced with N1-methyl pseudouridines (Ψ) (i.e., VZV modRNA vaccines).

[0120] The immunogenic compositions provided by the present disclosure can be used or administered in combination with one or more other vaccines. For example, with an influenza vaccine, a pneumococcal vaccine (e.g., a pneumococcal conjugate vaccine (PCV), such as Prevnar 7, 13, or 20, etc.), a tetanus vaccine, a diphtheria vaccine, a pertussis vaccine (e.g., Tdap), a respiratory syncytial virus (RSV) vaccine, or a COVID-19 vaccine.

[0121] The VZV RNA molecules, RNA-LNPs (e.g., VZV modRNA vaccines), and related aspects thereof used herein can be any of those described in PCT / IB2022 / 059774, the entire disclosure of which is incorporated by reference herein for all purposes.

[0122] The present disclosure provides the methods described herein, comprising administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule (e.g., a VZV modRNA vaccine) formulated in a lipid nanoparticle, wherein the RNA molecule encodes a VZV gE polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 1-11, and wherein a VZV gE binding antibody is induced in the human subject. In one aspect, the RNA molecule encodes a VZV gE polypeptide comprising the amino acid sequence of SEQ ID NO: 1. In one aspect, the RNA molecule encodes a VZV gE polypeptide comprising the amino acid sequence of SEQ ID NO: 5. In one aspect, the RNA molecule encodes a VZV gE polypeptide comprising the amino acid sequence of SEQ ID NO: 4.

[0123] The present disclosure further provides the methods described herein, comprising administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule encodes a VZV gE polypeptide that accumulates in the trans-Golgi network (TGN), is secreted, and / or is expressed in the cell membrane, and wherein VZV gE binding antibodies are induced in the human subject.

[0124] The present disclosure also provides the methods described herein, comprising administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises a nucleic acid sequence selected from any one of SEQ ID NOs: 146-279, and wherein VZV gE binding antibodies are induced in the human subject. In one aspect, the RNA molecule comprises the open reading frame (OFR) nucleic acid sequence of SEQ ID NO: 148. In one aspect, the RNA molecule comprises the OFR nucleic acid sequence of SEQ ID NO: 157. In one aspect, the RNA molecule comprises the OFR nucleic acid sequence of SEQ ID NO: 153.

[0125] In one aspect, the methods described herein comprise administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, and wherein the composition is administered at a dose ranging from about 15 pg to about 90 pg. In one aspect, the composition is administered at a dose of about 15 pg. In one aspect, the composition is administered at a dose of about 30 pg. In one aspect, the composition is administered at a dose of about 60 pg. In one aspect, the composition is administered at a dose of about 90 pg.

[0126] In one aspect, the methods described herein comprise administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, and wherein the composition is administered in a single dose or a two-dose regimen (0 and 2 months or 0 and 6 months).

[0127] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, wherein the geometric mean concentration (GMC) of VZV gE antibodies in the subject is at least 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold, or 40-fold greater than baseline about 1 month after the first dose.

[0128] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, wherein the percentage of subjects with at least a 4-fold increase in GMC is at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of subjects about 1 month after the first dose.

[0129] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, wherein the geometric mean fold rise (GMFR) of VZV gE antibodies is at least 15, 20, 25, 30, 35, or 40 or more about 1 month after the first dose.

[0130] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, wherein the GMC of VZV gE antibodies in the subject is higher than the GMC of antibodies in the subject at baseline and 1 month after the first dose about 1 month after the second dose.

[0131] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, wherein the GMC of VZV gE antibodies in the subject is at least 5-fold, 10-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, 55-fold, or 60-fold greater than baseline about 1 month after the second dose.

[0132] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, wherein the percentage of subjects with at least a 4-fold increase in GMC is at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% about 1 month after the second dose.

[0133] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 148, 157, or 153, wherein the geometric mean fold rise (GMFR) of VZV gE antibodies is at least 25, 30, 35, 40, 45, 50, 60, 65, 70, or 75 or greater about 1 month after the second dose.

[0134] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, wherein the GMC of VZV gE antibodies in the subject is at least about 1.1-fold, 1.2-fold, 1.3-fold, or 1.4-fold of the GMC of VZV gE antibodies in the human subject about 1 month after the first dose. In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, wherein the GMC of VZV gE antibodies in the subject is at least about 1.1-fold, 1.2-fold, 1.3-fold, or 1.4-fold of the GMC of VZV gE antibodies in the human subject about 1 month after the first dose.

[0135] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, wherein about 1 month after the second dose, the GMC of VZV gE antibodies in the subject is at least about 1.1 times the GMC of VZV gE antibodies in the subject about 1 month after the first dose. about 1 month after the second dose. In one aspect, the GMC of VZV gE antibodies in the subject about 1 month after the second dose is at least about 1.1 times the GMC of VZV gE antibodies in the subject about 1 month after the first dose.

[0136] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, wherein about 1 month after the second dose, the GMC of VZV gE antibodies in the subject is at least about 1.1 times the GMC of VZV gE antibodies in the subject about 1 month after the first dose. about 1 month after the second dose. In one aspect, the GMC of VZV gE antibodies in the subject about 1 month after the second dose is at least about 1.1 times the GMC of VZV gE antibodies in the subject about 1 month after the first dose. about 1 month after the second dose. In one aspect, the GMC of VZV gE antibodies in the subject about 1 month after the second dose is at least about 1.1 times the GMC of VZV gE antibodies in the subject about 1 month after the first dose.

[0137] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, wherein about 1 month after the second dose, the GMC of VZV gE antibodies in the subject is at least about 1.1 times the GMC of VZV gE antibodies in the subject about 1 month after the first dose. about 1 month after the second dose. In one aspect, the GMC of VZV gE antibodies in the subject about 1 month after the second dose is at least about 1.1 times the GMC of VZV gE antibodies in the subject about 1 month after the first dose.

[0138] In one aspect, the methods described herein include administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, wherein about 1 month after the second dose, the GMC of VZV gE antibodies in the subject is at least about 1.1 times the GMC of VZV gE antibodies in the subject about 1 month after the first dose. about 1 month after the second dose. In one aspect, the GMC of VZV gE antibodies in the subject about 1 month after the second dose is at least about 1.1 times the GMC of VZV gE antibodies in the subject about 1 month after the first dose. about 1 month after the second dose. In one aspect, the GMC of VZV gE antibodies in the subject about 1 month after the second dose is at least about 1.1 times the GMC of VZV gE antibodies in the subject about 1 month after the first dose.

[0139] In one aspect, the methods described herein comprise administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule (e.g., a VZV modRNA vaccine) formulated in lipid nanoparticles, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 153, wherein about one month after the second dose, GMFR is at or below the second dose. At least about 1.1 times, 1.2 times, or 1.3 times the GMFR in human subjects one month after administration.

[0140] In one aspect, the methods described herein comprise administering to a human subject an effective amount of an immunogenic composition comprising an RNA molecule formulated in a lipid nanoparticle (e.g., a VZV modRNA vaccine), wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, wherein about one month after the first dose, GMFR is elevated compared to that of the second dose. The GMFR of human subjects was similar 1 month later.

[0141] In one aspect, the methods described herein comprise administering to a human subject an immunogenic composition comprising 90 μg of an RNA molecule (e.g., a VZV modRNA vaccine) formulated in lipid nanoparticles, wherein the RNA molecule comprises the nucleic acid sequence of SEQ ID NO: 157, wherein about one month after the first dose, GMFR is expressed in the presence of a second dose of The GMFR of human subjects was similar 1 month later.

[0142] I. Examples of Definitions

[0143] Throughout this application, the term "about" is used according to its ordinary and customary meaning in the arts of cell and molecular biology to indicate a ±10% deviation from the value or values ​​with which it is used.

[0144] Recitation of ranges of values ​​herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.

[0145] When used in conjunction with the term "comprising," the use of the words "a" and "an" can mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one."

[0146] The phrase "and / or" means "and" or "or." For illustration, A, B, and / or C includes: A alone, B alone, C alone, the combination of A and B, the combination of A and C, the combination of B and C, or the combination of A, B, and C. In other words, "and / or" acts as an inclusive or operation.

[0147] The phrase "substantially all" is defined as "at least 95%" and if substantially all members of a group have a certain characteristic, then at least 95% of the members of the group have the characteristic. In some aspects, substantially all means equal to any one of, at least any one of, or between any two of: 95%, 96%, 97%, 98%, 99%, or 100% of the members of the group have the characteristic.

[0148] Compositions and methods can, when used, "comprise," "consist essentially of," or "consist of" any of the ingredients or steps disclosed throughout the specification. Throughout the specification, unless the context requires otherwise, the word "comprise," and any form of comprise, such as "comprise," "comprise," and "comprise," "have," and any form of have, such as "have" and "have," "include," and any form of include, such as "include" and "include," or "contain," and any form of contain, such as "contain" and "contain," are inclusive or open-ended and should be interpreted to mean including but not limited to. It is contemplated that aspects described herein in the context of the term "comprise" can also be implemented in the context of the term "consist of" or "consist essentially of." Compositions and methods that "consist of" any of the ingredients or steps disclosed throughout the specification limit the scope of the claims to the specified materials or steps that do not materially affect the basic and novel characteristic(s) of the claimed disclosure. The word "consisting of" (and any form of consisting of, such as "consist of" and "consists of") means including and limited to whatever follows the phrase "consisting of." Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory and that no other elements can be present.

[0149] Reference throughout this specification to“one aspect”,“an aspect”,“certain aspects”,“certain implementations”,“some aspects”,“some implementations”, or“another aspect” or combinations thereof, means that a particular feature, structure, or characteristic described in connection with the aspect is included in at least one aspect of the disclosure. The appearances of the foregoing phrases in various places in the specification are not necessarily all referring to the same aspect. Furthermore, the particular features, structures, or characteristics can be combined in any suitable manner in one or more aspects.

[0150] The terms“inhibiting”,“decreasing”, or“reducing”, or any variation of these terms, includes any measurable decrease, e.g., 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, or complete inhibition, to achieve a desired result. The terms“improving”,“enhancing”, or“increasing”, or any variation of these terms, includes any measurable increase, e.g., 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, or complete, to achieve a desired result or production of a protein or molecule.

[0151] As used herein, the terms“reference”,“standard”, or“control” describe a value against which a comparison is made. For example, a drug agent, subject, population, sample, or value of interest is compared to a reference, standard, or control drug agent, subject, population, sample, or value of interest. The reference, standard, or control can be tested and / or assayed substantially simultaneously with the drug agent, subject, population, sample, or value of interest, and / or by the same test or assay of the drug agent, subject, population, sample, or value of interest, and / or can be assayed or characterized under comparable conditions or circumstances as the drug agent, subject, population, sample, or value of interest being evaluated.

[0152] The term "isolated" can refer to a nucleic acid or polypeptide that is substantially free of cellular material, bacterial material, viral material, or culture medium when produced by recombinant DNA techniques or chemical precursors or other chemicals when chemically synthesized. In addition, an isolated compound refers to a compound that can be administered to a subject in the form of an isolated compound; in other words, a compound cannot simply be considered "isolated" if it is stuck to a column or embedded in an agarose gel. Furthermore, an "isolated nucleic acid fragment" or "isolated peptide" is a nucleic acid or protein fragment that is not naturally occurring as a fragment and / or that is not typically found in a functional state in nature and / or that is changed or removed from its natural state by the hand of man. For example, DNA in living animals is not "isolated", but DNA that is synthesized or prepared apart from its naturally occurring milieu is "isolated." An isolated nucleic acid can exist in substantially purified form, or can exist in a non-native environment, such as a cell into which the nucleic acid has been delivered.

[0153] As used herein, "nucleic acid" is a molecule comprising a nucleic acid component, and refers to a DNA or RNA molecule. It can be used interchangeably with the term "polynucleotide." A nucleic acid molecule is a polymer comprising or consisting of nucleotide monomers covalently linked to one another by phosphodiester bonds of a sugar / phosphate backbone. Nucleic acids can also encompass modified nucleic acid molecules, such as DNA or RNA molecules that are base-modified, sugar-modified, or backbone-modified, etc. Nucleic acids can exist in a variety of forms, such as: an isolated segment of an incorporated sequence or recombinant polynucleotide encoding a polypeptide, such as one or both chains of an antigen or antibody, and recombinant vectors, or fragments, derivatives, muteins, or variants thereof; a polynucleotide sufficient for use as a hybridization probe; a PCR primer or sequencing primer for identifying, analyzing, mutating, or amplifying a polynucleotide encoding a polypeptide; an antisense nucleic acid for inhibiting expression of a polynucleotide; mRNA; saRNA; and a complement of each of the foregoing described herein. A nucleic acid can encode an epitope to which an antibody can bind.

[0154] The term "epitope" refers to a portion that is specifically recognized by an immunoglobulin (e.g., an antibody or receptor) binding component. In some aspects, an epitope comprises multiple chemical atoms or groups on an antigen. In some aspects, such chemical atoms or groups are surface-exposed when the antigen adopts a relevant three-dimensional conformation. In some aspects, such chemical atoms or groups are physically proximal to one another in space when the antigen adopts such a conformation. In some aspects, at least some such chemical atoms or groups are physically separated from one another when the antigen adopts an alternative conformation (e.g., linearized).

[0155] A nucleic acid can be single-stranded or double-stranded, and can comprise RNA and / or DNA nucleotides, and artificial variants thereof (e.g., peptide nucleic acids). In some cases, a nucleic acid sequence can encode a polypeptide sequence with additional heterologous coding sequences, e.g., to enable purification, transport, secretion, post-translational modification of the polypeptide, or to enable a therapeutic benefit, such as targeting or efficacy. Tags or other heterologous polypeptides can be added to the modified polypeptide coding sequence, where “heterologous” refers to a polypeptide that is different from the modified polypeptide.

[0156] The term “polynucleotide” refers to a nucleic acid molecule, which can be recombinant or isolated from total genomic nucleic acid. Included within the term “polynucleotide” are oligonucleotides (nucleic acids 100 residues or fewer in length), recombinant vectors (including, e.g., plasmids, cosmids, phages, viruses), and the like. In certain aspects, a polynucleotide includes regulatory sequences substantially isolated from their naturally occurring genomic or protein coding sequences. A polynucleotide can be single-stranded (coding or antisense) or double-stranded, and can be RNA, DNA (genomic, cDNA or synthetic), an analog thereof, or a combination thereof. Additional coding or non-coding sequences can or can not be present within a polynucleotide.

[0157] In certain aspects, there are polynucleotide variants that are substantially identical to the sequences disclosed herein; have a sequence identity, using the methods described herein (e.g., BLAST analysis using standard parameters), compared to the polynucleotide sequences provided herein that is equal to any one of, at least any one of, at most any one of, or between any two of the following sequence identities: 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence identity. In certain aspects, an isolated polynucleotide will comprise a nucleotide sequence encoding a polypeptide that is at least 90% identical over an entire length of the sequence to an amino acid sequence described herein; or a nucleotide sequence complementary to the isolated polynucleotide. In some aspects, an isolated polynucleotide will comprise a nucleotide sequence encoding a polypeptide that is at least 95% identical over an entire length of the sequence to an amino acid sequence described herein; or a nucleotide sequence complementary to the isolated polynucleotide.

[0158] Regardless of the length of the coding sequence itself, the nucleic acid segment can be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, etc., such that the overall length can vary significantly. The nucleic acid can be of any length. The nucleic acid may, for example, be equal to, be at least, be at most, or be between any two of: 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, or more nucleotides in length; and / or can comprise one or more additional sequences (e.g., regulatory sequences); and / or can be part of a larger nucleic acid (e.g., a vector). Thus, it is contemplated that virtually any length of nucleic acid fragment can be used, with overall length limited by ease of preparation and intended use in the recombining nucleic acid scheme.

[0159] In this regard, the term "gene" is used to refer to a nucleic acid that encodes a protein, polypeptide, or peptide (including any sequences required for proper transcription, post-translational modification, or localization). As will be appreciated by those in the art, this term encompasses genomic sequences, expression cassettes, cDNA sequences, and smaller engineered nucleic acid segments that express or can be adapted to express proteins, polypeptides, domains, peptides, fusion proteins, and mutants. A nucleic acid that encodes all or a portion of a polypeptide can contain a contiguous nucleic acid sequence that encodes all or a portion of such a polypeptide. It is also contemplated that a particular polypeptide can be encoded by a nucleic acid containing a slightly different nucleic acid sequence, but still encoding the same or a substantially similar polypeptide.

[0160] As used herein, the term "expression" of a nucleic acid sequence refers to the production of any gene product from the nucleic acid sequence. In some aspects, the gene product can be a transcript. In some aspects, the gene product can be a polypeptide. In some aspects, expression of a nucleic acid sequence involves one or more of: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, etc.); (3) translation of an RNA into a polypeptide or protein; and / or (4) post-translational modification of a polypeptide or protein.

[0161] Generally, the term "engineered" refers to aspects that have been manipulated by the hand of man. For example, a polynucleotide is considered "engineered" when two or more sequences that are not connected together in that order in nature are directly linked to one another in an engineered polynucleotide by manipulation by the hand of man and / or when particular residues in a polynucleotide are non-naturally occurring and / or linked to entities or moieties that are not connected in nature via the hand of man.

[0162] As used herein, the term "DNA" means a nucleic acid molecule comprising nucleotides such as deoxyadenosine monophosphate, deoxythymidine monophosphate, deoxyguanosine monophosphate, and deoxycytidine monophosphate monomers, which nucleotides are composed of a sugar moiety (deoxyribose), a base moiety, and a phosphate moiety, and are polymerized by a characteristic backbone structure. The backbone structure is typically formed by a phosphodiester bond between the sugar moiety (e.g., deoxyribose) of a nucleotide of a first monomer and the phosphate moiety of a second adjacent monomer. The particular order of monomers (e.g., the order of bases linked to the sugar / phosphate backbone) is referred to as the DNA sequence. DNA can be single-stranded or double-stranded. In double-stranded form, the nucleotides of a first strand are typically hybridized to the nucleotides of a second strand, e.g., by A / T base pairing and G / C base pairing. DNA can comprise all or a substantial portion of deoxyribonucleotide residues. As used herein, the term "deoxyribonucleotide" means a nucleotide that does not contain a hydroxyl group at the 2' position of the beta-D-ribofuranosyl group. Without being limiting in any way, DNA can encompass double-stranded DNA, antisense DNA, single-stranded DNA, isolated DNA, synthetic DNA, DNA produced recombinantly, and modified DNA.

[0163] As used herein, the term "RNA" means a nucleic acid molecule comprising nucleotides such as adenosine monophosphate, uridine monophosphate, guanosine monophosphate, and cytidine monophosphate monomers connected to one another along a so-called backbone. The backbone is formed by phosphodiester bonds between the sugar (e.g., ribose) of a first monomer and the phosphate moiety of a second adjacent monomer. RNA can be obtained, for example, within a cell by transcription of a DNA sequence. In eukaryotic cells, transcription is typically carried out within the nucleus or mitochondria. In vivo, transcription of DNA can produce immature RNA, which is processed into messenger RNA (mRNA). Processing of immature RNA, for example, in eukaryotic organisms, includes various post-transcriptional modifications such as splicing, 5' capping, polyadenylation, export from the nucleus or mitochondria. Mature messenger RNA is processed and provides a nucleotide sequence that can be translated into an amino acid sequence of a peptide or protein. Mature mRNA can comprise a 5' cap, a 5' UTR, an open reading frame, a 3' UTR, and a poly-A tail sequence. RNA can comprise all or mostly ribonucleotide residues. As used herein, the term "ribonucleotide" means a nucleotide containing a hydroxyl group at the 2' position of a beta-D-ribofuranosyl group. In one aspect, RNA can be messenger RNA (mRNA) associated with an RNA transcript encoding a peptide or protein. As known to one of skill in the art, mRNA generally contains a 5' untranslated region (5' UTR), a polypeptide coding region, and a 3' untranslated region (3' UTR). Without being bound by any limitation, RNA can encompass double-stranded RNA, antisense RNA, single-stranded RNA, isolated RNA, synthetic RNA, recombinantly produced RNA, and modified RNA (modRNA).

[0164] "Isolated RNA" is defined as an RNA molecule that can be recombinant or has been separated from total genomic nucleic acid. An isolated RNA molecule or protein can exist in substantially purified form, or can exist in a non-native environment such as a host cell.

[0165] A "modified RNA" or "modRNA" refers to an RNA molecule having at least one addition, deletion, substitution, and / or alteration of one or more nucleotides compared to a naturally occurring RNA. Such alterations can refer to the addition of non-nucleotide material to internal RNA nucleotides, or to the 5' end and / or 3' end of the RNA. In one aspect, such modRNA contains at least one modified nucleotide, such as an alteration of the base of a nucleotide. For example, a modified nucleotide can substitute for one or more uridine and / or cytidine nucleotides. For example, these substitutions can occur for every instance of uridine and / or cytidine in the RNA sequence, or can occur for only selected uridine and / or cytidine nucleotides. Such alterations of standard nucleotides in the RNA can include non-standard nucleotides, such as chemically synthesized nucleotides or deoxynucleotides. For example, at least one uridine nucleotide in the RNA sequence can be substituted with an N1-methyl pseudouridine. Other such altered nucleotides are known to those of skill in the art. Such altered RNA molecules are considered to be analogs of naturally occurring RNA. In some aspects, the RNA is produced by in vitro transcription using a DNA template, where DNA refers to a nucleic acid containing deoxyribonucleotides. In some aspects, the RNA can be a replicon RNA (replicon), especially a self-replicating RNA or a self-amplifying RNA (saRNA).

[0166] As contemplated herein, without any limitation, RNA can be used as a therapeutic modality for the treatment and / or prevention of a variety of conditions in mammals, including humans. The methods described herein include administering to a mammal, such as a human, an RNA described herein. For example, in one aspect, such methods using RNA include RNA vaccines encoding antigens to induce stable neutralizing antibodies and accompanying / concomitant T cell responses to achieve protective immunization. In some aspects, a minimal vaccine dose is administered to induce stable neutralizing antibodies and accompanying / concomitant T cell responses to achieve protective immunization. In one aspect, the RNA administered is in vitro transcribed RNA. For example, such RNA can be used to encode at least one antigen intended to generate an immune response in the mammal. A pathogenic antigen is a peptide or protein antigen derived from a pathogen associated with an infectious disease. In particular aspects, the pathogenic agent is a peptide or protein antigen derived from VZV. Conditions and / or diseases that can be treated with the RNA disclosed herein include, but are not limited to, those conditions and / or diseases caused by and / or affected by viral infection. Such viruses include, but are not limited to, VZV.

[0167] As used herein, "prevent," "preventing," or "prevention," when used in connection with the occurrence of a disease, disorder, and / or condition, refers to a reduction in the risk of developing that disease, disorder, and / or condition and / or a delay in the onset of one or more characteristics or symptoms of the disease, disorder, or condition. Prevention can be considered complete when the onset of the disease, disorder, or condition has been delayed for a predetermined period of time.

[0168] As will be understood from context, "risk" of a disease, disorder, and / or condition refers to the likelihood that a particular individual will develop that disease, disorder, and / or condition. In some aspects, risk is expressed as a percentage. In some aspects, risk is, is at least, or is at most, 0, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, up to 100%. In some aspects, risk is expressed as a risk relative to a risk associated with a reference sample or a reference group of samples. In some aspects, the reference sample or reference group of samples has a known risk of a disease, disorder, condition, and / or event. In some aspects, the reference sample or reference group of samples is from an individual similar to the particular individual. In some aspects, risk can reflect one or more genetic attributes, e.g., that can predispose an individual to developing (or not developing) a particular disease, disorder, and / or condition. In some aspects, risk can reflect one or more epigenetic events or attributes and / or one or more lifestyle or environmental events or attributes. Predisposed to: An individual who is "predisposed to" a disease, disorder, and / or condition is an individual who has a higher risk of developing that disease, disorder, and / or condition than the general public. In some aspects, an individual who is predisposed to a disease, disorder, and / or condition can not have been diagnosed with that disease, disorder, and / or condition. In some aspects, an individual who is predisposed to a disease, disorder, and / or condition can present symptoms of that disease, disorder, and / or condition. In some aspects, an individual who is predisposed to a disease, disorder, and / or condition can not present symptoms of that disease, disorder, and / or condition. In some aspects, an individual who is predisposed to a disease, disorder, and / or condition will develop that disease, disorder, and / or condition. In some aspects, an individual who is predisposed to a disease, disorder, and / or condition will not develop that disease, disorder, and / or condition.

[0169] The terms "protein," "polypeptide," or "peptide" are used synonymously herein and refer to a polymer of amino acid monomers, e.g., a molecule comprising at least two amino acid residues. A polypeptide can include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, xenologs, isologs, fragments, and other equivalents, variants, and analogs of the foregoing. A polypeptide can be a single molecule or can be a multimeric complex, such as a dimer, trimer, or tetramer. A protein comprises one or more peptides or polypeptides and can fold into a 3-dimensional form, which the protein can need to exert its biological function.

[0170] As used herein, the term "wild type" or "WT" or "native" refers to the endogenous form of a molecule that is naturally occurring in an organism. In some aspects, the wild type form of a protein or polypeptide is employed, however in other aspects of the disclosure, a modified protein or polypeptide is employed to generate an immune response. The terms described above are used interchangeably.

[0171] A "modified protein" or "modified polypeptide" or "variant" refers to a protein or polypeptide whose chemical structure, and in particular, its amino acid sequence, is altered relative to a wild type protein or polypeptide. In some aspects, the modified protein or polypeptide / variant protein or polypeptide has at least one modified activity or function (recognizing that a protein or polypeptide can have multiple activities or functions). It is contemplated, in particular, that a modified protein or polypeptide / variant protein or polypeptide can be altered with respect to one activity or function, but in other aspects, retains the wild type activity or function, such as immunogenicity. When a protein is specifically mentioned herein, it generally refers to a native (wild type) or recombinant (modified) protein. A protein can be isolated directly from a native organism, produced by recombinant DNA / exogenous expression methods, produced by solid phase peptide synthesis (SPPS) or other in vitro methods. In particular aspects, there are isolated nucleic acid segments and recombinant vectors that incorporate nucleic acid sequences encoding a polypeptide, e.g., an antigen or fragment thereof. The term "recombinant" can be used in connection with a polypeptide or a specific polypeptide name, and this generally refers to a polypeptide that is produced from a nucleic acid molecule that has been manipulated in vitro or a polypeptide that is a replication product of such a molecule.

[0172] The term "fragment" with reference to an amino acid sequence (peptide or protein) refers to a part of the amino acid sequence, i.e. a sequence that is shortened at the N- and / or C-terminus. A fragment shortened at the C-terminus (N-terminal fragment) can be obtained, for example, by translation of a truncated open reading frame that does not have a 3' end of the open reading frame. A fragment shortened at the N-terminus (C-terminal fragment) can be obtained, for example, by translation of a truncated open reading frame that does not have a 5' end of the open reading frame, as long as the truncated open reading frame comprises a start codon to initiate translation. A fragment of an amino acid sequence comprises, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 99% of the amino acid residues from the amino acid sequence. In the present disclosure, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least, at most, exactly the following sequence identity or between any two of the following sequence identities: 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived.

[0173] In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 70% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 80% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 85% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 90% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 95% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 97% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 99% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived.

[0174] As used herein in the context of a molecule (e.g., a nucleic acid, a protein, or a small molecule), the term "variant" refers to a molecule that exhibits substantial structural identity to a reference molecule but differs in structure from the reference molecule, e.g., differs in the presence or absence of one or more chemical moieties or in the amount of one or more chemical moieties as compared to the reference entity. In some aspects, a variant also differs in function from its reference molecule. In general, whether a particular molecule is properly considered a "variant" of a reference molecule is based on the degree of structural identity it shares with the reference molecule. As will be appreciated by those skilled in the art, any biological or chemical reference molecule has certain characteristic structural components. By definition, a variant is a different molecule that shares one or more such characteristic structural components with the reference molecule but differs from the reference molecule in at least one respect. In some aspects, a variant polypeptide or nucleic acid can differ from a reference polypeptide or nucleic acid due to one or more differences in amino acid or nucleotide sequence and / or due to one or more differences in chemical moieties (e.g., carbohydrates, lipids, phosphate groups) that are covalently components of the polypeptide or nucleic acid (e.g., linked to the polypeptide or nucleic acid backbone). In some aspects, a variant polypeptide or nucleic acid exhibits at least, at most, exactly, or between any two of the following overall sequence identities: 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99% to a reference polypeptide or nucleic acid. In some aspects, a variant polypeptide or nucleic acid does not share at least one characteristic sequence component with a reference polypeptide or nucleic acid. In some aspects, a reference polypeptide or nucleic acid has one or more biological activities. In some aspects, a variant polypeptide or nucleic acid shares one or more of the biological activities of the reference polypeptide or nucleic acid. In some aspects, a variant polypeptide or nucleic acid does not have one or more of the biological activities of the reference polypeptide or nucleic acid. In some aspects, a variant polypeptide or nucleic acid exhibits a decrease in the level of one or more biological activities as compared to a reference polypeptide or nucleic acid. In some aspects, a polypeptide or nucleic acid of interest is considered a "variant" of a reference polypeptide or nucleic acid if its amino acid or nucleotide sequence is identical to that of the reference, but has a small number of sequence alterations at particular positions. Preferably, a variant polypeptide or nucleic acid sequence has at least one modification, e.g., 1 to about 20 modifications, as compared to a reference polypeptide or nucleic acid sequence. In one aspect, a variant polypeptide or nucleic acid sequence has 1 to about 10 modifications as compared to a reference polypeptide or nucleic acid sequence. In one aspect, a variant polypeptide or nucleic acid sequence has 1 to about 5 modifications as compared to a reference polypeptide or nucleic acid sequence. Typically, less than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of the residues in a variant are substituted, inserted, or deleted as compared to a reference.In general, a variant polypeptide or nucleic acid comprises a small number (e.g., fewer than about 5, about 4, about 3, about 2, or about 1) of substituted, inserted, or deleted functional residues (e.g., residues involved in a particular biological activity) relative to a reference. In some aspects, a variant polypeptide or nucleic acid comprises about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 substituted residues compared to a reference. In some aspects, a variant polypeptide or nucleic acid comprises fewer than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and usually fewer than about 5, about 4, about 3, or about 2 additions or deletions compared to a reference. In some aspects, a variant polypeptide or nucleic acid comprises no more than about 5, about 4, about 3, about 2, or about 1 addition or deletion, and in some aspects, no additions or deletions, compared to a reference.

[0175] In some aspects, a reference polypeptide or nucleic acid is a "wild type" or "WT" or "native" sequence found in nature, including allelic variations. A wild type polypeptide or nucleic acid sequence has a sequence that has not been intentionally modified. For purposes of the present disclosure, a "variant" of an amino acid sequence (peptide, protein, or polypeptide) comprises an amino acid insertion variant, an amino acid addition variant, an amino acid deletion variant, and / or an amino acid substitution variant. A "variant" of a nucleotide sequence comprises a nucleotide insertion variant, a nucleotide addition variant, a nucleotide deletion variant, and / or a nucleotide substitution variant. The term "variant" includes all mutants, splice variants, post-translational modification variants, conformations, isoforms, allelic variants, species variants, and species homologs, especially those that occur in nature. The term "variant" includes, among other things, fragments of an amino acid or nucleic acid sequence.

[0176] Changes can be introduced into a nucleic acid by mutation, thereby causing alterations in the amino acid sequence of a polypeptide (e.g., an antigen or antibody or antibody derivative) encoded by the nucleic acid. Mutations can be introduced using any technique known in the art. In one aspect, one or more particular amino acid residues are altered using, for example, a site-directed mutagenesis protocol. In another aspect, one or more randomly selected residues are altered using, for example, a random mutagenesis protocol. In some aspects, whether performed in any manner, the mutated polypeptides can be expressed and screened for desired properties.

[0177] Mutations can be introduced into a nucleic acid without significantly altering the biological activity of a polypeptide encoded by the nucleic acid. For example, nucleotide substitutions that result in amino acid substitutions at non-essential amino acid residues can be made. Alternatively, one or more mutations that selectively alter the biological activity of a polypeptide encoded by the nucleic acid can be introduced into the nucleic acid. For example, the mutations can quantitatively or qualitatively alter the biological activity. Examples of quantitative alterations include increasing, decreasing, or eliminating activity. Examples of qualitative alterations include altering the antigen specificity of an antibody.

[0178] "Sequence similarity" indicates the percentage of amino acids that are identical or represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences. "Sequence identity" between two nucleic acid sequences indicates the percentage of nucleotides that are identical between the sequences.

[0179] The term "percent identity," "percent identity," or like terms is intended to mean, inter alia, the percentage of nucleotides or amino acids that are identical between the compared sequences in the optimal alignment. The percentage is purely statistical and the differences between the two sequences can or can not be randomly distributed over the length of the compared sequences. Comparison of two sequences is typically performed by comparing the sequences over a segment or "comparison window" following optimal alignment to identify local regions where the sequences correspond. Optimal alignment for comparison can be performed manually or by means of the local homology algorithm of Smith and Waterman, 1981, Ads App. Math. 2, 482, by means of the local homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, by means of the similarity search algorithm of Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or by means of computer programs using these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group). In some aspects, the percent identity of two sequences is determined using the BLASTN or BLASTP algorithm, as available on the National Center for Biotechnology Information (NCBI) website.

[0180] The percent identity is obtained by determining the number of corresponding identical positions in the compared sequences, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence), and multiplying this result by 100.

[0181] In some aspects, the degree of similarity or identity is given for a region between at least, at most, exactly, or any two of the following: about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the length of the reference sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is given for at least, at most, exactly, or any two of the following number of nucleotides: about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, in some aspects, contiguous nucleotides. In some aspects, the degree of similarity or identity is given for the entire length of the reference sequence.

[0182] A homologous amino acid sequence can exhibit at least, at most, exactly, or any two of the following identities of amino acid residues: 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identity. In one aspect, a homologous amino acid sequence exhibits at least 95% identity of amino acid residues. In one aspect, a homologous amino acid sequence exhibits at least 98% identity of amino acid residues. In one aspect, a homologous amino acid sequence exhibits at least 99% identity of amino acid residues.

[0183] A fragment or variant of an amino acid sequence (peptide or protein) can be a "functional fragment" or "functional variant." The term "functional fragment" or "functional variant" of an amino acid sequence refers to any fragment or variant that exhibits the same or similar functional property or properties as the amino acid sequence from which it is derived, e.g., it is functionally equivalent. With respect to an antigen or antigenic sequence, one particular function is one or more immunogenic activities exhibited by the amino acid sequence from which the fragment or variant is derived. As used herein, the term "functional fragment" or "functional variant" refers, inter alia, to a variant molecule or sequence comprising an amino acid sequence that has one or more changes in amino acids compared to the amino acid sequence of the parent molecule or sequence and is still able to perform one or more functions of the parent molecule or sequence, e.g., induce an immune response. In one aspect, the modifications in the amino acid sequence of the parent molecule or sequence do not significantly affect or alter the characteristics of the molecule or sequence.

[0184] An amino acid sequence (peptide, protein, or polypeptide) "derived from" a specified amino acid sequence (peptide, protein, or polypeptide) refers to the origin of the first amino acid sequence. Preferably, an amino acid sequence derived from a particular amino acid sequence has an amino acid sequence that is identical, substantially identical, or homologous to the particular sequence or a fragment thereof. An amino acid sequence derived from a particular amino acid sequence can be a variant of the particular sequence or a fragment thereof. For example, one of ordinary skill in the art will appreciate that an antigen useful herein can be altered so that it differs in sequence from the naturally occurring sequence from which it is derived or the native sequence, while retaining the desired activity of the native sequence.

[0185] In the present disclosure, a vector refers to a nucleic acid molecule, such as an artificial nucleic acid molecule. A vector can be used to incorporate a nucleic acid sequence, such as a nucleic acid sequence comprising an open reading frame. Vectors include, but are not limited to, storage vectors, expression vectors, cloning vectors, transfer vectors. A vector can be an RNA vector or a DNA vector. In some aspects, a vector is a DNA molecule. In some aspects, a vector is a plasmid vector. In some aspects, a vector is a viral vector. Generally, an expression vector will contain the desired coding sequence and appropriate additional sequences for expression of operably linked coding sequences in a particular host organism (e.g., bacteria, yeast, plant, insect, or mammal) or in an in vitro expression system. Cloning vectors are generally used to engineer and amplify a desired fragment (typically a DNA fragment), and can lack functional sequences required for expression of the desired fragment.

[0186] As used herein, the term "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers. A pharmaceutical composition can be an immunogenic composition. In some aspects, an active agent is present in a therapeutic regimen in an amount appropriate for a unit dose suitable for administration that, when administered to a relevant population, shows a statistically significant probability of achieving a predetermined therapeutic effect. In some aspects, a pharmaceutical composition can be specially formulated for parenteral administration, e.g., by injection as a sterile solution or suspension, or sustained release formulation, e.g., subcutaneous, intramuscular, intravenous or epidural.

[0187] As used herein, the term "vaccination" refers to administration of an immunogenic composition intended to produce an immune response, e.g., against a disease-associated (e.g., pathogenic) agent (e.g., a virus). In some aspects, vaccination can be administered prior to, during, and / or after exposure to a disease-associated agent and, in certain aspects, prior to, during, and / or shortly after exposure to the disease-associated agent. In some aspects, vaccination comprises multiple administrations of a vaccine composition at a suitable interval in time. In some aspects, vaccination produces an immune response against an infectious agent. In some aspects, vaccination produces an immune response against a tumor; in some such aspects, vaccination is "personalized" in that it is directed, in part or in whole, to an epitope determined to be present in a tumor of a particular individual (e.g., which can be or include one or more neoepitopes).

[0188] An immune response refers to a humoral response, a cellular response, or both a humoral and cellular response in an organism. An immune response can be measured by an assay, including but not limited to, an assay that measures the presence or amount of an antibody that specifically recognizes a protein or cell surface protein (e.g., a glycoprotein E (gE)-binding antibody), an assay that measures T cell activation or proliferation, and / or an assay that measures modulation in the activity or expression of one or more cytokines.

[0189] As used herein, the term “combination therapy” refers to situations in which a subject is simultaneously exposed to two or more treatment regimens (e.g., two or more therapeutic agents). In some aspects, the two or more regimens can be administered simultaneously; in some aspects, such regimens can be administered sequentially (e.g., administering all “doses” of a first regimen prior to administering any dose of a second regimen); in some aspects, such agents are administered in overlapping dosing regimens. In some aspects, “administration” of a combination therapy can involve administering one or more agents or modalities to a subject receiving other agents or modalities in a combination. For clarity, combination therapy does not require that individual agents be administered together in a single composition (or even necessarily simultaneously), but in some aspects, two or more agents or active moieties thereof can be administered together in a combined composition or even in a combined compound (e.g., as part of a single chemical complex or covalent entity).

[0190] Those of skill in the art will appreciate that the term “dosing regimen” can be used to refer to a set of unit dosages administered individually to a subject, typically more than once, which are typically separated by a period of time. In some aspects, a given therapeutic agent has a recommended dosing regimen, which can involve one or more dosings. In some aspects, a dosing regimen includes multiple dosings, each of which is separated in time from the others. In some aspects, the individual dosings are separated from one another by periods of time of the same length; in some aspects, a dosing regimen includes multiple dosings and at least two different periods of time separating the individual dosings. In some aspects, all dosings within a dosing regimen have the same unit dosage amount. In some aspects, different dosings within a dosing regimen have different amounts. In some aspects, a dosing regimen includes a first dosing of a first dosage amount, followed by one or more additional dosings of a second dosage amount different from the first dosage amount. In some aspects, a dosing regimen comprises a first dosing of a first dosage amount, followed by one or more additional dosings of a second dosage amount that is the same as the first dosage amount. In some aspects, a dosing regimen is associated with a desired or beneficial outcome when administered across a relevant population (e.g., is a therapeutic dosing regimen).

[0191] II. Varicella Zoster Virus (VZV)

[0192] The present disclosure provides an RNA molecule (e.g., an RNA polynucleotide) comprising at least one open reading frame encoding a varicella zoster virus (VZV) polypeptide. The present disclosure further provides an immunogenic composition comprising at least one RNA molecule encoding a VZV polypeptide, the at least one RNA molecule complexed with, encapsulated in, or formulated with one or more lipids and forming a lipid nanoparticle (LNP).

[0193] Varicella zoster virus (VZV), also known as human herpes virus 3 (HHV-3), is a human pathogen that causes varicella or chickenpox in children and later recurs as herpes zoster or shingles. VZV has an inner capsid that encloses a linear, double-stranded DNA genome. Surrounding the capsid is an outer tegument layer with glycoproteins, and the outermost layer is a lipid-rich envelope with glycoproteins. Glycoproteins have multiple functions, from DNA replication or capsid assembly to interacting with cell surface molecules and aiding fusion into the plasma membrane. For example, glycoprotein E is an integral membrane protein that is thought to be important for viral T cell infection and intercellular spread. VZV shows tropism for neurons and T cells.

[0194] After primary infection with VZV (e.g., varicella or "chickenpox"), VZV establishes latency in sensory ganglia. VZV-specific T cells are needed to clear the primary infection and prevent reactivation. The mechanism of reactivation is unknown, but VZV cell-mediated immunity is thought to play a role. Lack of cell-mediated immunity (e.g., advanced age, immunocompromised conditions) is a risk factor for reactivation. Reactivation causes VZV replication and transport to the skin, which can manifest as herpes zoster (HZ).

[0195] Herpes zoster most commonly presents as a unilateral vesicular skin rash accompanied by pain, which is usually limited to one dermatome or to several contiguous dermatomes. Within days of the rash's onset, clusters of vesicles, bullae, or pustules can appear; these lesion sites contain VZV and are considered contagious. Characteristic pain of herpes zoster includes a burning or numbing, itching, or aching pain. Many people experience prodromal pain 2 to 3 days before the rash appears. In immunocompetent individuals, the lesions crust over within 7 to 10 days and are no longer contagious after crusting.

[0196] The most common complication of herpes zoster is postherpetic neuralgia (PHN), and up to 15% of individuals with herpes zoster develop PHN. PHN is a significant pain in the area affected by herpes zoster after the rash has crusted over. Older age and prodromal symptoms are considered risk factors for PHN. Other complications of herpes zoster include ocular complications (ocular herpes zoster or herpes zoster keratitis, acute retinal necrosis), neurological complications (otic herpes zoster, meningitis, encephalitis, myelitis, peripheral motor neuropathy, Guillan-Barre syndrome, and stroke), and secondary bacterial skin and soft tissue infections.

[0197] The VZV genome encodes at least 71 unique proteins (ORFs 0 to 68) and three additional open reading frames (ORFs 69 to 71) that replicate earlier open reading frames (ORFs 64 to 62, respectively). The encoded proteins form the structure of the viral particle, including nine glycoproteins: ORF5 (gK), ORF9A (gN), ORF14 (gC), ORF31 (gB), ORF37 (gH), ORF50 (gM), ORF60 (gL), ORF67 (gl), and ORF68 (gE). The encoded glycoproteins gE, gl, gB, gH, gK, gL, gC, gN, and gM play a role in different stages of the viral replication cycle. The most abundant glycoprotein found in infected cells and in mature virions is glycoprotein E (gE, ORF 68), which is a major component of the virion envelope and is essential for viral replication. Glycoprotein I (gl, ORG 67) forms a complex with gE in infected cells, which facilitates the endocytosis of both glycoproteins and directs them to the trans-Golginetwork (TGN), where the final viral envelope is acquired. VZV gE is a 623 amino acid type I membrane protein encoded by open reading frame 68 (ORF68) and is the most abundant viral glycoprotein expressed on the surface of cells infected with VZV. Glycoprotein I (gl) is required for VZV encapsulation and efficient membrane fusion during VZV replication within the TGN. VZV gE and gl are found complexed together on the surface of infected host cells. Glycoprotein B (ORF 31), which binds to neutralizing antibodies, is the second most prevalent glycoprotein and is thought to play a role in viral entry. Glycoprotein H is thought to have a fusion function that facilitates intercellular spread of the virus. Antibodies to gE, gB, and gH are prevalent after natural infection and after vaccination and have been shown to neutralize viral activity in vitro. As used herein, the term "varicella zoster virus" or "VZV" is not limited to any particular strain or variant.

[0198] In some aspects, the RNA molecule comprises an open reading frame encoding a VZV antigen. In some aspects, the VZV antigen is a VZV polypeptide. In some aspects, the VZV polypeptide is a VZV glycoprotein (e.g., gK, gN, gC, gB, gH, gM, gL, gI, and gE) or a fragment or variant thereof. In some aspects, the RNA molecule encodes a VZV gK polypeptide, the RNA molecule encodes a VZV gN polypeptide, the RNA molecule encodes a VZV gC polypeptide, the RNA molecule encodes a VZV gB polypeptide, the RNA molecule encodes a VZV gH polypeptide, the RNA molecule encodes a VZV gM polypeptide, the RNA molecule encodes a VZV gL polypeptide, the RNA molecule encodes a VZV gI polypeptide, and / or the RNA molecule encodes a VZV gE polypeptide. In one aspect, the RNA molecule encodes a VZV gE polypeptide. In some aspects, the VZV polypeptide comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or more) VZV polypeptides.

[0199] In some aspects, the VZV polypeptide is a full-length VZV polypeptide. In some aspects, the VZV polypeptide is a truncated VZV polypeptide. In some aspects, the VZV polypeptide is a variant of a VZV polypeptide. In some aspects, the VZV polypeptide is a fragment of a VZV polypeptide.

[0200] In some aspects, the VZV polypeptide is a full-length gK polypeptide. In some aspects, the VZV polypeptide is a truncated VZV gK polypeptide. In some aspects, the VZV polypeptide is a variant of a VZV gK polypeptide. In some aspects, the VZV polypeptide is a fragment of a VZV gK polypeptide.

[0201] In some aspects, the VZV polypeptide is a full-length gN polypeptide. In some aspects, the VZV polypeptide is a truncated VZV gN polypeptide. In some aspects, the VZV polypeptide is a variant of a VZV gN polypeptide. In some aspects, the VZV polypeptide is a fragment of a VZV gN polypeptide.

[0202] In some aspects, the VZV polypeptide is a full-length gC polypeptide. In some aspects, the VZV polypeptide is a truncated VZV gC polypeptide. In some aspects, the VZV polypeptide is a variant of a VZV gC polypeptide. In some aspects, the VZV polypeptide is a fragment of a VZV gC polypeptide.

[0203] In some aspects, the VZV polypeptide is a full-length gB polypeptide. In some aspects, the VZV polypeptide is a truncated VZV gB polypeptide. In some aspects, the VZV polypeptide is a variant of a VZV gB polypeptide. In some aspects, the VZV polypeptide is a fragment of a VZV gB polypeptide.

[0204] In some aspects, the VZV polypeptide is a full-length gH polypeptide. In some aspects, the VZV polypeptide is a truncated VZV gH polypeptide. In some aspects, the VZV polypeptide is a variant of a VZV gH polypeptide. In some aspects, the VZV polypeptide is a fragment of a VZV gH polypeptide.

[0205] In some aspects, the VZV polypeptide is a full-length gM polypeptide. In some aspects, the VZV polypeptide is a truncated VZV gM polypeptide. In some aspects, the VZV polypeptide is a variant of a VZV gM polypeptide. In some aspects, the VZV polypeptide is a fragment of a VZV gM polypeptide.

[0206] In some aspects, the VZV polypeptide is a full-length gL polypeptide. In some aspects, the VZV polypeptide is a truncated VZV gL polypeptide. In some aspects, the VZV polypeptide is a variant of a VZV gL polypeptide. In some aspects, the VZV polypeptide is a fragment of a VZV gL polypeptide.

[0207] In some aspects, the VZV polypeptide is a full-length gI polypeptide. In some aspects, the VZV polypeptide is a truncated VZV gI polypeptide. In some aspects, the VZV polypeptide is a variant of a VZV gI polypeptide. In some aspects, the VZV polypeptide is a fragment of a VZV gI polypeptide.

[0208] In some aspects, the VZV polypeptide is a full-length gE polypeptide. In some aspects, the VZV polypeptide is a truncated VZV gE polypeptide. In some aspects, the VZV polypeptide is a variant of a VZV gE polypeptide. In some aspects, the VZV polypeptide is a fragment of a VZV gE polypeptide.

[0209] In some aspects, the VZV polypeptide comprises at least one mutation. In some aspects, the VZV polypeptide is a VZV gK polypeptide comprising at least one mutation. In some aspects, the VZV polypeptide is a VZV gN polypeptide comprising at least one mutation. In some aspects, the VZV polypeptide is a VZV gC polypeptide comprising at least one mutation. In some aspects, the VZV polypeptide is a VZV gB polypeptide comprising at least one mutation. In some aspects, the VZV polypeptide is a VZV gH polypeptide comprising at least one mutation. In some aspects, the VZV polypeptide is a VZV gM polypeptide comprising at least one mutation. In some aspects, the VZV polypeptide is a VZV gL polypeptide comprising at least one mutation. In some aspects, the VZV polypeptide is a VZV gI polypeptide comprising at least one mutation. In some aspects, the VZV polypeptide is a VZV gE polypeptide comprising at least one mutation.

[0210] In some aspects, the RNA molecule encodes a polypeptide comprising a VZV gB polypeptide, a VZV gC polypeptide, a VZV gE polypeptide, a VZV gH polypeptide, a VZV gI polypeptide, a VZV gK polypeptide, a VZV gL polypeptide, a VZV gM polypeptide, a VZV gN polypeptide, or a VZV gQ polypeptide, according to any of the following A VZV gE polypeptide of the amino acid sequence of any one of accession numbers AAG32558.1, ABE03086.1, AA K01047.1, Q9J3M8.1, AEW88548.1, AGY33616.1, AEW89124.1, AIT53150.1, CAA25033.1, NP_040190.1, AKG56356.1, AEW89412.1, ABF21714.1, ABF21714.1, AAT07749.1, AEW88764.1, AAG48520.1, and / or AEW88980.1, the respective sequences of which are incorporated herein by reference, or a fragment or variant thereof. In some aspects, the RNA molecule encodes a VZV gE polypeptide comprising an amino acid sequence according to A VZV gE polypeptide of the amino acid sequence of accession number AH009994.2 (ORF68), the sequence of which is incorporated herein by reference, or a fragment or variant thereof.

[0211] In some aspects, the RNA molecule encodes a VZV polypeptide of Table 1. In some aspects, the RNA molecule encodes a VZV gE polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 1-11, or a fragment or variant thereof. In some aspects, the VZV gE polypeptide can have at least, at most, exactly the following identity or the identity between any two of the following: 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% to any one of the amino acid sequences of Table 1, e.g., to any one of SEQ ID NOs: 1-11. In some aspects, the VZV gE polypeptide consists of any one of the amino acid sequences of Table 1, e.g., of any one of SEQ ID NOs: 1-11.

[0212] In some aspects, the RNA molecule sequence is transcribed from a DNA nucleic acid sequence (DNA polynucleotide) of Table 2. In some aspects, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence of any one of SEQ ID NOs: 12-145, or a fragment or variant thereof. In some aspects, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence that can have at least, at most, exactly the following identity, or the identity between any two of the following, to any one of the nucleic acid sequences of Table 2, e.g., to any one of SEQ ID NOs: 12-145: 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some aspects, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence consisting of any one of the nucleic acid sequences of Table 2, e.g., any one of SEQ ID NOs: 12-145.

[0213] In some aspects, the RNA molecule comprises an ORF comprising a RNA nucleic acid sequence (RNA polynucleotide) of Table 3. In some aspects, the RNA molecule comprises an ORF comprising a nucleic acid sequence of any one of SEQ ID NOs: 146-279, or a fragment or variant thereof. In some aspects, the RNA molecule comprises an ORF comprising a nucleic acid sequence that can have at least, at most, exactly the following identity, or the identity between any two of the following, to any one of the RNA nucleic acid sequences of Table 3, e.g., to any one of SEQ ID NOs: 146-279: 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some aspects, the RNA molecule comprises an ORF comprising a nucleic acid sequence consisting of any one of the RNA nucleic acid sequences of Table 3, e.g., any one of SEQ ID NOs: 146-279.

[0214] In some aspects, the RNA molecule comprises a stabilized RNA. In some aspects, the RNA molecule comprises at least one uridine substituted with a N1-methyl pseudouridine. In some aspects, the RNA molecule comprises a sequence in which all uridines have been substituted with N1-methyl pseudouridines (denoted as “”). In some aspects, the RNA molecule comprises an ORF comprising a nucleic acid sequence of any one of SEQ ID NOs: 146-279, in which all uridines have been substituted with N1-methyl pseudouridines (denoted as “”).

[0215] In some aspects, the RNA molecule comprises an open reading frame encoding a VZV polypeptide amino acid sequence that can have at least, at most, exactly, or between any two of the following identities to any one of the VZV polypeptide sequences of SEQ ID NOs: 1-11 (Table 1) or other VZV polypeptides described herein: 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some aspects, the RNA molecule comprises an open reading frame encoding a VZV polypeptide amino acid sequence that consists of any one of the VZV polypeptide sequences of SEQ ID NOs: 1-11 (Table 1) or other VZV polypeptides described herein.

[0216] In some aspects, the RNA molecule comprises an open reading frame transcribed from a DNA nucleic acid sequence that can have at least, at most, exactly, or between any two of the following identities to any one of the nucleic acid sequences of SEQ ID NOs: 12-145 (Table 2) or other nucleic acids described herein: 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some aspects, the RNA molecule comprises an open reading frame transcribed from a DNA nucleic acid sequence that consists of any one of the nucleic acid sequences of SEQ ID NOs: 12-145 (Table 2) or other nucleic acids described herein.

[0217] In some aspects, the RNA molecule comprises an open reading frame comprising a RNA nucleic acid sequence that can have at least, at most, exactly, or between any two of the following identities to any one of the nucleic acid sequences of SEQ ID NOs: 146-279 (Table 3) or other nucleic acids described herein: 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some aspects, the RNA molecule comprises an open reading frame comprising a RNA nucleic acid sequence that consists of any one of the nucleic acid sequences of SEQ ID NOs: 146-279 (Table 3) or other nucleic acids described herein. In some aspects, the RNA molecule comprises an ORF comprising the nucleic acid sequence of any one of SEQ ID NOs: 146-279 (Table 3), wherein all uridines have been substituted with N1-methyl pseudouridines (denoted as “Ψ”).

[0218] III. RNA molecules

[0219] In some aspects, the RNA molecules described herein are coding RNA molecules. Coding RNA includes functional RNA molecules that are translatable into a peptide or polypeptide. In some aspects, the coding RNA molecule includes at least one open reading frame (ORF) that encodes at least one peptide or polypeptide. An open reading frame contains a sequence of codons that are translatable into a peptide or protein. The coding RNA molecule can include one (monocistronic), two (bicistronic), or more (multicistronic) ORFs that can be a sequence of codons that are translatable into a polypeptide or protein of interest.

[0220] The coding RNA molecule can be a messenger RNA (mRNA) molecule, a viral RNA molecule, or a self-amplifying RNA molecule (saRNA, also known as a replicon). In some aspects, the RNA molecule is an mRNA. Preferably, the RNA molecule of the present disclosure is an mRNA. In some aspects, the RNA molecule is a saRNA. In some aspects, the saRNA molecule can be a coding RNA molecule.

[0221] The RNA molecule can encode one or more polypeptides of interest, such as one or more antigens, for example two, three, four, five, six, seven, eight, nine, ten, or more polypeptides. Alternatively or additionally, one RNA molecule can also encode more than one polypeptide of interest, such as an antigen, for example a bicistronic or tricistronic RNA molecule encoding different or the same antigens.

[0222] The sequence of the RNA molecule can be codon-optimized or de-optimized for expression in a desired host, such as a human cell. In some aspects, the gene of interest described herein (e.g., an antigen) is encoded by a coding sequence that is codon-optimized and / or has an increased guanosine / cytidine (G / C) content compared to the wild-type coding sequence. In some aspects, one or more sequence regions of the coding sequence are codon-optimized and / or have an increased G / C content compared to the corresponding sequence region of the wild-type coding sequence. In some aspects, the codon-optimization and / or the increased G / C content do not change the sequence of the encoded amino acid sequence.

[0223] As will be appreciated by those skilled in the art, the term “codon-optimization” refers to the alteration of codons in the coding region of a nucleic acid molecule that reflects the typical codon usage of the host organism without changing the amino acid sequence encoded by the nucleic acid molecule. Within the context of the present disclosure, in some aspects, the coding region is codon-optimized for optimal expression in the subject to be treated with the RNA polynucleotides described herein. Codon-optimization is based on the finding that the efficiency of translation is also determined by the different frequencies of occurrence of tRNA molecules in the cell. Thus, the sequence of the RNA can be modified such that codons of frequently occurring tRNA molecules are inserted in place of “rare codons”.

[0224] In some aspects, the G / C content of the coding region (e.g., the gene sequence of interest; open reading frame (ORF)) of the RNA is increased compared to the G / C content of the corresponding coding sequence of the wild-type RNA encoding the gene of interest, where in some aspects the amino acid sequence encoded by the RNA is not modified compared to the amino acid sequence encoded by the wild-type RNA. This modification of the RNA sequence is based on the fact that the sequence of any RNA region to be translated is important for the efficient translation of the mRNA. Sequences with increased G (guanosine) / C (cytidine) content are more stable compared to sequences with increased A (adenosine) / U (uridine) content. In view of the fact that several codons code for the same amino acid (so-called genetic code degeneracy), the codons that are most favorable for stability can be determined (so-called alternative codon usage). Depending on the amino acid encoded by the RNA, there are various possibilities for the modification of the RNA sequence compared to its wild-type sequence. In particular, codons containing A and / or U nucleosides can be modified by substituting these codons with other codons that encode the same amino acid but do not contain A and / or U or contain a lower content of A and / or U nucleosides. Thus, in some aspects, the G / C content of the coding region of the RNA described herein is increased by at least, at most, exactly, or a percentage between any two of the following percentages: 10%, 20%, 30%, 40%, 50%, 55%, or even more, compared to the G / C content of the coding region of the wild-type RNA. In some aspects, the coding region of the VZV RNA described herein comprises a G / C content of at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or about 80%. In some aspects, the coding region of the VZV RNA described herein comprises a G / C content of about 50% to 75%, about 55% to 70%, about 50% to 60%, about 60% to 70%, about 70% to 80%, about 50% to 55%, about 55% to 60%, about 60% to 65%, about 65% to 70%, about 70% to 75%, or about 75% to 80%. In some aspects, the coding region of the VZV RNA described herein comprises a G / C content of about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, or about 75%. In some aspects, the coding region of the VZV RNA described herein comprises a G / C content of about 58%, about 66%, or about 62%.

[0225] In some aspects, the RNA molecule comprises about 20 to about 100,000 nucleotides (e.g., 30 to 50, 30 to 100, 30 to 250, 30 to 500, 30 to 1,000, 30 to 1,500, 30 to 3,000, 30 to 5,000, 30 to 7,000, 30 to 10,000, 30 to 25,000, 30 to 50,000, 30 to 70,000, 100 to 250, 100 to 500, 100 to 1,000, 100 to 1,500, 100 to 3,000, 100 to 5,000, 100 to 7,000, 100 to 10,000, 100 to 25,000, 100 to 50,000, 100 to 70,000, 100 to 100,000, 500 to 1,000, 500 to 1,500, 500 to 2,000, 500 to 3,000, 500 to 5,000, 500 to 7,000, 500 to 10,000, 500 to 25,000, 500 to 50,000, 500 to 70,000, 500 to 100,000, 1,000 to 1,500, 1,000 to 2,000, 1,000 to 3,000, 1,000 to 5,000, 1,000 to 7,000, 1,000 to 10,000, 1,000 to 25,000, 1,000 to 50,000, 1,000 to 70,000, 1,000 to 100,000, 1,500 to 3,000, 1,500 to 5,000, 1,500 to 7,000, 1,500 to 10,000, 1,500 to 25,000, 1,500 to 50,000, 1,500 to 70,000, 1,500 to 100,000, 2,000 to 3,000, 2,000 to 5,000, 2,000 to 7,000, 2,000 to 10,000, 2,000 to 25,000, 2,000 to 50,000, 2,000 to 70,000, and 2,000 to 100,000 nucleotides).

[0226] In some aspects, the RNA molecule has at least, at most, exactly, or a number of nucleotides between any two of the following: about 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000, 9200, 9400, 9600, 9800, or 100000 nucleotides.

[0227] In some aspects, the RNA molecule comprises at least 100 nucleotides. For example, in some aspects, the RNA is between 100 and 15,000 nucleotides in length; between 7,000 and 16,000 nucleotides; between 8,000 and 15,000 nucleotides; between 9,000 and 12,500 nucleotides; between 11,000 and 15,000 nucleotides; between 13,000 and 16,000 nucleotides; between 7,000 and 25,000 nucleotides. In some aspects, the RNA molecule has at least, at most, exactly, or a number of nucleotides between any two of the following: about 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, 3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700, 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950, 5000, 5050, 5100, 5150, 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 5950, 6000, 6050, 6100, 6150, 6200, 6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000, 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450, 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850, 7900, 7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700, 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550, 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950, 10,000, 10,050, 10,100, 10,150, 10,200, 10,250, 10,300, 10,350, 10,400, 10,450, 10,500, 10,550, 10,600, 10,650, 10,700, 10,750, 10,800, 10,850, 10,900, 10,950, 11,000, 11,050, 11,100, 11,150, 11,200, 11,250, 11,300, 11,350, 11,400, 11,450, 11,500, 11,550, 11,600, 11,650, 11,700, 11,750, 11,800, 11,850, 11,900, 11,950, 12,000, 12,050, 12,100, 12,150, 12,200, 12,250, 12,300, 12,350, 12,400, 12,450, 12,500, 12,550, 12,600, 12,650, 12,700, 12,750, 12,800, 12,850, 12,900, 12,950, 13,000, 13,050, 13,100, 13,150, 13,200, 13,250, 13,300, 13,350, 13,400, 13,450, 13,500, 13,550, 13,600, 13,650, 13,700, 13,750, 13,800, 13,850, 13,900, 13,950, 14,000, 14,050, 14,100, 14,150, 14,200, 14,250, 14,300, 14,350, 14,400, 14,450, 14,500, 14,550, 14,600, 14,650, 14,700, 14,750, 14,800, 14,850, 14,900, 14,950, 15,000, 15,050, 15,100, 15,150, 15,200, 15,250, 15,300, 15,350, 15,400, 15,450, 15,500, 15,550, 15,600, 15,650, 15,700, 15,750, 15,800, 15,850, 15,900, 15,950, 16,000, 16,050, 16,100, 16,150, 16,200, 16,250, 16,300, 16,350, 16,400, 16,450, 16,500, 16,550, 16,600, 16,650, 16,700, 16,750, 16,800, 16,850, 16,900, 16,950, 17,000, 17,050, 17,100, 17,150, 17,200, 17,250, 17,300, 17,350, 17,400, 17,450, 17,500, 17,550, 17,600, 17,650, 17,700, 17,750, 17,800, 17,850, 17,900, 17,950, 18,000, 18,050, 18,100, 18,150, 18,200, 18,250, 18,300, 18,350, 18,400, 18,450, 18,500, 18,550, 18,600, 18,650, 18,700, 18,750, 18,800, 18,850, 18,900, 18,950, 19,000, 19,050, 19,100, 19,150, 19,200, 19,250, 19,300, 19,350, 19,400, 19,450, 19,500, 19,550, 19,600, 19,650, 19,700, 19,750, 19,800, 19,850, 19,900, 19,950, 20,000, 20,050, 20,100, 20,150, 20,200, 20,250, 20,300, 20,350, 20,400, 20,450, 20,500, 20,550, 20,600, 20,650, 20,700, 20,750, 20,800, 20,850, 20,900, 20,950, 21,000, 21,050, 21,100, 21,1508000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700, 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550, 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950, 10000, 10050, 10100, 10150, 10200, 10250, 10300, 10350, 10400, 10450, 10500, 10550, 10600, 10650, 10700, 10750, 10800, 10850, 10900, 10950, 11000, 11050, 11100, 11150, 11200, 11250, 11300, 11350, 11400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, 13000, 13050, 13100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000 nucleotides.

[0228] In some aspects of the disclosure, the RNA is or comprises messenger RNA (mRNA) that is associated with an RNA transcript that encodes a polypeptide. In some aspects, the RNA disclosed herein comprises: a 5' cap comprising a 5' cap disclosed herein; a 5' untranslated region comprising a cap proximal sequence (5' UTR), that is, a sequence that encodes a protein (e.g., a polypeptide); a 3' untranslated region (3' UTR); and / or a polyadenylate (poly-A) sequence.

[0229] In some aspects, the RNA disclosed herein comprises, in the 5' to 3' direction, the following components: a 5' cap comprising a 5' cap disclosed herein; a 5' untranslated region comprising a cap proximal sequence (5' UTR), i.e., a sequence encoding a protein (e.g., polypeptide); a 3' untranslated region (3' UTR); and a poly-A sequence.

[0230] A. Modified Nucleobases

[0231] In the present disclosure, RNA molecules can comprise modified nucleobases, which can be incorporated into modified nucleosides and nucleotides. In some aspects, the RNA molecule can include one or more modified nucleotides. Naturally occurring nucleotide modifications are known in the art.

[0232] In some aspects, the RNA molecule can include modified nucleotides.Non-limiting examples of modified nucleotides that can be included in the RNA molecule include pseudouridine, N1-methylpseudouridine, 5-methyluridine, 3-methyl-uridine, 5-methoxy-uridine, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5- aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 1-ethyl-pseudouridine, 5- methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5- carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5- carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl- pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-2- thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl- 1-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2- thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6- dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3- amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio- uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O-methyl- pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl- uridine, 5-carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl- 2'-O-methyl-uridine, 3,2'-O-dimethyl-uridine, 5-(isopentenylaminomethyl)-2'-O- methyl-uridine, 1-thio-uridine, deoxythymidine, 2'-F-arabinouridine, 2'-F-uridine, 2'-OH-arabinouridine, 5-(2-methoxycarbonylvinyl)uridine, 5-[3-(1-E- propenylamino)uridine, any other modified uridine known in the art, or combinations thereof.

[0233] In some aspects of the disclosure, the modified nucleotides comprise any of N1-methyl pseudouridine or pseudouridine.

[0234] In some aspects, the RNA molecule comprises nucleotides modified with N1-methyl pseudouridine. In some aspects, the RNA molecule comprises nucleotides modified with pseudouridine.

[0235] In some aspects, at least one uridine of the RNA is replaced by a modified nucleoside. In some aspects, every uridine of the RNA is replaced by a modified nucleoside. In some aspects, the RNA molecule comprises at least one sequence in which uridines are replaced by N1-methyl pseudouridines. In some aspects, the RNA molecule comprises a sequence in which all uridines are replaced by N1-methyl pseudouridines. N1-methyl pseudouridine is represented in a sequence as “Ψ”. As used herein, the term “uracil” describes one kind of nucleobase that can occur in a nucleic acid of an RNA. As used herein, the term “uridine” describes one kind of nucleoside that can occur in an RNA. “Pseudouridine” is one example of a modified nucleoside that is an isomer of uridine in which the uracil is connected to the pentose ring via a carbon-carbon bond rather than a nitrogen-carbon glycosidic bond.

[0236] In some aspects, the RNA molecule comprises at least one nucleic acid sequence in which uridines are replaced by N1-methyl pseudouridines or pseudouridines. In some aspects, the RNA molecule comprises a nucleic acid sequence in which at least, at most, exactly, or a percentage between any two of the following percentages of uridines are replaced by N1-methyl pseudouridines or pseudouridines: 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some aspects, the RNA molecule comprises a nucleic acid sequence in which all uridines are replaced by N1-methyl pseudouridines or pseudouridines.

[0237] Modifications that can be present in an RNA molecule further include, for example: m5C (5-methylcytidine), m5U (5-methyluridine), m6A (N6-methyladenosine), s2U (2-thiouridine), Um (2'-O-methyluridine), mlA (1-methyladenosine); m2A (2-methyladenosine); Am (2-1-O-methyladenosine); ms2m6A (2-methylthio-N6-methyladenosine); i6A (N6-isopentenyladenosine); ms2i6A (2-methylthio-N6isopentenyladenosine); io6A (N6-(cis-hydroxyisopentenyl)adenosine); ms2io6A (2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine); g6A (N6-glycolylcarbamoyladenosine); t6A (N6-threonylcarbamoyladenosine); ms2t6A (2-methylthio-N6-threonylcarbamoyladenosine); m6t6A (N6-methyl-N6-threonylcarbamoyladenosine); hn6A (N6-hydroxynorvalylcarbamoyladenosine); ms2hn6A (2-methylthio-N6-hydroxynorvalylcarbamoyladenosine); Ar(p) (2'-O-ribosyladenosine (phosphate)); I (inosine); mil (1-methylinosine); m'lm (1,2'-O-dimethylinosine); m3C (3-methylcytidine); Cm (2T-O-methylcytidine); s2C (2-thiocytidine); ac4C (N4-acetylcytidine); f5C (5-formylcytosine); m5Cm (5,2-O-dimethylcytidine); ac4Cm (N4acetyl 2TO methylcytidine); k2C (lysidine); mlG (1-methylguanosine); m2G (N2-methylguanosine); m7G (7-methylguanosine); Gm (2'-O-methylguanosine); m22G (N2,N2-dimethylguanosine); m2Gm (N2,2'-O-dimethylguanosine); m22Gm (N2,N2,2'-O-trimethylguanosine); Gr(p) (2'-O-ribosylguanosine (phosphate)); yW (wybutosine); o2yW (peroxy wybutosine); OHyW (hydroxywybutosine); OHyW* (hypomodified hydroxywybutosine); imG (wyosine); mimG (methylguanosine); Q (queuosine); oQ (epoxy queuosine); galQ (galactosyl-queuosine); manQ (mannosyl-queuosine); preQo (7-cyano-7-deazaguanosine); preQi (7-aminomethyl-7-deazaguanosine); G* (gulosine); D (dihydrouridine); m5Um (5,2'-O-dimethyluridine); s4U (4-thiouridine); m5s2U (5-methyl-2-thiouridine); s2Um (2-thio-2'-O-methyluridine); acp3U (3-(3-amino-3-carboxypropyl)uridine);ho5U (5-hydroxyuridine); mo5U (5-methoxyuridine); cmo5U (uridine 5-oxyacetic acid); mcmo5U (uridine 5-oxyacetic acid methyl ester); chm5U (5-(carboxyhydroxymethyl)uridine)); mchm5U (5-(carboxyhydroxymethyl)uridine methyl ester); mcm5U (5-methoxycarbonylmethyluridine); mcm5Um (5-methoxycarbonylmethyl-2-O-methyluridine); mcm5s2U (5-methoxycarbonylmethyl-2-thiouridine); nm5s2U (5-aminomethyl-2-thiouridine); mnm5U (5-methylaminomethyluridine); mnm5s2U (5-methylaminomethyl-2-thiouridine); mnm5se2U (5-methylaminomethyl-2-selenouridine); ncm5U (5-carbamoylmethyluridine); ncm5Um (5-carbamoylmethyl-2'-O-methyluridine); cmnm5U (5-carboxymethylaminomethyluridine); cnmm5Um (5-carboxymethylaminomethyl-2'-O-methyluridine); cmnm5s2U (5-carboxymethylaminomethyl-2-thiouridine); m62A (N6,N6-dimethyladenosine); Tm (2'-O-methylinosine); m4C (N4-methylcytidine); m4Cm (N4,2-O-dimethylcytidine); hm5C (5-hydroxymethylcytidine); m3U (3-methyluridine); cm5U (5-carboxymethyluridine); m6Am (N6,T-O-dimethyladenosine); rn62Am (N6,N6,O-2-trimethyladenosine); m2'7G (N2,7-dimethylguanosine); m2'2'7G (N2,N2,7-trimethylguanosine); m3Um (3,2T-O-dimethyluridine); m5D (5-methyldihydrouridine); f5Cm (5-formyl-2'-O-methylcytidine); m1Gm (1,2'-O-dimethylguanosine); m'Am (1,2-O-dimethyladenosine) irinomethyluridine); tm5s2U (S-taurinomethyl-2-thiouridine)); imG-14 (4-demethylguanosine); imG2 (isoguanosine);ac6A (N6-acetyladenosine), hypoxanthine, inosine, 8-oxo-adenine, 7-substituted derivatives thereof, dihydrouracil, pseudouracil, 2-thiouracil, 4-thiouracil, 5- aminouracil, 5-(Ci-C6)alkyluracil, 5-methyluracil, 5-(C2-C6)alkenyluracil, 5-(C2-C6)alkynyluracil, 5-(hydroxymethyl)uracil, 5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine, 5-(Ci-C6)alkylcytosine, 5-methylcytosine, 5-(C2-C6)alkenylcytosine, 5-(C2-C6)alkynylcytosine, 5-chlorocytosine, 5-fluorocytosine, 5-bromocytosine, N2-dimethylguanine, 7-deazaguanine, 8-azaguanine, 7-deaza-7-substituted guanine, 7-deaza-7-(C2-C6)alkynylguanine, 7-deaza-8-substituted guanine, 8-hydroxyguanine, 6-thioguanine, 8-oxoguanine, 2-aminopurine, 2-amino-6-chloropurine, 2,4-diaminopurine, 2,6-diaminopurine, 8-azapurine, substituted 7-deazapurine, 7-deaza-7-substituted purine, 7-deaza-8-substituted purine, hydrogen (no base residue), m5C, m5U, m6A, s2U, W, or 2'-0-methyl-U.

[0238] In some aspects, the RNA molecule can include phosphoramidate, phosphorothioate, and / or methylphosphonate linkages.

[0239] The sequence of the RNA molecule can be modified as desired, for example, to increase the expression or replication efficacy of the RNA, or to provide additional stability or resistance to degradation. For example, the RNA sequence can be modified with respect to its codon usage, for example, to increase the translation efficacy and half-life of the RNA.

[0240] In some aspects, the RNA molecule of the present disclosure comprises an open reading frame having a sequence that is modified at at least one codon. The codon-modified sequence is a coding sequence that differs from the corresponding wild-type coding sequence at at least one codon (nucleotide triplet that encodes one amino acid). The codon-modified sequence can exhibit improved resistance to degradation, improved stability, and / or improved translatability.

[0241] The sequence of the RNA molecule can be codon-optimized or de-optimized for expression in a desired host, such as a human cell.

[0242] In some aspects, the RNA molecule can include one or more structural and / or chemical modifications or alterations that confer a suitable property on the polynucleotide, in some aspects, such suitable property includes a lack of substantial induction of an innate immune response of a cell into which the polynucleotide is introduced. As used herein, a "structural" feature or modification is a modification of two or more linked nucleotides that is an insertion, deletion, duplication, inversion, or randomization of the nucleotides in the RNA molecule without a significant chemical modification of the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, a structural modification is chemical in nature and thus is a chemical modification. However, a structural modification will result in a different nucleotide sequence. For example, a polynucleotide "ATCG" can be chemically modified to "AT-5meC-G". The same polynucleotide can be structurally modified from "ATCG" to "ATCCCG". Here, a dinucleotide "CC" has been inserted, resulting in a structural modification of the polynucleotide.

[0243] In some aspects, the RNA molecule can include one or more modified nucleotides in addition to any 5' cap structure. Naturally occurring nucleotide modifications are known in the art.

[0244] In some aspects, the RNA molecule does not include a modified nucleotide, e.g., does not include a modified nucleobase, in addition to an optional 5' cap that can include, e.g., 7-methylguanosine (further described below), and all of the nucleotides in the RNA molecule are conventional standard ribonucleotides A, U, G, and C. In some aspects, the RNA can include a 5' cap that includes 7'-methylguanosine, and the first 1, 2, or 3 5' ribonucleotides can be methylated at the 2' position of the ribose.

[0245] In some aspects, the RNA molecules described herein are non-coding RNA molecules. Non-coding RNA (ncRNA) molecules include functional RNA molecules that are not translated into a peptide or polypeptide. Non-coding RNA molecules can include highly abundant and functionally important RNA molecules. In some aspects, the non-coding RNA is a functional mRNA molecule that is not translated into a peptide or polypeptide. The non-coding RNA can include modified nucleotides as described herein. Preferably, the RNA molecule is an mRNA.

[0246] The RNA molecules of the present disclosure can be prepared by any method known in the art, including chemical synthesis and in vitro methods, such as RNA in vitro transcription. In some aspects, the RNA of the present disclosure is prepared using in vitro transcription.

[0247] In some aspects, the RNA molecules of the present disclosure are purified, e.g., such as by filtration, which can be via, e.g., ultrafiltration, diafiltration, or, e.g., tangential flow ultrafiltration / diafiltration.

[0248] In some aspects, the RNA molecules of the present disclosure are lyophilized to be temperature stable.

[0249] B. 5' Cap

[0250] In some aspects, the RNA molecules described herein include a 5' cap, which generally "caps" the 5' end of the RNA and stabilizes the RNA molecule.

[0251] In some aspects, the 5' cap moiety is a natural 5' cap. A "natural 5' cap" is defined to include a cap of 7-methylguanosine linked to the 5' end of the mRNA molecule via a 5' to 5' triphosphate linkage. In some aspects, the guanosine nucleoside included in the 5' cap can be modified, for example, by methylation at one or more positions on the base (guanine), for example, at the 7 position, and / or by methylation at one or more positions on the ribose. In some aspects, the guanosine nucleoside included in the 5' cap comprises 3' O methylation at the ribose (3'OMeG). In some aspects, the guanosine nucleoside included in the 5' cap comprises methylation at the 7 position of the guanine (m7G). In some aspects, the guanosine nucleoside included in the 5' cap comprises methylation at the 7 position of the guanine and 3' O methylation at the ribose (m7(3'OMeG)). The 5' cap can be incorporated during RNA synthesis (e.g., co-transcriptional capping), or can be enzymatically engineered after RNA transcription (e.g., post-transcriptional capping). In some aspects, co-transcriptional capping with a cap disclosed herein increases the efficiency of capping of the RNA compared to co-transcriptional capping with an appropriate reference comparator. In some aspects, increasing the efficiency of capping can increase the efficiency and / or rate of translation of the RNA, and / or increase the expression of the encoded polypeptide. In some aspects, capping is performed after purification of the RNA molecule (e.g., tangential flow filtration).

[0252] In some aspects, the RNA described herein comprises a 5' cap or 5' cap analog, such as Cap 0, Cap 1, or Cap 2. In some aspects, the provided RNA does not have an uncapped 5'- triphosphate. In some aspects, the 5' end of the RNA is capped with a modified ribonucleotide. In some aspects, the 5' cap moiety is a 5' cap analog. In some aspects, the RNA can be capped with a 5' cap analog. Cap structures include, but are not limited to, 7mG(5')ppp(5')N, pN2p (Cap 0), and 7mG(5')ppp(5')N1mpNp (Cap 1). In some aspects, the RNA described herein comprises Cap 0. Cap 0 is an N7-methylguanosine linked to the 5' nucleotide via a 5' to 5' triphosphate bond, which is commonly referred to as a m7G cap or m7Gppp. In cells, the Cap 0 structure is critical for efficient translation of the cap-bearing mRNA. An additional methylation on the 2' O position of the initiating nucleotide results in Cap 1, or is referred to as m7GpppNm, where Nm represents any nucleotide with 2' O methylation. In some aspects, the RNA described herein comprises Cap 1, for example as described herein. In some aspects, the RNA described herein comprises Cap 2.

[0253] In some aspects, the Cap 0 structure comprises a guanosine nucleoside methylated at the 7 position of the guanine (m7G). In some aspects, the Cap 0 structure is linked to the RNA via a 5' to 5' triphosphate bond, and is also referred to herein as m7Gppp or m7G(5')ppp(5'). The 5' cap can be methylated with the structure m7G(5')ppp(5')N (Cap 0 structure) or derivatives thereof, where N is the terminal 5' nucleotide of the nucleic acid bearing the 5' cap, typically the 5' end of an mRNA. An exemplary enzymatic reaction for capping can include the use of a Vaccinia virus capping enzyme (VCE) comprising mRNA triphosphatase, guanylyltransferase, and guanine-7-methyltransferase, which catalyzes the construction of N7-monomethylated Cap 0 structures. The Cap 0 structure plays an important role in maintaining the stability and translational efficacy of the RNA molecule.

[0254] The 5' cap of an RNA molecule can be further modified by a 2'-O-methyltransferase that results in the production of a Cap 1 structure (m7Gppp[m2'-O]N) that can further increase translation efficacy. In some aspects, the Cap 1 structure comprises a guanosine nucleoside methylated at the 7 position of the guanine (m7G) and a first nucleotide 2' O-methylated in the RNA (2'OMeN1). In some aspects, the Cap 1 structure is linked to the RNA via a 5' to 5' triphosphate bond and is also referred to herein as m7Gppp(2'OMeN1) or m7G(5')ppp(5')(2'OMeN1). In some aspects, N1 is selected from A, C, G, or U. In some aspects, N1 is A. In some aspects, N1 is C. In some aspects, N1 is G. In some aspects, N1 is U. In some aspects, the m7G(5')ppp(5')(2'OMeN1) Cap 1 structure comprises a second nucleotide N2, which is the cap proximal nucleotide at position 2 and is selected from A, G, C, or U (m7G(5')ppp(5')(2'OMeN1)N2). In some aspects, N2 is A. In some aspects, N2 is C. In some aspects, N2 is G. In some aspects, N2 is U.

[0255] In some aspects, the Cap 1 structure comprises a guanosine nucleoside methylated at the 7 position of the guanine (m7G) and one or more additional modifications (e.g., methylation on the ribose) and a first nucleotide 2' O-methylated in the RNA. In some aspects, the Cap 1 structure comprises a guanosine nucleoside methylated at the 7 position of the guanine, 3' O-methylation at the ribose (m7(3'OMeG)), and a first nucleotide 2' O-methylated in the RNA (2'OMeN1). In some aspects, the Cap 1 structure is linked to the RNA via a 5' to 5' triphosphate bond and is also referred to herein as m7(3'OMeG)ppp(2'OMeN1) or m7(3'OMeG)(5')ppp(5')(2'OMeN1). In some aspects, N1 is selected from A, C, G, or U. In some aspects, N1 is A. In some aspects, N1 is C. In some aspects, N1 is G. In some aspects, N1 is U. In some aspects, the m7(3'OMeG)(5')ppp(5')(2'OMeN1) Cap 1 structure comprises a second nucleotide N2, which is the cap proximal nucleotide at position 2 and is selected from A, G, C, or U (m7(3'OMeG)(5')ppp(5')(2'OMeN1)N2). In some aspects, N2 is A. In some aspects, N2 is C. In some aspects, N2 is G. In some aspects, N2 is U.

[0256] In some aspects, the second nucleotide in the Cap 1 structure can comprise one or more modifications, e.g., methylation. In some aspects, a Cap 1 structure comprising a second nucleotide comprising 2' O-methylation is a Cap 2 structure.

[0257] In some aspects, the RNA molecule can be enzymatically capped at the 5' end using vaccinia guanylyltransferase, guanosine triphosphate, and S-adenosyl-L-methionine to give a Cap 0 structure. A reversed 7-methylguanosine cap is added via a 5' to 5' triphosphate bridge. Alternatively, a Cap 1 structure is obtained using a 2'0-methyltransferase with vaccinia guanylyltransferase, in which, in addition to the Cap 0 structure, the 2' OH group on the penultimate nucleotide is methylated. S-adenosyl-L-methionine (SAM) is a cofactor used as a methyltransfer reagent. Non-limiting examples of 5' cap structures are those that have enhanced binding of cap-binding polypeptides, increased half-life, decreased sensitivity to 5' endonucleases, and / or reduced 5' decapping compared to synthetic 5' cap structures (or wild-type, native, or physiological 5' cap structures) known in the art.

[0258] For example, a recombinant vaccinia virus capping enzyme and a recombinant 2'-0- methyltransferase can create a canonical 5'-5' triphosphate bond between the 5' terminal nucleotide of the mRNA and a guanine cap nucleotide, where the cap guanine includes N7 methylation and the 5' terminal nucleotide of the mRNA includes 2'-0-methylation. Such a structure is referred to as a Cap 1 structure. This cap results in higher translational capacity and cellular stability and reduced activation of cellular proinflammatory cytokines compared to, for example, other 5' cap analog structures known in the art.

[0259] In some aspects, the 5' end cap includes a cap analog, for example, the 5' end cap can include a guanine analog. Exemplary guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0260] In some aspects, the capping region can comprise a single cap or a series of nucleotides forming a cap. In this aspect, the length of the capping region can be from 1 to 10, e.g., 2 to 9, 3 to 8, 4 to 7, 1 to 5, 5 to 10, or at least 2, or 10 or fewer nucleotides. In this aspect, the length of the capping region is at least, at most, exactly, or between any two of the following number of nucleotides: 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some aspects, there is no cap. In some aspects, the length of the first and second operational regions can range from 3 to 40 nucleotides, e.g., 5 to 30, 10 to 20, 15, or at least 4, or 30 or fewer nucleotides; and can also comprise one or more signal and / or restriction sequences in addition to the start and / or stop codons. In some aspects, the length of the first and second operational regions is at least, at most, exactly, or between any two of the following number of nucleotides: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40; and can also comprise one or more signal and / or restriction sequences in addition to the start and / or stop codons.

[0261] Other examples of 5' cap structures include, but are not limited to, glyceryl, inverted deoxy abasic residue (moieties), 4',5' methylene nucleotides, 1-(beta-D-erythrofuranosyl) nucleotides, 4'-thio nucleotides, carbocyclic nucleotides, 1,5-anhydrohexitol nucleotides, L-nucleotides, alpha- nucleotides, modified base nucleotides, threo-pentofuranosyl nucleotides, acyclic 3',4'-seco nucleotides, acyclic 3,4-dihydroxybutyl nucleotides, acyclic 3,5 dihydroxypentyl nucleotides, 3'-3' inverted nucleotide moieties, 3'-3' inverted abasic moieties, 3'-2' inverted nucleotide moieties, 3'-2' inverted abasic moieties, 1,4-butanediol phosphate, 3'-aminophosphates, hexyl phosphate, amino hexyl phosphate, 3'-phosphates, 3' thiophosphates, dithiophosphates, or bridged or non-bridged methylphosphonate moieties.

[0262] In some aspects, the RNA molecules of the present disclosure comprise at least one 5' cap structure. In some aspects, the RNA molecules of the present disclosure do not comprise a 5' cap structure.

[0263] In one aspect, the 5' capping structure comprises a modified 5' cap 1 structure (m 7 G + m 3’-5'-ppp-5'-A). In one aspect, the 5' cap structure comprises (3'OMe)-m2 7,3’-O Gppp(m1 2’-O )ApG (TriLink BioTechnologies). This molecule is consistent with the natural RNA cap structure because it begins with a guanosine that is methylated at N7 and is linked to the first encoded nucleotide of the transcribed RNA (in this case, an adenosine) by a 5' to 5' triphosphate linkage. This guanosine is also methylated at the 3' hydroxyl of the ribose to mitigate possible reverse incorporation of the cap molecule. The 2' hydroxyl of the ribose on the adenosine is methylated, conferring a cap 1 structure.

[0264] C. Untranslated Regions (UTRs)

[0265] A 5' UTR is a regulatory region located at the 5' end of a protein open reading frame that is transcribed into mRNA but not translated into an amino acid sequence or the corresponding region in an RNA polynucleotide, such as an mRNA molecule. Untranslated regions (UTRs) can be present at the 5' end (upstream) of an open reading frame (5' UTR) and / or the 3' end (downstream) of an open reading frame (3' UTR).

[0266] In some aspects, the UTRs are derived from mRNA that is naturally abundant in the particular tissue targeted for mRNA expression (e.g., lymphoid tissue). In some aspects, the UTRs increase protein synthesis. Without being bound by mechanism or theory, the UTRs can increase protein synthesis by increasing the time mRNA is retained in the translating ribosome (messenger stability) and / or the rate at which the ribosome initiates translation based on the messenger (messenger translation efficiency). Thus, the UTR sequences can prolong protein synthesis in a tissue-specific manner.

[0267] In some aspects, the 5' UTR and 3' UTR sequences are computationally derived. In some aspects, the 5' UTR and 3' UTR are derived from mRNA that is naturally abundant in a tissue. The tissue can be, for example, liver, stem cell, or lymphoid tissue. Lymphoid tissue can include, for example, any of lymphocytes (e.g., B lymphocytes, helper T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, or natural killer cells), macrophages, monocytes, dendritic cells, neutrophils, eosinophils, and reticular red blood cells. In some aspects, the 5' UTR and 3' UTR are derived from an alphavirus. In some aspects, the 5' UTR and 3' UTR are from a wild-type alphavirus.

[0268] i. 5' UTR

[0269] In some aspects, the RNA disclosed herein comprises a 5' UTR. The 5' UTR, if present, is located at the 5' end and begins at the transcription start site upstream of the start codon of the protein coding region. The 5' UTR is downstream of the 5' cap, if present, e.g., directly adjacent to the 5' cap. The 5' UTR can contain various regulatory components, e.g., a 5' cap structure, stem-loop structures, and an internal ribosome entry site (IRES), which can play a role in the control of translation initiation.

[0270] In some aspects, the 5' UTR disclosed herein comprises a cap-proximal sequence, e.g., as disclosed herein. In some aspects, the cap-proximal sequence comprises the sequence adjacent to the 5' cap. In some aspects, the cap-proximal sequence comprises the nucleotides at positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide.

[0271] In some aspects, the cap structure comprises one or more polynucleotides of the cap-proximal sequence. In some aspects, the cap structure comprises an m7 guanosine cap and nucleotide +1 (N1) of the RNA polynucleotide. In some aspects, the cap structure comprises an m7 guanosine cap and nucleotide +2 (N2) of the RNA polynucleotide. In some aspects, the cap structure comprises an m7 guanosine cap and nucleotides +1 and +2 (N1 and N2) of the RNA polynucleotide.

[0272] It will be appreciated by persons skilled in the art upon reading this disclosure that, in some aspects, one or more residues of the cap-proximal sequence (e.g., one or more of residues +1, +2, +3, +4, and / or +5) can be included in the RNA by virtue of having been included in the cap entity (e.g., cap 1 structure, etc.); or, in some aspects, at least some of the residues in the cap-proximal sequence can be added enzymatically (e.g., by a polymerase, such as a T7 polymerase). For example, in certain exemplary aspects utilizing a (m2 7,3′-O )Gppp(m 2’-O )ApG cap, the +1 and +2 residues are the (m2 7,3′-O )A and G residues of the cap, and the +3, +4, and +5 residues are added by a polymerase (e.g., a T7 polymerase).

[0273] In some aspects, the cap proximal sequence comprises N1and / or N2of the cap structure, wherein N1and N2are any nucleotide, e.g., A, C, G, or U. In some aspects, N1is A. In some aspects, N1is C. In some aspects, N1is G. In some aspects, N1is U. In some aspects, N2is A. In some aspects, N2is C. In some aspects, N2is G. In some aspects, N2is U. In some aspects, the cap proximal sequence comprises N1and N2of the cap structure and N3, N4, and N5, wherein N1-N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide. In some aspects, N1, N2, N3, N4, or N5 is any nucleotide, e.g., A, C, G, or U. In some aspects, N1N2comprises any of the following: AA, AC, AG, AU, CA, CC, CG, CU, GA, GC, GG, GU, UA, UC, UG, or UU. In some aspects, N1N2comprises AG and N3N4N5comprises any of the following: AAA, ACA, AGA, AUA, AAG, AGG, ACG, AUG, AAC, ACC, AGC, AUC, AAU, ACU, AGU, AUU, CAA, CCA, CGA, CUA, CAG, CGG, CCG, CUG, CAC, CCC, CGC, CUC, CAU, CCU, CGU, CUU, GAA, GCA, GGA, GUA, GAG, GGG, GCG, GUG, GAC, GCC, GGC, GUC, GAU, GCU, GGU, GUU, UAA, UCA, UGA, UUA, UAG, UGG, UCG, UUG, UAC, UCC, UGC, UUC, UAU, UCU, UGU, or UUU.

[0274] In some aspects, the cap proximal sequence comprises N1and N2of the cap structure and a sequence comprising A3A4X5(SEQ ID NO: 307; wherein X5is A, G, C, or U), wherein each of N1and N2is independently selected from A, C, G, or U. In some aspects, N1is A and N2is G. In some aspects, X5is selected from A, C, G, or U. In some aspects, X5is A. In some aspects, X5is C. In some aspects, X5is G. In some aspects, X5is U.

[0275] In some aspects, the cap proximal sequence comprises N1and N2of the cap structure and a sequence comprising C3A4X5(SEQ ID NO: 308; wherein X5is A, G, C, or U), wherein each of N1and N2is independently selected from A, C, G, or U. In some aspects, N1is A and N2is G. In some aspects, X5is selected from A, C, G, or U. In some aspects, X5is A. In some aspects, X5is C. In some aspects, X5is G. In some aspects, X5is U.

[0276] In some aspects, the cap proximal sequence comprises N1and N2of the cap structure and a sequence comprising X3Y4X5(SEQ ID NO: 309; wherein each of X3or X5is independently selected from A, G, C, or U; and Y4is not C). In some aspects, each of N1and N2is independently selected from: A, C, G, or U. In some aspects, N1is A and N2is G. In some aspects, each of X3and X5is independently selected from A, C, G, or U. In some aspects, X3and / or X5is A. In some aspects, X3and / or X5is C. In some aspects, X3and / or X5is G. In some aspects, X3and / or X5is U. In some aspects, Y4is C. In other aspects, Y4is not C. In some aspects, Y4is A. In some aspects, Y4is G. In other aspects, Y4is not G. In some aspects, Y4is U.

[0277] In some aspects, the cap proximal sequence comprises N1and N2of the cap structure and a sequence comprising A3C4A5(SEQ ID NO: 310). In some aspects, each of N1and N2is independently selected from: A, C, G, or U. In some aspects, N1is A and N2is G.

[0278] In some aspects, the cap proximal sequence comprises N1and N2of the cap structure and a sequence comprising A3U4G5(SEQ ID NO: 311). In some aspects, each of N1and N2is independently selected from: A, C, G, or U. In some aspects, N1is A and N2is G.

[0279] Exemplary 5’ UTRs include a human alpha globin (hAg) 5’ UTR or fragment thereof, a TEV 5’ UTR or fragment thereof, a HSP70 5’ UTR or fragment thereof, or a c-Jun 5’ UTR or fragment thereof.

[0280] In some aspects, the RNA disclosed herein comprises a hAg 5’ UTR or fragment thereof. In some aspects, the RNA disclosed herein comprises a hAg 5’ UTR that is 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identical to the human alpha globin 5’ UTR provided in SEQ ID NO: 312. In some aspects, the RNA disclosed herein comprises the hAg 5’ UTR provided in SEQ ID NO: 312.

[0281] SEQ ID NO: 312

[0282] AGAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCC

[0283] In some aspects, the RNA disclosed herein comprises a hAg 5' UTR having 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the human alpha globin 5' UTR provided in SEQ ID NO: 313. In some aspects, the RNA disclosed herein comprises the hAg 5' UTR provided in SEQ ID NO: 313.

[0284] SEQ ID NO: 313

[0285] AAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCC

[0286] In one aspect, the DNA encoding the 5' UTR disclosed herein comprises a sequence having at least, at most, exactly the following identity, or identity between any two of the following: 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% to SEQ ID NO: 280. In one aspect, the DNA encoding the 5' UTR comprises the sequence of SEQ ID NO: 280. In one aspect, the RNA disclosed herein comprises a 5' UTR comprising a sequence having at least, at most, exactly the following identity, or identity between any two of the following: 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% to the 5' UTR provided in any one of SEQ ID NOs: 281-282, wherein the transcribed 5' cap structure is underlined. In one aspect, the 5' UTR comprises the sequence of any one of SEQ ID NOs: 281-282, wherein the transcribed 5' cap structure is underlined.

[0287] SEQ ID NO: 280 (DNA)

[0288] AG AATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC

[0289] SEQ ID NO: 281 (RNA)

[0290] AG AAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC

[0291] SEQ ID NO: 282 (RNA)

[0292] AGAAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCCGCCACC

[0293] ii.3'UTR

[0294] In some aspects, the RNA disclosed herein comprises a 3' UTR. The 3' UTR, if present, is located downstream of the protein-coding sequence open reading frame, e.g., downstream of the stop codon of the protein-coding region. The 3' UTR is generally the portion of the mRNA located between the protein-coding sequence and the poly(A) tail of the mRNA. Thus, in some aspects, the 3' UTR is upstream of the poly-A sequence, if present, e.g., directly adjacent to the poly-A sequence. The 3' UTR can be involved in regulatory processes, including transcript cleavage, stability and polyadenylation, translation, and mRNA localization.

[0295] The 3' UTR can also comprise components that are not encoded in the template for the transcribed RNA but are added during maturation after transcription, e.g., a poly(A) tail. The 3' UTR of an mRNA is not translated into an amino acid sequence. In some aspects, the RNA disclosed herein comprises a 3' UTR comprising a F-component and / or an I-component. In some aspects, the 3' UTR or a proximal sequence thereof comprises a restriction site. In some aspects, the restriction site is a BamHI site. In some aspects, the restriction site is a Xhol site.

[0296] In some aspects, the RNA disclosed herein comprises a 3' UTR having at least, at most, or exactly the following identity to the 3' UTR provided in SEQ ID NO: 314: 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. In some aspects, the RNA disclosed herein comprises the 3' UTR provided in SEQ ID NO: 314.

[0297] SEQ ID NO: 314

[0298] CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC

[0299] In one aspect, the DNA encoding the 3' UTR disclosed herein comprises a sequence having at least, at most, exactly, or between any two of the following identities to SEQ ID NO: 283: 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. In one aspect, the DNA encoding the 5' UTR comprises the sequence of SEQ ID NO: 283. In one aspect, the RNA disclosed herein comprises a 3' UTR comprising a sequence having at least, at most, exactly, or between any two of the following identities to the 3' UTR provided in any one of SEQ ID NOs: 284-285 and 317-318: 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. In one aspect, the 3' UTR comprises the sequence of any one of SEQ ID NOs: 284-285 and 317-318.

[0300] SEQ ID NO: 283 (DNA)

[0301] CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC

[0302] SEQ ID NO: 284 (RNA)

[0303] CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCCUGGAGCUAGC

[0304] SEQ ID NO: 285 (RNA)

[0305] CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCCUGGAGCUAGC

[0306] SEQ ID NO: 317 (RNA)

[0307] CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC SEQ ID NO: 318 (RNA)

[0308] CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC

[0309] D. Open Reading Frame (ORF)

[0310] 5' and 3' UTRs are operably linked to an open reading frame (ORF), which can be a sequence of codons that can be translated into a polypeptide of interest. An open reading frame can be a sequence of several DNA or RNA nucleotide triplets that can be translated into a peptide or protein. An ORF can begin with a start codon at its 5' end and the next position, which is, for example, a combination of three consecutive nucleotides that usually encodes the amino acid methionine (ATG or AUG), which is usually a multiple of 3 nucleotides in length. An open reading frame can be terminated by at least one stop codon, including, but not limited to, TAA, TAG, TGA, or UAA, UAG, or UGA, or any combination thereof. In some aspects, an open reading frame can be terminated by one, two, three, four, or more stop codons, including, but not limited to, TAATAA (SEQ ID NO: 289), TAATAG (SEQ ID NO: 290), TAATGA (SEQ ID NO: 291), TAGTGA (SEQ ID NO: 292), TAGTAA (SEQ ID NO: 293), TAGTAG (SEQ ID NO: 294), TGATGA (SEQ ID NO: 295), TGATAG (SEQ ID NO: 296), TGATAA (SEQ ID NO: 297), or UAAUAA (SEQ ID NO: 298), UAAUAG (SEQ ID NO: 299), UAAUGA (SEQ ID NO: 300), UAGUGA (SEQ ID NO: 301), UAGUAA (SEQ ID NO: 302), UAGUAG (SEQ ID NO: 303), UGAUGA (SEQ ID NO: 304), UGAUAG (SEQ ID NO: 305), UGAUAA (SEQ ID NO: 306), or any combination thereof. An open reading frame can be isolated, or it can be incorporated into a longer nucleic acid sequence, for example, into a vector or mRNA. An open reading frame can also be referred to as a "(protein) coding region" or "coding sequence."

[0311] As stated herein, an RNA molecule can include one (monocistronic), two (bicistronic), or more (multicistronic) open reading frames.

[0312] In some aspects, the ORF encodes a non-structural viral gene. In some aspects, the ORF further includes one or more subgenomic promoters. In some aspects, the RNA molecule includes a subgenomic promoter operably linked to the ORF. In some aspects, the first RNA molecule does not include an ORF encoding any polypeptide of interest, while the second RNA molecule includes an ORF encoding a polypeptide of interest. In some aspects, the first RNA molecule does not include a subgenomic promoter.

[0313] The present disclosure provides an RNA molecule comprising at least one open reading frame encoding a varicella zoster virus (VZV) polypeptide. In some aspects, the RNA molecule comprises at least one open reading frame encoding a VZV gE polypeptide.

[0314] E. Gene of Interest

[0315] The RNA molecules described herein can include a gene of interest. The gene of interest encodes a polypeptide of interest. Non-limiting examples of polypeptides of interest include, for example, a biologic, an antibody, a vaccine, a therapeutic polypeptide or peptide, a cell-penetrating peptide, a secreted polypeptide, a plasma membrane polypeptide, a cytoplasmic or cytoskeletal polypeptide, an intracellular membrane-bound polypeptide, a nuclear polypeptide, a polypeptide associated with a human disease, a targeting moiety, those polypeptides encoded by the human genome that have not yet been identified for a therapeutic indication but have utility in the research and exploratory space, or combinations thereof. The sequence of a particular gene of interest is readily identified by one of skill in the art using public and private databases such as GenBank® .

[0316] In some aspects, the RNA molecule includes a coding region of a gene of interest. In some aspects, the gene of interest is or includes an antigenic polypeptide or an immunogenic variant or immunogenic fragment thereof. In some aspects, the antigenic polypeptide includes one epitope from an antigen. In some aspects, the antigenic polypeptide includes multiple different epitopes from an antigen. In some aspects, the antigenic polypeptide including multiple different epitopes from an antigen is multi-epitopic. In some aspects, the antigenic polypeptide includes an antigenic polypeptide from an allergen, a viral antigenic polypeptide, a bacterial antigenic polypeptide, a fungal antigenic polypeptide, a parasitic antigenic polypeptide, an antigenic polypeptide from an infectious agent, an antigenic polypeptide from a pathogen, a tumor antigenic polypeptide, or a self-antigenic polypeptide.

[0317] The term "antigen" can mean a substance capable of being recognized by the immune system, e.g., by the adaptive immune system, and capable of eliciting an antigen-specific immune response, e.g., by the formation of antibodies and / or antigen-specific T cells, as part of an adaptive immune response. An antigen can be or can include a peptide or protein, which can be presented by MHC to T cells. An antigen can be the translation product of a provided nucleic acid molecule, e.g., an RNA molecule comprising at least one coding sequence as described herein. In addition, fragments, variants, and derivatives of an antigen, such as a peptide or protein, including at least one epitope are understood to be an antigen.

[0318] In some aspects, the RNA encoding the gene of interest (e.g., an antigen) is expressed in the cells of the treated subject to provide the gene of interest (e.g., an antigen). In some aspects, the RNA is transiently expressed in the cells of the subject. In some aspects, the expression of the gene of interest (e.g., an antigen) is at the cell surface. In some aspects, the gene of interest (e.g., an antigen) is expressed and presented in the context of MHC. In some aspects, the expression of the gene of interest (e.g., an antigen) is into the extracellular space, e.g., the antigen is secreted.

[0319] In some aspects, the RNA molecule comprises a coding region of a gene of interest (e.g., an antigen). In some aspects, the RNA molecule comprises a coding region of a gene of interest (e.g., an antigen) derived from a pathogen associated with an infectious disease. In some aspects, the RNA molecule comprises a coding region of a gene of interest (e.g., an antigen) derived from varicella zoster virus (VZV).

[0320] In some aspects, the RNA molecule encodes a VZV gE protein or fragment or variant thereof. In some aspects, the RNA molecule encodes a VZV gE protein comprising an amino acid sequence according to any one of the following AAG32558.1, ABE03086.1, AAK01047.1, Q9J3M8.1, AEW88548.1, AGY33616.1, AEW89124.1, AIT53150.1, CAA25033.1, NP_040190.1, AKG56356.1, AEW89412.1, ABF21714.1, ABF21714.1, AAT07749.1, AEW88764.1, AAG48520.1, and / or AEW88980.1, the respective sequences of which are incorporated herein by reference. In some aspects, the RNA molecule encodes a VZV gE protein comprising an amino acid sequence according to AAG32558.1, ABE03086.1, AAK01047.1, Q9J3M8.1, AEW88548.1, AGY33616.1, AEW89124.1, AIT53150.1, CAA25033.1, NP_040190.1, AKG56356.1, AEW89412.1, ABF21714.1, ABF21714.1, AAT07749.1, AEW88764.1, AAG48520.1, and / or AEW88980.1, the respective sequences of which are incorporated herein by reference. In some aspects, the RNA molecule encodes a VZV gE protein comprising an amino acid sequence according to

[0321] In some aspects, the RNA polynucleotide described herein, or a composition or medical preparation comprising the same, comprises a nucleotide sequence disclosed herein. In some aspects, the RNA polynucleotide comprises a sequence that is at least 80% identical to a nucleotide sequence disclosed herein. In some aspects, the RNA polynucleotide comprises a sequence that encodes a polypeptide that is at least 80% identical to a polypeptide sequence disclosed herein. In some aspects, the RNA polynucleotide described herein, or a composition or medical preparation comprising the same, is transcribed from a DNA template. In some aspects, the DNA template for transcribing the RNA polynucleotide described herein comprises a sequence that is complementary to the RNA polynucleotide. In some aspects, the gene of interest described herein is encoded by the RNA polynucleotide described herein comprising a nucleotide sequence disclosed herein. In some aspects, the RNA polynucleotide encodes a polypeptide that is at least 80% identical to a polypeptide sequence disclosed herein. In some aspects, the polypeptide described herein is encoded by an RNA polynucleotide that is transcribed from a DNA template comprising a sequence that is complementary to the RNA polynucleotide.

[0322] In some aspects, the RNA molecule encodes a VZV glycoprotein comprising a sequence of any one of SEQ ID NOs: 1-11, or a fragment or variant thereof.

[0323] In some aspects, the RNA molecule encodes a VZV glycoprotein synthesized from a nucleic acid sequence comprising any one of SEQ ID NOs: 12-145, or a fragment or variant thereof.

[0324] F. Poly(A) Tail

[0325] In some aspects, the RNA molecule disclosed herein comprises a polyadenosine (polyA) sequence, e.g., as described herein. In some aspects, the polyA sequence is downstream of the 3’ UTR, e.g., adjacent to the 3’ UTR. A “poly(A) tail” or “polyA sequence” refers to a stretch of consecutive adenine residues that can be ligated to the 3’ end of an RNA molecule. PolyA sequences are known to those of skill in the art, and can be appended to the 3’ UTR in the RNA molecules described herein. The poly(A) tail can increase the half-life of the RNA molecule.

[0326] The RNA molecules disclosed herein can have a poly(A) sequence that is ligated to the free 3’ end of the RNA after transcription by a template-independent RNA polymerase, or a poly(A) sequence that is encoded by DNA and transcribed by a template-dependent RNA polymerase. In some aspects, the poly(A) sequence is ligated during RNA transcription, e.g., during the preparation of in vitro transcribed RNA, based on a DNA template comprising repeated dT nucleotides (deoxythymidylate) in the strand complementary to the coding strand.

[0327] DNA sequences (coding strand) encoding a poly-A sequence are referred to as poly-A cassettes. In some aspects, a poly-A cassette present in the coding strand of DNA consists essentially of dA nucleotides, but interspersed with a random sequence of four nucleotides (dA, dC, dG, and dT). Such random sequences can be at least, at most, exactly, or any number of nucleotides between 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. Such cassettes are disclosed in WO 2016 / 005324 Al, which is hereby incorporated by reference. Any of the poly-A cassettes disclosed in WO 2016 / 005324 Al can be used in the present disclosure. The present disclosure encompasses a poly-A cassette that consists essentially of dA nucleotides, but interspersed with a random sequence of four nucleotides (dA, dC, dG, dT) with an equal distribution and a length of, for example, 5 to 50 nucleotides, which exhibits constant propagation of plasmid DNA in E. coli at the DNA level and is still associated with beneficial properties with respect to supporting RNA stability and translation efficiency at the RNA level. In some aspects, the poly-A sequence contained in the RNA polynucleotides described herein consists essentially of adenosine nucleotides, but interspersed with a random sequence of four nucleotides (A, C, G, U). Such random sequences can be at least, at most, exactly, or any number of nucleotides between 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides.

[0328] In some aspects, no nucleotides other than adenosine nucleotides flank the poly-A sequence at the 3' end of the poly-A sequence, e.g., the 3' end of the poly-A sequence is not masked by or followed by nucleotides other than adenosine.

[0329] In some aspects, the RNA molecule can further comprise an endonuclease recognition site sequence immediately downstream of the poly-A tail sequence. The RNA molecule can further comprise a poly-A polymerase recognition sequence (e.g., AAUAAA) proximal to its 3' end.

[0330] The poly-A sequence can be of any length. In some aspects, the polyadenyl tail can comprise a length of 5 to 300 nucleotides. In some aspects, the RNA molecule comprises a polyadenyl tail comprising, consisting essentially of, or consisting of a sequence of about 25 to about 400 adenosine nucleotides, a sequence of about 50 to about 400 adenosine nucleotides, a sequence of about 50 to about 300 adenosine nucleotides, a sequence of about 50 to about 250 adenosine nucleotides, a sequence of about 60 to about 250 adenosine nucleotides, or a sequence of about 40 to about 100 adenosine nucleotides. In some aspects, the polyadenyl tail comprises, consists essentially of, or consists of at least, at most, exactly, or a number of adenosine nucleotides between any two of the following: 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or 500 adenosine nucleotides. In this context, “consisting essentially of’ means that a majority of the nucleotides in the poly-A sequence (typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the number of nucleotides in the poly-A sequence) are adenosine nucleotides, but permits the remaining nucleotides to be nucleotides other than adenosine nucleotides, such as uridine, guanosine, or cytosine. In this context,

[0331] “consisting of’ means that all of the nucleotides in the poly-A sequence (e.g., 100% of the number of nucleotides in the poly-A sequence) are adenosine nucleotides.

[0332] In some aspects, the RNA molecule includes a poly(A) tail having a sequence including more than 30 adenosine nucleotides. In some aspects, the RNA molecule includes a poly(A) tail having a sequence including about 40 adenosine nucleotides. In some aspects, the RNA molecule includes a poly(A) tail having a sequence including about 80 adenosine nucleotides. In some aspects, the 3' poly(A) tail has a sequence segment of at least 10 consecutive adenosine residues and up to 300 consecutive adenosine residues. In some particular aspects, the RNA molecule includes about 40 consecutive adenosine residues. In some aspects, the RNA molecule includes about 80 consecutive adenosine residues. The poly(A) tail can play a key regulatory role in enhancing translation efficiency and modulating mRNA quality control and efficiency of degradation. Short sequences or hyperpolyadenylation can signal RNA degradation. Some designs include a poly(A) tail of about 40 adenosine nucleotides, about adenosine nucleotides.

[0333] In some aspects, the poly(A) tail can be located within the RNA molecule or other nucleic acid molecule, such as in a vector, e.g., in a vector that serves as a template for production of RNA, e.g., mRNA, e.g., by transcription of the vector. In some aspects, the RNA molecule can not include a poly(A) tail.

[0334] In one aspect, the DNA encoding the poly(A) tail disclosed herein comprises a sequence having at least, at most, exactly, or between any two of the following identities to SEQ ID NO: 286: 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. In one aspect, the DNA encoding the poly(A) tail comprises the sequence of SEQ ID NO: 286. In one aspect, the RNA disclosed herein comprises a poly(A) tail comprising a sequence having at least, at most, exactly, or between any two of the following identities to any one of SEQ ID NOs: 287-288 and 315-316: 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. In one aspect, the poly(A) tail comprises the sequence of any one of SEQ ID NOs: 287-288 + / - 2 adenosine (A) nucleotides. In one aspect, the poly(A) tail comprises the sequence of any one of SEQ ID NOs: 287-288 + / - 1 adenosine (A) nucleotide. In one aspect, the poly(A) tail comprises the sequence of any one of SEQ ID NOs: 287-288. In one aspect, the poly(A) tail comprises the sequence of any one of SEQ ID NOs: 315-316 + / - 2 adenosine (A) nucleotides. In one aspect, the poly(A) tail comprises the sequence of any one of SEQ ID NOs: 315-316 + / - 1 adenosine (A) nucleotide. In one aspect, the poly(A) tail comprises the sequence of any one of SEQ ID NOs: 315-316.

[0335] SEQ ID NO: 286 (DNA)

[0336] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0337] SEQ ID NO: 287 (RNA)

[0338] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0339] SEQ ID NO: 288 (RNA)

[0340] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0341] SEQ ID NO: 315 (RNA)

[0342] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0343] SEQ ID NO: 316 (RNA)

[0344] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0345] G. Self-amplifying RNA (SaRNA)

[0346] In some aspects, the RNA molecule can be a saRNA. "Self-amplifying RNA," "self-amplifying RNA," and "replicon" refer to an RNA that is capable of self-replication. Self-amplifying RNA molecules can be generated by using replication components derived from, for example, alphaviruses, and substituting the structural viral polypeptides with a nucleotide sequence encoding a polypeptide of interest. Self-amplifying RNA molecules are typically positive strand molecules that can be translated directly after delivery to a cell, and this translation provides a RNA-dependent RNA polymerase, which then generates antisense and sense transcripts from the delivered RNA. The delivered RNA causes the production of multiple daughter RNA molecules. These daughter RNA molecules, as well as the co-linear subgenomic transcripts, can themselves be translated to provide in situ expression of the encoded polypeptide of interest (e.g., viral antigen), or can be transcribed to provide other transcripts synonymous with the delivered RNA that are translated to provide in situ expression of the antigen. The overall result of this series of transcription is that the number of introduced saRNA molecules is amplified, and thus the encoded polypeptide of interest (e.g., viral antigen) becomes a major polypeptide product of the cell.

[0347] IV. RNA transcription

[0348] In some aspects, the RNA disclosed herein is produced by in vitro transcription or chemical synthesis. In the context of the present disclosure, the term "transcription" relates to the process in which the genetic code in a DNA sequence is transcribed into RNA. Subsequently, the RNA can be translated into a peptide or protein.

[0349] According to the present disclosure, "transcription" includes "in vitro transcription" or "IVT", which refers to a process in which transcription occurs in vitro in a non-cellular system to produce synthetic RNA products for various applications, including, for example, the production of proteins or polypeptides. Cloning vectors can be applied to produce the transcripts. These cloning vectors are generally referred to as transcription vectors and are encompassed by the term "vector" according to the present disclosure. According to particular aspects, the RNA used is in vitro transcribed RNA (IVT-RNA) and can be obtained by in vitro transcription of an appropriate DNA template. The promoter used to control transcription can be any promoter for any RNA polymerase. Particular examples of RNA polymerases are T7, T3 and SP6 RNA polymerases. Preferably, the in vitro transcription according to the present application is controlled by a T7 or SP6 promoter. The DNA template used for in vitro transcription can be obtained by cloning a nucleic acid, in particular a cDNA, and introducing it into an appropriate vector for in vitro transcription. The cDNA can be obtained by reverse transcription of an RNA.

[0350] The synthetic IVT RNA products can be translated in vitro or directly introduced into a cell, where the products can be translated. In terms of RNA, the term "expression" or "translation" relates to the process in which a mRNA strand directs the assembly of an amino acid sequence in the ribosomes of a cell to produce a peptide or protein. Such synthetic RNA products include, for example, but are not limited to, mRNA molecules, saRNA molecules, antisense RNA molecules, shRNA molecules, long non-coding RNA molecules, ribozymes, aptamers, guide RNA molecules (e.g. guide RNA molecules for CRISPR), ribosomal RNA molecules, small nuclear RNA molecules, small nucleolar RNA molecules, and the like. The IVT reaction typically utilizes a DNA template (e.g. a linear DNA template), ribonucleotides (e.g. unmodified ribonucleotide triphosphates or modified ribonucleotide triphosphates) as described and / or utilized herein, and an appropriate RNA polymerase.

[0351] In some aspects, the mRNA is produced by in vitro transcription using a DNA template, wherein DNA refers to a nucleic acid containing deoxyribonucleotides. In some aspects, the RNA disclosed herein is in vitro transcribed RNA (IVT-RNA) and can be obtained by in vitro transcription of an appropriate DNA template. The promoter used to control transcription can be any promoter for any RNA polymerase. The DNA template used for in vitro transcription can be obtained by cloning a nucleic acid, in particular a cDNA, and introducing it into an appropriate vector for in vitro transcription. The cDNA can be obtained by reverse transcription of an RNA.

[0352] In some aspects, the starting material for IVT can include a linearized DNA template, nucleotides, RNase inhibitors, pyrophosphatase, and / or T7 RNA polymerase. In some aspects, the IVT process is performed in a bioreactor. The bioreactor can comprise a mixer. In some aspects, nucleotides can be added to the bioreactor during the entire IVT process.

[0353] In some aspects, one or more post-IVT reagents are added to the IVT mixture comprising RNA in the bioreactor after the IVT process. Exemplary post-IVT reagents can include DNase I configured to digest the linearized DNA template and proteinase K configured to digest DNase I and T7 RNA polymerase. In some aspects, the post-IVT reagents are incubated with the mixture in the bioreactor after IVT. In some aspects, the bioreactor can contain at least, at most, exactly, or any two of between, the following number of liters of IVT mixture: 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, and 500 or more liters. The IVT mixture can have at least, at most, exactly, or any two of between, the following or the following: 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 7.0, 8.0, 9.0, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL or more RNA.

[0354] In some aspects, the IVT mixture can include residual spermidine, residual DNA, residual protein, peptides, HEPES, EDTA, ammonium sulfate, cations (e.g., Mg2+, Na+, Ca2+), RNA fragments, residual nucleotides, free phosphate, or any combination thereof.

[0355] In some aspects, at least a portion of the IVT mixture is filtered. The IVT mixture can be filtered via ultrafiltration and / or diafiltration to remove at least some impurities from the IVT mixture and / or to change the buffer solution of at least a portion of the IVT mixture to produce a concentrated RNA solution as a retentate.

[0356] In some aspects, both "ultrafiltration" and "diafiltration" refer to membrane filtration processes. Ultrafiltration generally uses a membrane with a pore size of at least, at most, exactly, or any two of the following: 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, and 0.1 pm. In some aspects, ultrafiltration membranes are generally classified by molecular weight cut-off (MWCO) rather than pore size. For example, the MWCO can be at least, at most, exactly, or between any two of the following: 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, 100 kDa, 110 kDa, 120 kDa, 130 kDa, 140 kDa, 150 kDa, 160 kDa, 170 kDa, 180 kDa, 190 kDa, 200 kDa, 210 kDa, 220 kDa, 230 kDa, 240 kDa, 250 kDa, 260 kDa, 270 kDa, 280 kDa, 290 kDa, 300 kDa, 310 kDa, 320 kDa, 330 kDa, 340 kDa, 350 kDa, 360 kDa, 370 kDa, 380 kDa, 390 kDa, 400 kDa, 500 kDa, 600 kDa, 700 kDa, 800 kDa, 900 kDa, 1000 kDa, 2000 kDa, 3000 kDa, 4000 kDa, 5000 kDa, 6000 kDa, 7000 kDa, 8000 kDa, 9000 kDa, and 10,000 kDa. Those skilled in the art will appreciate that the filtration membranes can have different suitable materials depending on the application, including, for example, polymers, cellulose, ceramic, etc. In some aspects, membrane filtration can be more desirable for large volume purification processes.

[0357] In some aspects, ultrafiltration and diafiltration of the IVT mixture for purification of the RNA can include: (1) direct flow filtration (DFF), also known as "dead-end" filtration, which applies a feed flow perpendicular to the membrane surface and attempts to pass 100% of the fluid through the membrane; and / or (2) tangential flow filtration (TFF), also known as sweep flow filtration, in which the feed flow is passed parallel to the membrane surface, with one portion passing through the membrane (permeate) and the remainder (retentate) retained and / or recirculated back to the feed tank.

[0358] In some aspects, the filtration of the IVT mixture is via TFF comprising an ultrafiltration step, a first diafiltration step, and a second diafiltration step. In some aspects, the first diafiltration step is performed in the presence of ammonium sulfate. The first diafiltration step can be configured to remove a majority of impurities from the IVT mixture. In some aspects, the second diafiltration step is performed in the absence of ammonium sulfate. The second diafiltration step can be configured to transfer the RNA into a DS buffer formulation.

[0359] A filtration membrane with an appropriate MWCO can be selected for ultrafiltration in a TFF process. The MWCO of a TFF membrane determines which solutes can pass through the membrane into the filtrate and which solutes are retained in the retentate. The MWCO of a TFF membrane can be selected such that substantially all of the solutes of interest (e.g., the desired synthetic RNA species) are retained in the retentate, while the undesired components (e.g., excess ribonucleotides, small nucleic acid fragments such as digested or hydrolyzed DNA templates, peptide fragments such as digested proteins, and / or other impurities) are passed into the filtrate. In some aspects, the retentate comprising the desired synthetic RNA species can be recirculated to the feed tank for re-filtering in additional cycles. In some aspects, the MWCO of the TFF membrane can be at least, at most, exactly equal to, or between any two of: 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, or greater. In some aspects, the MWCO of the TFF membrane can be at least, at most, exactly equal to, or between any two of: 100 kDa, 150 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa, or greater. In some aspects, the MWCO of the TFF membrane can be about 250-350 kDa. In some aspects, the MWCO of the TFF membrane (e.g., a cellulose-based membrane) can be about 30-300 kDa; in some aspects, about 50-300 kDa, about 100-300 kDa, or about 200-300 kDa.

[0360] Diafiltration can be performed discontinuously or continuously. For example, in continuous diafiltration, diafiltration solution can be added to the sample feed reservoir at the same rate that filtrate is produced. In this way, the volume of the sample reservoir remains constant, but small molecules (e.g., salts, solvents, etc.) that can freely permeate through the membrane are removed. Using solvent removal as an example, each additional diafiltration volume (DV) further reduces the solvent concentration. In discontinuous diafiltration, the solution is first diluted and then concentrated back to the starting volume. This process is then repeated until the desired concentration of small molecules (e.g., salts, solvents, etc.) remaining in the reservoir is achieved. Each additional diafiltration volume (DV) further reduces the small molecule (e.g., solvent) concentration. Continuous diafiltration generally requires the minimum volume for a given reduction of the molecules to be filtered. On the other hand, discontinuous diafiltration permits rapid changes in the state of the retentate (such as pH, salt content, etc.). In some aspects, the first diafiltration step is performed with at least, at most, exactly, or a number between any two of the following numbers of diafiltration volumes: 2, 3, 4, 5, 6, 7, 8, 9, 10, or more. In some aspects, the second diafiltration step is performed with at least, at most, exactly, or a number between any two of the following numbers of diafiltration volumes: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more. In some aspects, the first diafiltration step is performed with 5 diafiltration volumes, and the second diafiltration step is performed with 10 diafiltration volumes.

[0361] In some aspects, for ultrafiltration and / or diafiltration, the IVT mixture is filtered at a rate of at least, at most, exactly, or a rate between any two of the following: 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 500, 600, 700, 800, 900, or 1000 L / m2filter area / hour or greater. The concentrated RNA solution can comprise at least, at most, exactly, or a concentration between any two of the following concentrations of single-stranded RNA: 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 mg / mL.

[0362] In some aspects, the biological load of the concentrated RNA solution from which the RNA product solution is obtained via filtration can also be reduced. Filtration for reducing biological load can be performed using one or more filters. The one or more filters can comprise a filter having a pore size of at least, at most, exactly, or between any two of the following: 0.2 pm, 0.45 pm, 0.65 pm, 0.8 pm, or any other pore size configured to remove biological load.

[0363] As one example, reducing the bioburden can include draining a retentate tank containing retentate obtained from ultrafiltration and / or diafiltration to obtain a retentate. Reducing the bioburden can include rinsing a filtration system used for ultrafiltration and / or diafiltration with a wash buffer solution to obtain a wash pool solution containing residual RNA remaining in the filtration system. The retentate can be filtered to obtain a filtered retentate. The wash pool solution can be filtered using a first 0.2 μιη filter to obtain a filtered wash pool solution. The retentate can be filtered using the first 0.2 μιη filter or another 0.2 μιη filter.

[0364] The filtered wash pool solution and the filtered retentate can be combined to form a combined pool solution. The combined pool solution can be filtered using a second 0.2 μιη filter to obtain a filtered combined pool solution, which is further filtered using a third 0.2 μιη filter to produce an RNA product solution.

[0365] V. RNA encapsulation

[0366] The RNA in the RNA product solution can be encapsulated, and the RNA solution can further comprise at least one encapsulating agent. In one aspect, the encapsulating agent comprises lipids, lipid nanoparticles (LNP), lipoplexes, polymeric particles, polyplexes, and monolithic delivery systems, and combinations thereof.

[0367] In one aspect, the encapsulating agent is a lipid, and a lipid nanoparticle (LNP) encapsulated RNA is produced. Without intending to be bound by any theory, it is believed that cationic or cationizable lipid or lipid-like materials and / or cationic polymers combine with nucleic acids to form aggregates, and this aggregation results in colloidally stable particles. The lipids can be naturally occurring lipids or synthetic lipids. However, lipids are generally biological materials. Biological lipids are well known in the art, and include, for example, neutral fats, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glycolipids, sulfur lipids, lipids with ether and ester-linked fatty acids, and polymerizable lipids, and combinations thereof. Lipids are materials that are insoluble in water and extractable with organic solvents. Compounds other than those specifically described herein are understood by those skilled in the art to be lipids, and are encompassed by the compositions and methods of the present disclosure. Lipid components and non-lipid can be covalently or non-covalently linked to one another.

[0368] In some aspects, the LNP can be designed to protect the RNA molecule (e.g., saRNA, mRNA) from extracellular RNases, and / or can be engineered for systemic delivery of the RNA to target cells. In some aspects, such LNP can be particularly useful for delivering the RNA molecule (e.g., saRNA, mRNA) when the RNA molecule is intravenously administered to a human subject in need thereof. In some aspects, such LNP can be particularly useful for delivering the RNA molecule (e.g., saRNA, mRNA) when the RNA molecule is intramuscularly administered to a human subject in need thereof.

[0369] In one aspect, the concentration of RNA in the RNA solution is < 1 mg / mL. In another aspect, the concentration of RNA is at least about 0.05 mg / mL. In another aspect, the concentration of RNA is at least about 0.5 mg / mL. In another aspect, the concentration of RNA is at least about 1 mg / mL. In another aspect, the concentration of RNA is about 0.05 mg / mL to about 0.5 mg / mL. In another aspect, the concentration of RNA is at least 10 mg / mL. In another aspect, the concentration of RNA is at least 50 mg / mL. In some aspects, the concentration of RNA is at least, at most, exactly, or between any two of the following: about 0.05 mg / mL, 0.5 mg / mL, 1 mg / mL, 10 mg / mL, 50 mg / mL, 75 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 400 mg / mL, or more.

[0370] The present disclosure provides RNA solutions and lipid formulation mixtures or compositions thereof comprising at least one RNA encoding, for example, an antigen (e.g., a VZV polypeptide) that is complexed with, encapsulated in, and / or formulated with one or more lipids, and forms a lipid nanoparticle (LNP), a liposome, a lipoplex, and / or a nanoliposome. In some aspects, the composition comprises a lipid nanoparticle.

[0371] Lipid nanoparticles or LNPs refer to particles of any morphology that result when cationic lipids and optionally one or more other lipids are combined, e.g., in an aqueous environment and / or in the presence of RNA. In some aspects, lipid nanoparticles are included in formulations that can be used to deliver active or therapeutic agents, such as nucleic acids (e.g., mRNA), to a target site of interest (e.g., a cell, tissue, organ, tumor, etc.). In some aspects, the lipid nanoparticles of the present disclosure comprise a nucleic acid. Such lipid nanoparticles typically comprise a cationic lipid and one or more excipients, e.g., one or more neutral lipids, a charged lipid, a steroid, a polymer-conjugated lipid, or combinations thereof. In some aspects, active or therapeutic agents, such as nucleic acids (e.g., mRNA), can be encapsulated in the lipid portion of the lipid nanoparticles or in an aqueous space surrounded by some or all of the lipid portion of the lipid nanoparticles, thereby protecting them from enzymatic degradation or other undesirable effects caused by mechanisms of the host organism or cell, e.g., adverse immune reactions. Nucleic acids (e.g., mRNA) or portions thereof can also be associated and complexed with the lipid nanoparticles. The lipid nanoparticles can comprise any lipid capable of forming particles that link or encapsulate nucleic acid(s).

[0372] In some aspects, the provided RNA molecules (e.g., saRNA, mRNA) can be formulated with LNPs. In some aspects, the average diameter of the lipid nanoparticles can be about 1 to 500 nm. In some aspects, the average diameter of the lipid nanoparticles is about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 to about 90 nm, about 80 nm to about 90 nm, about 70 nm to about 80 nm, or at least, at most, exactly or between any two of the following: 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm, and are substantially non-toxic. The term “average diameter” refers to the average hydrodynamic diameter of the particles as measured by dynamic light scattering (DLS) with data analysis using the so-called cumulants algorithm, which results in a so-called Z-average in the dimension of length and a polydispersity index (PI) which is dimensionless (Koppel, D., J. Chem. Phys. 57, 1972, pp 4814-4820, ISO 13321). Herein, the “average diameter”, “diameter” or “size” of the particles is used synonymously with this Z-average.

[0373] The LNPs described herein can exhibit a polydispersity index of less than about 0.5, less than about 0.4, less than about 0.3, or about 0.2 or less. By way of example, the LNPs can exhibit a polydispersity index of at least, at most, exactly, or anywhere between any two of the following: 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, or 0.5. In some aspects, the polydispersity index is calculated based on dynamic light scattering measurements by so-called cumulants analysis as mentioned in the definition of “mean diameter”. Under certain prerequisites, it can be considered as a measure of the size distribution of the nanoparticle population.

[0374] In certain aspects, the nucleic acid (e.g., RNA molecule) is resistant to nuclease degradation in aqueous solution when present in the provided LNP. In some aspects, the LNP is a liver-targeted lipid nanoparticle. In some aspects, the LNP is a cationic lipid nanoparticle comprising one or more cationic lipids (e.g., a cationic lipid described herein). In some aspects, the cationic LNP can comprise at least one cationic lipid, at least one polymer-conjugated lipid, and at least one helper lipid (e.g., at least one neutral lipid).

[0375] In certain aspects, the RNA solution and its lipid formulation mixture or composition can have, have at least, or have at most, or have exactly, or have an amount between any two of the following amounts of a particular lipid, lipid-type, or non-lipid component, such as a lipidoid and / or a cationic polymer or adjuvant, antigen, peptide, polypeptide, sugar, nucleic acid, or other substance disclosed herein or as would be known to one of skill in the art: about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%.

[0376] The LNPs described herein can be prepared using a wide range of methods, which can involve obtaining a colloid from at least one cationic or cationic ionizable lipid or lipidoid and / or at least one cationic polymer and mixing the colloid with a nucleic acid to obtain a nucleic acid particle. The term “colloid” as used herein is with respect to a homogeneous mixture in which dispersed particles do not settle out. The insoluble particles in the mixture are microscopic, with a particle size between 1 and 1000 nanometers. The mixture can be referred to as a colloid or colloidal suspension. Sometimes, the term “colloid” refers only to the particles in the mixture and not the entire suspension.

[0377] To prepare a colloid comprising at least one cationic or cationic ionizable lipid or lipidoid material and / or at least one cationic polymer, methods conventionally used for preparing liposomal vesicles can be applied herein, suitably adapted. The most commonly used method for preparing liposomal vesicles shares the following basic stages: (i) dissolution of the lipid in an organic solvent, (ii) drying of the resulting solution, and (iii) hydration of the dried lipid (using various aqueous media). In the film hydration method, the lipid is first dissolved in a suitable organic solvent and dried to produce a thin film at the bottom of a flask. The resulting lipid film is hydrated using a suitable aqueous medium to produce a liposomal dispersion. In addition, an additional size-reduction step can be included.

[0378] Reverse-phase evaporation is an alternative method for preparing film hydration of liposomal vesicles, which involves the formation of a water-in-oil emulsion between an aqueous phase and an organic phase containing the lipid. Short sonication of this mixture is required for system homogenization. Removal of the organic phase under reduced pressure gives a milky gel, which subsequently turns into a liposomal suspension.

[0379] The term "ethanol injection technique" refers to a process in which an ethanol solution comprising a lipid is rapidly injected into an aqueous solution via a needle. This action disperses the lipid throughout the solution and promotes lipid structuring, e.g., lipid vesicle formation, such as liposome formation. In general, the RNA lipoplex particles described herein can be obtained by adding RNA to a colloidal liposome dispersion. Using the ethanol injection technique, in some aspects, such colloidal liposome dispersions are formed by injecting an ethanol solution comprising a lipid (such as a cationic lipid and additional lipids) into an aqueous solution under stirring. In some aspects, the RNA lipoplex particles described herein can be obtained without an extrusion step.

[0380] The term "extruding" or "extrusion" refers to the production of particles having a fixed cross-sectional profile. In particular, it refers to the size reduction of particles, in which the particles are forced through a filter having a defined aperture.

[0381] According to the present disclosure, other methods having no organic solvent properties can also be used to prepare the colloid.

[0382] In some aspects, LNP-encapsulated RNA can be produced by rapidly mixing a solution of RNA described herein (e.g., a solution of RNA product) with a lipid formulation described herein (which includes, e.g., at least one cationic lipid and optionally one or more other lipid components in an organic solvent) under conditions that trigger a solubility mutation of the lipid components that causes the lipids to self-assemble into LNP. In some aspects, suitable buffers include tris, histidine, citrate, acetate, phosphate, or succinate. The pH of the liquid formulation is related to the pKa of the encapsulating agent (e.g., cationic lipid). The pH of the acidified buffer can be at least one half of the pH scale less than the pKa of the encapsulating agent (e.g., cationic lipid), and the pH of the final buffer can be at least one half of the pH scale greater than the pKa of the encapsulating agent (e.g., cationic lipid). In some aspects, the properties of the cationic lipid are selected so that the initial formation of the particle occurs by association with oppositely charged backbones of the nucleic acid (e.g., RNA). In this way, a particle is formed around the nucleic acid, which in some aspects, for example, can result in a much higher encapsulation efficiency than would be achieved in the absence of an interaction between the nucleic acid and at least one of the lipid components.

[0383] In certain aspects, the nucleic acid, when present in a lipid nanoparticle, is resistant to nuclease degradation in aqueous solution. Lipid nanoparticles comprising nucleic acids and methods of making the same are disclosed, for example, in U.S. Patent Publication Nos. 2004 / 0142025, 2007 / 0042031, and PCT Publication Nos. WO 2013 / 016058 and WO 2013 / 086373, the entire disclosures of which are incorporated herein by reference in their entirety for all purposes.

[0384] Some aspects described herein are directed to compositions, methods, and uses involving more than one, e.g., 2, 3, 4, 5, 6, or even more, nucleic acid species, such as RNA species. In LNP formulations, it is possible to formulate each nucleic acid species separately as an individual LNP formulation. In this case, each individual LNP formulation will comprise one nucleic acid species. The individual LNP formulations can exist as separate entities, e.g., in separate containers. Such formulations can be obtained by separately providing each nucleic acid species, typically each in the form of a solution containing the nucleic acid, and a suitable cationic or cationic ionizable lipid or lipidoid material and a cationic polymer that allows the formation of LNP. Each individual particle will contain only the particular nucleic acid species that was provided when the particle was formed (individual particle formulation).

[0385] In some aspects, compositions such as pharmaceutical compositions comprise more than one individual LNP formulation. Each individual pharmaceutical composition is referred to as a mixed LNP formulation. Mixed LNP formulations according to the present application can be obtained by separately forming individual LNP formulations as described above, followed by a step of mixing the individual LNP formulations. By the mixing step, a formulation comprising a mixed population of LNP containing nucleic acids can be obtained. The individual LNP populations can be together in one container, comprising the mixed population of individual LNP formulations.

[0386] Alternatively, it is possible to formulate different nucleic acid species together into a combined LNP formulation. Such formulations can be obtained by providing a combined formulation, typically a combined solution, of different RNA species, and suitable cationic or cationizable lipid or lipidoid species and cationic polymers that allow the formation of LNP. In contrast to mixed LNP formulations, combined LNP formulations will typically contain LNP comprising more than one RNA species. In combined LNP compositions, the different RNA species are typically present together in a single particle.

[0387] A. Cationic polymeric species

[0388] In view of the high chemical flexibility of polymeric species, they are often used for nanoparticle-based delivery. Typically, cationic species are used to electrostatically condense negatively charged nucleic acids into nanoparticles. This positively charged group often consists of ammonia, which changes its state of protonation between pH ranges of 5.5 and 7.5, which is believed to cause an ionic imbalance leading to endosomal rupture. Polymers such as poly-L-omithine, polyamidoamine, protamine, and polyethylenimine, as well as naturally occurring polymers such as polyglucosamine, have been applied for nucleic acid delivery and are suitable as cationic species suitable for use in some aspects herein. In addition, some researchers have synthesized polymeric species specifically for nucleic acid delivery. In particular, poly(P-amino esters) are widely used in nucleic acid delivery due to their ease of synthesis and biodegradability. In some aspects, such synthetic species can be suitable as cationic species herein.

[0389] A “polymeric species” as used herein has its ordinary meaning, e.g., a molecular structure comprising one or more repeating units (monomers) connected by covalent bonds. In some aspects, such repeating units can all be the same; or, in some cases, more than one type of repeating unit is present within the polymeric species. In some cases, the polymeric species is biologically derived, e.g., a biopolymer such as a protein. In some cases, additional moieties can also be present within the polymeric species, e.g., targeting moieties such as those described herein.

[0390] Those skilled in the art will appreciate that a polymer (or polymeric moiety) is referred to as a "copolymer" when more than one type of repeating unit is present within the polymer (or polymeric moiety). In some aspects, a polymer (or polymeric moiety) utilized in accordance with the present disclosure can be a copolymer. The repeating units forming a copolymer can be arranged in any manner. For example, in some aspects, the repeating units can be arranged in a random order; or, or in addition, in some aspects, the repeating units can be arranged in an alternating order, or as a "block" copolymer, e.g., comprising one or more regions each comprising a first repeating unit (e.g., a first block) and one or more regions each comprising a second repeating unit (e.g., a second block), etc. Block copolymers can have two (diblock copolymers), three (triblock copolymers), or a greater number of different blocks.

[0391] In certain aspects, a polymeric substance utilized in accordance with the present disclosure is biocompatible. A biocompatible substance is one that does not generally cause significant cell death at moderate concentrations. In certain aspects, a biocompatible substance is biodegradable, e.g., capable of being chemically and / or biologically degraded within a physiological environment, such as within the body. In certain aspects, a polymeric substance can be or comprise protamine or a polyalkylenimine, particularly protamine.

[0392] As those skilled in the art will appreciate, the term "protamine" is often used to refer to any of a variety of strongly basic proteins having a relatively low molecular weight, which are rich in arginine and are found associated with the DNA in place of the somatic histones in the sperm cells of various animals, e.g., fish. In particular, the term "protamine" is often used to refer to a protein found in fish sperm that is strongly basic, water-soluble, does not coagulate on heating, and yields mainly arginine on hydrolysis. In purified form, it is used in long-acting formulations of insulin and in anticoagulant agents to neutralize the blood-thinning effects of heparin.

[0393] In some aspects, the term "protamine" as used herein refers to a protamine amino acid sequence obtained or derived from a natural or biological source, including fragments and / or polymeric forms of the amino acid sequence or fragments thereof, as well as (synthetic) polypeptides which are artificial and specifically designed for a specific purpose and cannot be isolated from a natural or biological source.

[0394] In some aspects, a polyalkylenimine comprises a polyethylenimine and / or a polypropylenimine. In some aspects, a polyalkylenimine is a polyethylenimine (PEI). In some aspects, a polyalkylenimine is a linear polyalkylenimine, e.g., a linear polyethylenimine (PEI).

[0395] Cationic species contemplated for use herein (e.g., polymeric species, including polycationic polymers) include those that are capable of electrostatically binding nucleic acids. In some aspects, cationic polymeric species contemplated for use herein include any cationic polymeric species that can associate with nucleic acids, e.g., by forming a complex with the nucleic acid or forming a vesicle in which the nucleic acid is enclosed or encapsulated.

[0396] In some aspects, the particles described herein can comprise a polymer other than a cationic polymer, e.g., a non-cationic polymeric species and / or an anionic polymeric species. Anionic and neutral polymeric species are collectively referred to herein as non-cationic polymeric species.

[0397] B. Lipids and Lipid-Like Species

[0398] The terms "lipid" and "lipid-like species" are used herein to refer to molecules that comprise one or more hydrophobic moieties or groups and, optionally, one or more hydrophilic moieties or groups. According to the present disclosure, lipids and lipid-like species can be cationic, anionic, or neutral. At a selected pH, a neutral lipid or lipid-like species exists in an uncharged or neutral zwitterionic form.

[0399] The term "lipid" refers to a group of organic compounds that are characterized by their insolubility in water but solubility in many organic solvents. Generally, lipids can be classified into eight categories: fatty acids and their derivatives (including triglycerides, diglycerides, monoglycerides, and phospholipids), glycerolipids, glycerophospholipids, sphingolipids, glycolipids, polyketides, sterol lipids, and sterol metabolite-containing lipids (such as cholesterol), and prenol lipids. Examples of fatty acids include, but are not limited to, fatty esters and fatty amides. Examples of glycerolipids include, but are not limited to, glycosylglycerols and glycerophospholipids (e.g., phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine). Examples of sphingolipids include, but are not limited to, ceramide sphingophospholipids (e.g., sphingomyelin, phosphocholine), and glycosphingolipids (e.g., cerebrosides, gangliosides). Examples of sterol lipids include, but are not limited to, cholesterol and its derivatives, and tocopherol and its derivatives.

[0400] The term "lipid-like species," "lipid-like compound," or "lipid-like molecule" is with respect to a species that is structurally and / or functionally related to a lipid but can not be considered a lipid in the strictest sense. For example, the term includes compounds that are capable of forming an amphipathic layer when they are present in a vesicle, multilamellar / single lamellar liposome, or membrane in an aqueous environment, and includes surfactants or synthetic compounds with hydrophilic and hydrophobic moieties. In general, the term refers to molecules that comprise hydrophilic and hydrophobic moieties with different structural organization, which can or can not be similar to the hydrophilic and hydrophobic moieties of a lipid.

[0401] In some aspects, the RNA solution and its lipid formulation mixture or composition can comprise a cationic lipid, a neutral lipid, cholesterol, and / or a polymer (e.g., polyethylene glycol) conjugated lipid, which forms a lipid nanoparticle comprising the RNA molecule. Thus, in some aspects, the LNP can comprise a cationic lipid and one or more excipients, such as one or more neutral lipids, a charged lipid, a steroid or steroid analog (e.g., cholesterol), a polymer conjugated lipid (e.g., PEG-lipid), or a combination thereof. In some aspects, the LNP comprises or encapsulates a nucleic acid molecule.

[0402] i. Cationic Lipid

[0403] A cationic or cationizable lipid or lipidoid refers to a lipid or lipidoid that is capable of carrying a positive charge and is capable of electrostatically binding a nucleic acid. As used herein, “cationic lipid” or “cationic lipidoid” refers to a lipid or lipidoid that has a net positive charge. Cationic lipids or lipidoids bind to negatively charged nucleic acids through electrostatic interactions. Generally, cationic lipids have a lipophilic portion, such as a sterol, acyl chain, diacyl, or more acyl chains, and the head group of the lipid typically carries a positive charge. Exemplary cationic lipids include one or more amino groups that carry a positive charge. Cationic lipids can encapsulate negatively charged RNA.

[0404] In some aspects, the cationic lipid is ionizable, such that it can exist in a positively charged or neutral form depending on the pH. Ionization of the cationic lipid affects the surface charge of the lipid nanoparticle under different pH conditions. Without wishing to be bound by theory, it is believed that this ionizable behavior enhances efficacy via aiding in endosomal escape and reducing toxicity compared to particles that remain cationic at physiological pH. For the purposes of the present disclosure, the term “cationic lipid” or “cationic lipidoid” encompasses such “cationic ionizable” lipids or lipidoids, unless the context contradicts.

[0405] In some aspects, the cationic lipid can comprise about 10 mol% to about 100 mol%, about 20 mol% to about 100 mol%, about 30 mol% to about 100 mol%, about 40 mol% to about 100 mol%, or about 50 mol% to about 100 mol% of the total lipid present in the particle. In some aspects, the cationic lipid can be at least, at most, exactly, or an amount between any two of the following amounts of the total lipid present in the particle: 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, 90 mol%, or 100 mol%, or any range or value derivable therein.

[0406] Examples of cationic lipids include, but are not limited to: ((4-hydroxybutyl) azadialkyl) bis(hexane-6,1-diyl) bis(2-hexyldecanoate); 1,2-dioleoyl-3-trimethylammonium propane (DOTAP); N,N-dimethyl-2,3-dioleyloxypropylamine (DODMA), 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), 3-(N-(N',N'-dimethylaminoethane)-carbamoyl) cholesterol (DC-Chol), dimethyldioctadecyl ammonium (DDAB); 1,2-dioleoyl-3-dimethylammonium-propane (DODAP); 1,2-diacyloxy-3-dimethylammonium propane; 1,2-dialkoxy-3-dimethylammonium propane dioctadecyldimethylammonium chloride (DODAC), 1,2-distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 2,3-ditetradecyloxypropyl-(2-hydroxyethyl)-dimethylammonium (DMRIE), 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC), 1,2-dimyristoyl-3-trimethylammoniumpropane (DMTAP), 1,2-dioleyloxypropyl-3-dimethyl-hydroxyethylammonium bromide (DORIE), 2,3-dioleoyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propylammonium trifluoroacetate (DOSPA), 1,2-dilinoleyl-N,N-dimethylamino 1,2-dioleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DLenDMA), dioctadecylamidoglycylspermine (DOGS), 3-dimethylamino-2-(cholest-5-en-3-β-oxybut-4-oxy)-l-(cis,cis-9,12-octadecadienyloxy)propane (CLinDMA), 2-[5'-(cholest-5-en-3-β-oxy)-3'-oxopentyloxy)-3-dimethyl-l-(cis,cis-9',12'-octadecadienyloxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N'-dioleyloxy 1,2-Dilinoleylcarbamoyl-3-dimethylaminopropane (DLincarbDAP), 1,2-Dilinoleyloxycarbamoyl-3-dimethylaminopropane (DLinCDAP), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-K-XTC2-DMA), 2,2-Dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane3]-dioxolane (DLin-KC2-DMA), thirty-seven carbon-6,9,28,31-tetraene-19-yl-4- (dimethylamino)butanoate (DLin-MC3-DM A), N-(2-hydroxyethyl)-N,N-dimethyl-2,3- bis(tetradecyloxy)-l -propyl ammonium bromide (DMRIE), (±)-N-(3- aminopropyl)-N,N-dimethyl-2,3-bis(cis-9-tetradecenyl oxy)-l -propyl ammonium bromide (GAP-DMORIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(dodecyloxy)-l- propyl ammonium bromide (GAP-DLRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3- bis(tetradecyloxy)-l -propyl ammonium bromide (GAP-DMRIE), N-(2- aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-l -propyl ammonium bromide (bAE-DMRIE), N-(4-carboxybenzyl)-N,N-dimethyl-2,3-dioleoylpropan-1- ammonium (DOBAQ), 2-({8-[(3b)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-aminium (Octyl-CLinDMA), 1,2- dimyristoyl-3-dimethylammonium-propane (DMDAP), 1,2-dipalmitoyl-3- dimethylammonium-propane (DPDAP), N1-[2-((1S)-1-[(3- aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylformamido)ethyl]-3,4- di[oleyl oxy]-benzamide (MVL5), 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC), 2,3-bis(dodecyloxy)-N-(2-hydroxyethyl)-N,N-dimethylpropan-1- ammonium bromide (DLRIE), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)propan- 1- ammonium bromide (DMORIE), di((Z)-non-2-en-l-yl) 8,8'-((((2 (dimethylamino)ethyl)thio)carbonyl)azanediyl) dioctanoate (ATX), N,N-dimethyl-2,3- bis(dodecyloxy)propan-1-aminium (DLDMA), N,N-dimethyl-2,3-bis(tetradecyloxy)propan-1 -amine (DMDMA), di((Z)-non-2-en-l-yl)-9-((4- (dimethylaminobutyryloxy)heptadecanedioate (L319), N-dodecyl-3-((2- dodecylcarbamoyl-ethyl)-{2-[(2-dodecylcarbamoyl-ethyl)-2-{(2- dodecylcarbamoyl-ethyl)-[2-(2-dodecylcarbamoyl-ethylamino)-ethyl]-amino}- ethylamino)propanamide (Lipidoid 98N12-5), 1 -[2-[bis(2-hydroxydodecyl)amino] ethyl-[2-[4-[2-[bis(2-hydroxydodecyl)amino]ethyl]piperazin- 1 -yl]ethyl]amino]dodecan-2-ol (Lipidoid 02-200); or 8-((2-hydroxyethyl)(6-oxo-6- (undecyloxy)hexyl)amino)octanoic acid heptadecan-9-yl ester (SM-102).

[0407] In some aspects, the lipid nanoparticle comprises one or more cationic lipids. In one aspect, the lipid nanoparticle comprises (4-hydroxybutyl)azanediyl bis(hexane-6,1- diyl)bis(2-hexyldecanoate) (ALC-0315), which has the following formula:

[0408]

[0409] Cationic lipids are disclosed, for example, in U.S. 10,166,298, the entire disclosure of which is incorporated by reference herein in its entirety for all purposes.

[0410] In some aspects, the RNA-LNP comprises a cationic lipid, an RNA molecule as described herein, and one or more of a neutral lipid, a sterol, a PEGylated lipid, or a combination thereof. If more than one cationic lipid is incorporated into the LNP, such percentages apply to the combined cationic lipids. In one aspect, the cationic lipid is present in the LNP in an amount such as at least, at most, exactly, or any amount between any two of the following amounts: about 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 molar percent, respectively.

[0411] In some aspects of the disclosure, the LNP comprises a combination or mixture of any of the lipids described above.

[0412] ii. Polymer conjugated lipids

[0413] In some aspects, the LNP comprises a polymer-conjugated lipid. The term "polymer-conjugated lipid" refers to a molecule comprising both a lipid moiety and a polymer moiety. An example of a polymer-conjugated lipid is a pegylated lipid. The term "pegylated lipid" refers to a molecule comprising both a lipid moiety and a polyethylene glycol moiety. Pegylated lipids are known in the art and include 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoyl glycerol (PEG-s-DMG), 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, and the like.

[0414] In certain aspects, the LNP comprises an additional stabilizing lipid, which is a polyethylene glycol lipid (pegylated lipid). A polymer-conjugated lipid (e.g., PEG-lipid) refers to a molecule comprising both a lipid moiety and a polymer moiety. An example of a polymer-conjugated lipid is a PEG-lipid. A PEG-lipid refers to a molecule comprising both a lipid moiety and a polyethylene glycol moiety. PEG-lipids include, but are not limited to, PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides (e.g., PEG-CerC14or PEG-CerC20), PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols. Representative polyethylene glycol lipids include PEG-c-DOMG, PEG-c-DMA, and PEG-s-DMG. In one aspect, the polyethylene glycol lipid is N-[(methoxypolyethylene glycol) 2000]carbamoyl]-1,2-dimyristoyloxyprop-3- amine (PEG-c-DMA). In one aspect, the polyethylene glycol lipid is PEG-2000-DMG. In one aspect, the polyethylene glycol lipid is PEG-c-DOMG. In other aspects, the LNP comprises a pegylated diacylglycerol (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoyl glycerol (PEG-DMG), pegylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEG-S-DAG), such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-((ortho methoxy(polyethoxy)ethyl) succinate (PEG-S-DMG), pegylated ceramide (PEG-cer), or a PEG dialaurylpropyl carbamate, such as co-poly-methoxy(polyethoxy)ethyl-N-(2,3 di(tetradecanoyloxy)propyl)carbamate or 2,3-di(tetradecanoyloxy)propyl-N-(u- methoxy(polyethoxy)ethyl)carbamate. PEG-lipids are disclosed, for example, in U.S. 9,737,619, the entire disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0415] In some aspects, the lipid nanoparticle comprises a polymer-conjugated lipid. In one aspect, the lipid nanoparticle comprises 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159), which has the following formula:

[0416]

[0417] In various aspects, the molar ratio of cationic lipid to PEGylated lipid is in the range of about 100:1 to about 20:1, such as about 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, 55:1, 60:1, 65:1, 70:1, 75:1, 80:1, 85:1, 90:1, 95:1, or 100:1, or any range or value derived therefrom.

[0418] In certain aspects, the PEG-lipid is present in the LNP in an amount of about 1 to about 10 mole percent (mol%) (e.g., at least, at most, exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mol% or any mol% between any two of these values) relative to the total lipid content of the nanoparticle.

[0419] iii. Additional Lipids

[0420] In certain aspects, the LNP comprises one or more additional lipids or lipid-like substances that stabilize the formation of the particles during particle formation. Suitable stabilizing or structural lipids include non-cationic lipids, such as neutral lipids and anionic lipids. Without being bound by any theory, optimizing the formulation of the LNP by adding other hydrophobic moieties, such as cholesterol and lipids other than ionizable / cationic lipids or lipid-like substances, can enhance particle stability and nucleic acid delivery efficacy.

[0421] As used herein, “anionic lipid” refers to any lipid that carries a negative charge at the selected pH. The term “neutral lipid” refers to any one of a variety of lipid species that exist in uncharged or neutral zwitterionic form at physiological pH. In some aspects, the additional lipid comprises one of the following neutral lipid components: (1) a phospholipid; (2) cholesterol or a derivative thereof; or (3) a mixture of a phospholipid and cholesterol or a derivative thereof.

[0422] Representative neutral lipids include phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidic acid, phosphatidylserine, ceramide, sphingomyelin, dihydrosphingomyelin, cerebroside, and sulfatide. Exemplary phospholipids include, for example, phosphatidylcholine, e.g., diacylphosphatidylcholine, such as distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), dipentadecanoylphosphatidylcholine, dilauricphosphatidylcholine, dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), diarachidoylphosphatidylcholine (DAPC), dibehenoylphosphatidylcholine (DBPC), ditricosanoylphosphatidylcholine (DTPC), ditetracosanoylphosphatidylcholine (DLPC), palmitoyloleoylphosphatidylcholine (POPC), l,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), l-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), and l-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC); and phosphatidylethanolamine, e.g., diacylphosphatidylethanolamine, such as dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), and dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), dilauricphosphatidylethanolamine (DLPE), distearoylphosphatidylethanolamine (DSPE), diphytanyiphosphatidylethanolamine (DpyPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1 -trans PE, l-stearoyl-2-oleoylphosphatidylethanolamine (SOPE), and l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (trans DOPE). In one aspect, the neutral lipid is l,2-distearoyl-sn-glycero-3phosphocholine (DSPC), which has the following formula:

[0423]

[0424] In some aspects, the LNP comprises a neutral lipid, and the neutral lipid comprises one or more of DSPC, DPPC, DMPC, DOPC, POPC, DOPE, or SM.

[0425] In various aspects, the LNP further comprises a steroid or steroid analog. A “steroid” is a compound comprising the following carbon skeleton:

[0426]

[0427] In certain aspects, the steroid or steroid analog is cholesterol. Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, tocopherol and derivatives thereof, and mixtures thereof. In one aspect, the cholesterol has the following formula:

[0428]

[0429] Without being bound by any theory, the amount of at least one cationic lipid can influence important nucleic acid particle characteristics, such as charge of the nucleic acid, particle size, stability, tissue selectivity, and biological activity, compared to the amount of at least one additional lipid. Thus, in some aspects, the molar ratio of cationic lipid to neutral lipid is in the range of about 2: 1 to about 8: 1, or about 10:0 to about 1:9, about 4: 1 to about 1:2, or about 3: 1 to about 1: 1.

[0430] In some aspects, the non-cationic lipid, e.g., neutral lipid (e.g., one or more phospholipids and / or cholesterol), can comprise about 0 mol% to about 90 mol%, about 0 mol% to about 80 mol%, about 0 mol% to about 70 mol%, about 0 mol% to about 60 mol%, or about 0 mol% to about 50 mol% of the total lipid present in the particle. In some aspects, the non-cationic lipid, e.g., neutral lipid (e.g., one or more phospholipids and / or cholesterol), can be at least, at most, exactly, or any amount between any two of the following amounts of the total lipid present in the particle: 0 mol%, 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, or 90 mol%.

[0431] VI. Characterization and Analysis of RNA Molecules

[0432] The RNA molecules described herein can be analyzed and characterized using various methods. Analysis can be performed before or after capping. Alternatively, analysis can be performed before or after affinity purification based on poly-A capture. In another aspect, analysis can be performed before or after additional purification steps, such as anion exchange chromatography and the like. For example, RNA template quality can be determined using a bioanalyzer chip-based electrophoresis system. In other aspects, RNA template purity is analyzed using analytical reverse phase HPLC, respectively. Capping efficiency can be analyzed using, for example, total nuclease digestion followed by MS / MS quantitation of di-nucleotide cap species versus un-capped GTP species. In vitro potency can be analyzed by, for example, transfecting the RNA molecule into a human cell line. Protein expression of the polypeptide of interest can be quantified using methods such as ELISA or flow cytometry. Immunogenicity can be analyzed by, for example, transfecting the RNA molecule into a cell line indicative of innate immune stimulation (e.g., PBMC). Cytokine induction can be analyzed using, for example, methods such as ELISA to quantify cytokines, e.g., interferon-a. Bio-distribution can be analyzed, for example, by bioluminescence measurement.

[0433] In some aspects, the RNA polynucleotides disclosed herein are characterized by observing, relative to an appropriate reference, when an organism is administered a composition or pharmaceutical formulation comprising the RNA polynucleotide: increased expression of a gene of interest (e.g., an antigen); increased duration of expression of a gene of interest (e.g., long-term expression); increased expression and increased duration of expression of a gene of interest (e.g., long-term expression); decreased interaction of the RNA polynucleotide with IFIT1; increased translation of the RNA polynucleotide.

[0434] In some aspects, the reference comprises an organism administered an RNA polynucleotide that is otherwise similar but does not have a m7(3'OMeG)(5')ppp(5')(2'OMeAi)pG2 cap. In some aspects, the reference comprises an organism administered an RNA polynucleotide that is otherwise similar but does not have a cap-proximal sequence disclosed herein. In some aspects, the reference comprises an organism administered an RNA polynucleotide that is otherwise similar but has a self-hybridizing sequence.

[0435] In some aspects, the elevated expression is determined at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours after administration of the composition or pharmaceutical formulation comprising the RNA polynucleotide. In some aspects, the elevated expression is determined at least 24 hours after administration of the composition or pharmaceutical formulation comprising the RNA polynucleotide. In some aspects, the elevated expression is determined at least 48 hours after administration of the composition or pharmaceutical formulation comprising the RNA polynucleotide. In some aspects, the elevated expression is determined at least 72 hours after administration of the composition or pharmaceutical formulation comprising the RNA polynucleotide. In some aspects, the elevated expression is determined at least 96 hours after administration of the composition or pharmaceutical formulation comprising the RNA polynucleotide. In some aspects, the elevated expression is determined at least 120 hours after administration of the composition or pharmaceutical formulation comprising the RNA polynucleotide.

[0436] In some aspects, the elevated expression is determined about 24-120 hours after administration of the composition or pharmaceutical formulation comprising the RNA polynucleotide. In some aspects, the elevated expression is determined about 24-110 hours, about 24-100 hours, about 24-90 hours, about 24-80 hours, about 24-70 hours, about 24-60 hours, about 24-50 hours, about 24-40 hours, about 24-30 hours, about 30-120 hours, about 40-120 hours, about 50-120 hours, about 60-120 hours, about 70-120 hours, about 80-120 hours, about 90-120 hours, about 100-120 hours, or about 110-120 hours after administration of the composition or pharmaceutical formulation comprising the RNA polynucleotide.

[0437] In some aspects, the expression of the gene of interest (e.g., antigen) is elevated at least 2-fold to at least 10-fold. In some aspects, the expression of the gene of interest (e.g., antigen) is elevated at least 2-fold. In some aspects, the expression of the gene of interest (e.g., antigen) is elevated at least 3-fold. In some aspects, the expression of the gene of interest (e.g., antigen) is elevated at least 4-fold. In some aspects, the expression of the gene of interest (e.g., antigen) is elevated at least 6-fold. In some aspects, the expression of the gene of interest (e.g., antigen) is elevated at least 8-fold. In some aspects, the expression of the gene of interest (e.g., antigen) is elevated at least 10-fold.

[0438] In some aspects, expression of the gene of interest (e.g., antigen) is increased by about 2-fold to about 50-fold. In some aspects, expression of the gene of interest (e.g., antigen) is increased by about 2-fold to about 45-fold, about 2-fold to about 40-fold, about 2-fold to about 30-fold, about 2-fold to about 25-fold, about 2-fold to about 20-fold, about 2-fold to about 15-fold, about 2-fold to about 10-fold, about 2-fold to about 8-fold, about 2-fold to about 5-fold, about 5-fold to about 50-fold, about 10-fold to about 50-fold, about 15-fold to about 50-fold, about 20-fold to about 50-fold, about 25-fold to about 50-fold, about 30-fold to about 50-fold, about 40-fold to about 50-fold, or about 45-fold to about 50-fold. In some aspects, expression of the gene of interest (e.g., antigen) is increased by at least, at most, exactly, or a number of multiples between any two of the following: 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, 22-fold, 23-fold, 24-fold, 25-fold, 26-fold, 27-fold, 28-fold, 29-fold, 30-fold, 31-fold, 32-fold, 33-fold, 34-fold, 35-fold, 36-fold, 37-fold, 38-fold, 39-fold, 40-fold, 41-fold, 42-fold, 43-fold, 44-fold, 45-fold, 46-fold, 47-fold, 48-fold, 49-fold, or 50-fold, or any range or value derivable therein.

[0439] In some aspects, the increase in expression of the gene of interest (e.g., antigen) (e.g., increase in duration of expression) lasts for at least, at most, exactly, or a time between any two of the following: 24 hours, 48 hours, 72 hours, 96 hours, or 120 hours after administration of the composition or pharmaceutical formulation comprising the RNA polynucleotide. In some aspects, the increase in expression of the gene of interest (e.g., antigen) lasts for at least 24 hours after administration. In some aspects, the increase in expression of the gene of interest (e.g., antigen) lasts for at least 48 hours after administration. In some aspects, the increase in expression of the gene of interest (e.g., antigen) lasts for at least 72 hours after administration. In some aspects, the increase in expression of the gene of interest (e.g., antigen) lasts for at least 96 hours after administration. In some aspects, the increase in expression of the gene of interest (e.g., antigen) lasts for at least 120 hours after administration of the composition or pharmaceutical formulation comprising the RNA polynucleotide.

[0440] In some aspects, the elevated expression of the gene of interest (e.g., antigen) lasts for about 24-120 hours after administration of the composition or pharmaceutical formulation comprising the RNA polynucleotide. In some aspects, the elevated expression lasts for about 24-110 hours, about 24-100 hours, about 24-90 hours, about 24-80 hours, about 24-70 hours, about 24-60 hours, about 24-50 hours, about 24-40 hours, about 24-30 hours, about 30-120 hours, about 40-120 hours, about 50-120 hours, about 60-120 hours, about 70-120 hours, about 80-120 hours, about 90-120 hours, about 100-120 hours, or about 110-120 hours after administration of the composition or pharmaceutical formulation comprising the RNA polynucleotide. In some aspects, the elevated expression of the gene of interest (e.g., antigen) lasts for at least, at most, exactly, or any time in between, the following times: 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, 84 hours, 96 hours, 108 hours, or 120 hours, or any range or value derivable therein.

[0441] VII. Immune responses and assays

[0442] As discussed herein, the present disclosure relates to eliciting or inducing an immune response in a human subject against a VZV protein (e.g., wild-type or variant VZV glycoprotein). In one aspect, the immune response can protect a human subject from contracting an infection or related disease, particularly those infections or related diseases associated with VZV, or treating a human subject who has, is suspected of having, or is at risk of having the infection or related disease. One use of the immunogenic compositions of the present disclosure is to prevent VZV infection by vaccinating or immunizing a human subject.

[0443] A. Immune assays

[0444] The present disclosure includes conducting serological assays to assess whether and to what extent an immune response is induced or elicited by the compositions of the present disclosure. Many types of immune assays can be conducted. Immune assays encompassed by the present disclosure include, but are not limited to, those described in U.S. Patent 4,367,110 (double monoclonal antibody sandwich assay) and U.S. Patent 4,452,901 (Western blot). Other assays include immunoprecipitation and immunocytochemistry of labeled ligands, both in vitro and in vivo.

[0445] Immunoassays are generally binding assays. In some aspects, the immunoassay is an enzyme-linked immunosorbent assay (ELISA) and a radioimmunoassay (RIA) of the various types known in the art. Immunochemical detection using tissue sections is also particularly useful. In one example, antibodies or antigens are immobilized on a selected surface, such as the wells in a polystyrene microtiter plate, a test strip, or a column support. Next, a test composition suspected of containing the desired antigen or antibody, such as a clinical sample, is added to the wells. After binding and washing to remove non-specifically bound immunocomplexes, the bound antigen or antibody can be detected. Detection is generally achieved by adding another antibody specific for the desired antigen or antibody that is linked to a detectable label. This type of ELISA is referred to as a "sandwich ELISA." Detection can also be achieved by adding a second antibody specific for the desired antigen, followed by the addition of a third antibody that has binding affinity for the second antibody, where the third antibody is linked to a detectable label.

[0446] A competitive ELISA is also a possible embodiment in which the test sample competes with a known amount of labeled antigen or antibody for binding. The amount of reactive species in the unknown sample is determined by mixing the sample with the known labeled species prior to or during incubation with the coated wells. The presence of reactive species in the sample serves to reduce the amount of labeled species available to bind to the wells, and thus reduce the final signal. Regardless of the form employed, ELISAs have certain common features, such as coating, incubation or binding, washing to remove non-specifically bound species, and detection of bound immunocomplexes.

[0447] Antigens or antibodies can also be linked to solid supports, such as solid supports in the form of plates, beads, test strips, membranes, or column matrices, and the sample to be analyzed is applied to the immobilized antigens or antibodies. In coating plates with antigens or antibodies, the wells of the culture plate are generally incubated with the antigen or antibody solution overnight or for a specified time. The wells of the culture plate are then washed to remove incompletely adsorbed material. Next, any residual available surface of the wells is "coated" with a non-specific protein that is antigenically neutral to the test antisera. Proteins include bovine serum albumin (BSA), casein, and milk powder solutions. This coating allows for blocking of non-specific adsorption sites on the immobilization surface and thus reduces background due to non-specific binding of antisera to the surface.

[0448] B. Diagnosis of VZV infection

[0449] The present disclosure encompasses the use of VZV polypeptides, proteins, and / or peptides in a variety of ways, including detecting the presence of VZV to diagnose infection. In accordance with the present disclosure, methods of detecting the presence of infection involve the step of obtaining a sample suspected of being infected with one or more strains of VZV, such as a sample obtained from a subject, for example, a sample obtained from blood, saliva, tissue, bone, muscle, cartilage, or skin. After the sample is isolated, diagnostic assays utilizing the polypeptides, proteins, and / or peptides of the present disclosure can be performed to detect the presence of VZV, and such assay techniques for determining the presence of such in a sample are well known to those of skill in the art, and include methods such as radioimmunoassays, Western blot analysis, and ELISA assays.

[0450] In general, in accordance with the present disclosure, a method of diagnosing infection is contemplated, wherein a sample suspected of being infected with VZV is added to a polypeptide, protein, or peptide according to the present disclosure, and VZV is indicated by binding of an antibody to the polypeptide, protein, and / or peptide or binding of the polypeptide, protein, and / or peptide to an antibody in the sample.

[0451] Accordingly, RNA molecules encoding VZV polypeptides, proteins, and / or peptides according to the present disclosure can be used to treat, prevent, or reduce the severity of a disease caused by infection with VZV (e.g., active or passive immunization) or as a research tool.

[0452] Any of the above polypeptides, proteins, and / or peptides can be directly labeled with a detectable label in order to identify and quantify VZV. Labels suitable for use in immunoassays are generally known to those of skill in the art, and include enzymes, radioisotopes, and fluorescent, luminescent, and chromogenic substances, including colored particles such as colloidal gold or latex beads. Suitable immunoassays include enzyme-linked immunosorbent assays (ELISA).

[0453] C. Protective immunity

[0454] In some aspects of the present disclosure, RNA molecules encoding VZV polypeptides, RNA-LNPs, and compositions thereof confer protective immunity to a human subject. Protective immunity refers to the body’s ability to establish a specific immune response that protects a human subject from contracting a particular disease or condition, which involves an agent against which an immune response exists. An immunogenically effective amount is capable of conferring protective immunity to a human subject.

[0455] As used herein, the phrase "immune response" or its equivalent "immunological response" refers to the generation of a humoral response (antibody-mediated), a cellular response (mediated by antigen-specific T cells or their secreted products), or both, directed against an antigen. Such a response can be an active response or a passive response. A cellular immune response is elicited by the presentation of a polypeptide epitope in association with MHC class I or class II molecules to activate antigen-specific CD4(+) T helper cells and / or CD8(+) cytotoxic T cells. The response can also involve the activation of monocytes, macrophages, NK cells, basophils, dendritic cells, astrocytes, microglia, eosinophils, or other components of innate immunity. As used herein, "active immunity" refers to any immunity conferred on a human subject by the production of antibodies in response to the presence of an antigen, such as a VZV polypeptide encoded by an RNA molecule of the disclosure.

[0456] As used herein, "passive immunity" includes, but is not limited to, the administration of activated immune effectors, including cellular mediators or protein mediators of an immune response, such as monoclonal and / or polyclonal antibodies. Monoclonal or polyclonal antibody compositions can be used for passive immunization to treat, prevent, or reduce the severity of a disease caused by infection with an organism bearing an antigen recognized by the antibodies. The antibody composition can include antibodies that bind to multiple antigens, which in turn can be associated with various organisms. The antibody component can be polyclonal antisera. In certain aspects, one or more antibodies are affinity purified from an animal or a second subject that has been challenged with an antigen. Alternatively, a mixture of antibodies can be used, which is a mixture of monoclonal and / or polyclonal antibodies directed against antigens present in the same, related, or different microorganism or organism, such as a virus, including but not limited to VZV.

[0457] Passive immunity can be conferred on a patient or human subject by administering to the patient immunoglobulins (Ig) and / or other immune factors obtained from a donor or other non-patient source that has a known immune response. In other aspects, a human subject can be administered an immunogenic composition of the disclosure, who then serves as a source or donor of globulin containing antibodies against VZV or other organism that are produced in response to challenge by the immunogenic composition ("hyperimmune globulin"). The human subject so treated will donate plasma from which the hyperimmune globulin is obtained via conventional plasma separation methods, and administered to another human subject to confer resistance to or treat VZV infection.

[0458] For the purposes of the present specification and the accompanying claims, the terms "epitope" and "antigenic determinant" are used interchangeably to refer to a site on an antigen that is responded to or recognized by B and / or T cells. B cell epitopes can be formed both by contiguous amino acids or non-contiguous amino acids that get brought into proximity by the tertiary folding of the protein. Epitopes formed by contiguous amino acids are usually retained upon exposure to denaturing solvents, whereas epitopes formed by tertiary folding are usually lost upon treatment with denaturing solvents. Epitopes usually comprise at least 3 and more usually at least 5 or 8 to 10 amino acids in a unique spatial conformation. Methods of determining the spatial conformation of an epitope include, for example, x-ray crystallography and 2-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols (1996). Antibodies that recognize the same epitope can be distinguished in a simple immunoassay that shows the ability of one antibody to block the binding of the other to the antigen of interest. T cells recognize contiguous epitopes of about nine amino acids for CD8 cells or about 13 to 15 amino acids for CD4 cells. T cells recognizing an epitope can be identified by in vitro assays, by antigen-dependent killing (cytotoxic T lymphocyte assay, Tigges et al., 1996) or by cytokine secretion 3 H-thymidine incorporation was determined (Burke et al., 1994).

[0459] The presence of a cell-mediated immune response can be determined by proliferation assays (CD4(+) T cells) or CTL (cytotoxic T lymphocyte) assays. The relative contribution of humoral and cellular responses to the protective or therapeutic effect of an immunogenic composition can be distinguished by isolating IgG and T cells from immunized syngeneic animals, respectively, and measuring the protective or therapeutic effect in a second human subject.

[0460] As used herein, the terms "antibody" or "immunoglobulin" are used interchangeably and refer to any of several classes of structurally related proteins that function as part of the immune response of an animal or recipient, including IgG, IgD, IgE, IgA, IgM, and related proteins. Under normal physiological conditions, antibodies are found in the plasma and other bodily fluids and in the membranes of certain cells, and are produced by lymphocytes of the B cell type or their functional equivalents as indicated by the type.

[0461] As used herein, the terms "immunogenic agent" or "immunogen" or "antigen" are used interchangeably to describe a molecule that is capable of inducing an immune response against itself when administered to a recipient, either alone, in combination with an adjuvant, or presented on a delivery vehicle.

[0462] VIII. Compositions

[0463] In some aspects, the RNA molecules and / or RNA-LNPs disclosed herein can be administered in the form of a pharmaceutical composition or medicament and can be administered in any form suitable for a pharmaceutical composition. In some aspects, the pharmaceutical composition is for therapeutic or prophylactic treatment. In one aspect, the disclosure relates to a composition for administration to a host. In some aspects, the host is a human. In other aspects, the host is a non-human.

[0464] In some aspects, the RNA molecules and / or RNA-LNPs disclosed herein can be administered in the form of a pharmaceutical composition, which can be formulated into preparations in solid, semi-solid, liquid, lyophilized, frozen or gaseous forms. In some aspects, the RNA molecules and / or RNA-LNPs disclosed herein can be administered in the form of a pharmaceutical composition, which can comprise a pharmaceutically acceptable carrier and can optionally comprise one or more adjuvants, stabilizers, salts, buffers, preservatives, and optionally other therapeutic agents. In some aspects, the pharmaceutical compositions disclosed herein comprise one or more pharmaceutically acceptable carriers, diluents, and / or excipients. In some aspects, the pharmaceutical composition does not include an adjuvant (e.g., it is free of adjuvants).

[0465] Preservatives suitable for use in the pharmaceutical compositions of the disclosure include, but are not limited to, benzalkonium chloride, chlorbutanol, parabens, and thimerosal. The term “excipient,” as used herein, refers to a substance that can be present in a pharmaceutical composition of the disclosure, but that is not an active ingredient. Examples of excipients include, but are not limited to, carriers, binders, diluents, lubricants, thickening agents, surface active agents, preservatives, stabilizers, emulsifiers, buffers, flavoring agents, or coloring agents.

[0466] The term “diluent” is with respect to a diluting and / or thinning agent. Further, the term “diluent” includes any one or more of a fluid, liquid, or solid suspension and / or mixing medium. Examples of suitable diluents include ethanol, glycerin saline, and water.

[0467] The term “carrier” refers to a component that can be natural, synthetic, organic, inorganic, into which an active ingredient is incorporated in order to facilitate, enhance, or enable administration of the pharmaceutical composition. A carrier, as used herein, can be one or more compatible solid or liquid fillers, diluents, or encapsulating substances that are suitable for administration to a subject. Suitable carriers include, but are not limited to, sterile water, Ringer’s solution, lactated Ringer’s solution, sterile sodium chloride solution, isotonic saline, polyalkylene glycols, hydronaphthalene, and especially biocompatible lactide polymers, lactide / glycolide copolymers, or polyoxyethylene / polyoxypropylene copolymers. In some aspects, the pharmaceutical compositions of the disclosure include sodium chloride.

[0468] Pharmaceutically acceptable carriers, excipients, or diluents for therapeutic use are well-known in the medical arts, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro ed. 1985).

[0469] The pharmaceutical carrier, excipient, or diluent can be chosen by consideration of the intended route of administration and standard pharmaceutical practice.

[0470] In some aspects, the composition comprises an RNA molecule comprising an open reading frame encoding an immunogenic polypeptide. In some aspects, the immunogenic polypeptide comprises a VZV antigen. In some aspects, the VZV antigen is a VZV polypeptide. In some aspects, the VZV polypeptide is a VZV glycoprotein (e.g., gK, gN, gC, gB, gH, gM, gL, gI, and gE) or a fragment or variant thereof. In some aspects, the RNA molecule encodes a VZV gK polypeptide, the RNA molecule encodes a VZV gN polypeptide, the RNA molecule encodes a VZV gC polypeptide, the RNA molecule encodes a VZV gB polypeptide, the RNA molecule encodes a VZV gH polypeptide, the RNA molecule encodes a VZV gM polypeptide, the RNA molecule encodes a VZV gL polypeptide, the RNA molecule encodes a VZV gI polypeptide, and / or the RNA molecule encodes a VZV gE polypeptide. In one aspect, the RNA molecule encodes a VZV gE polypeptide. In some aspects, the VZV polypeptide comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or more) VZV polypeptides.

[0471] In some aspects, the composition comprises an RNA molecule comprising an open reading frame encoding a full-length VZV polypeptide. In some aspects, the encoded immunogenic polypeptide is a truncated VZV polypeptide. In some aspects, the encoded immunogenic polypeptide is a variant of a VZV polypeptide. In some aspects, the encoded immunogenic polypeptide is a fragment of a VZV polypeptide.

[0472] A. Immunogenic compositions comprising LNPs

[0473] In some aspects, the pharmaceutical compositions comprise the RNA molecules (e.g., polynucleotides) disclosed herein formulated with a lipid-based delivery system. Thus, in some aspects, the compositions include a lipid-based delivery system (e.g., LNP) (e.g., a lipid-based vaccine) that delivers a nucleic acid molecule to the interior of a cell, which nucleic acid molecule can then replicate, suppress expression of a protein of interest, and / or express an encoded polypeptide of interest inside the cell. The delivery system can have an adjuvant effect that enhances the immunogenicity of the encoded antigen. In some aspects, the compositions comprise at least one RNA molecule encoding a VZV polypeptide that is complexed with, encapsulated in, and / or formulated with one or more lipids, and forms a lipid nanoparticle (LNP), a liposome, a lipoplex, and / or a nanoliposome. In some aspects, the compositions comprise a lipid nanoparticle. Thus, in certain aspects, the disclosure relates to compositions comprising one or more lipids associated with a nucleic acid or polypeptide / peptide (e.g., VZV RNA-LNP).

[0474] In some cases, the immunogenic compositions comprising a lipid-based delivery system can further include one or more salts and / or one or more pharmaceutically acceptable surfactants, preservatives, carriers, diluents, and / or excipients. In some aspects, the immunogenic compositions comprising a lipid-based delivery system further include a pharmaceutically acceptable vehicle. In some aspects, each of a buffer, a stabilizer, and optionally a salt can be included in the immunogenic compositions comprising a lipid-based delivery system. In other aspects, any one or more of a buffer, a stabilizer, a salt, a surfactant, a preservative, and an excipient can not be included in the immunogenic compositions comprising a lipid-based delivery system.

[0475] In another aspect, the immunogenic composition comprising a lipid-based delivery system further comprises a stabilizer. In some aspects, the stabilizer comprises sucrose, mannose, sorbitol, raffinose, trehalose, mannitol, myo-inositol, sodium chloride, arginine, lactose, hydroxyethyl starch, polydextrose, polyvinylpyrrolidone, glycine, or a combination thereof. In some aspects, the stabilizer is a disaccharide or a sugar. In one aspect, the stabilizer is sucrose. In another aspect, the stabilizer is trehalose. In another aspect, the stabilizer is a combination of sucrose and trehalose. In some aspects, the total concentration of the stabilizer in the composition is about 5% to about 10% w / v. For example, the total concentration of the stabilizer can be at least, at most, exactly equal to, or between any two of: 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% w / v, or can be derived from any range or value therein. In some aspects, the stabilizer concentration includes, but is not limited to, a concentration of about 10 mg / mL to about 400 mg / mL, about 100 mg / mL to about 200 mg / mL, about 100 mg / mL to about 150 mg / mL, about 100 mg / mL to about 140 mg / mL, about 100 mg / mL to about 130 mg / mL, about 100 mg / mL to about 120 mg / mL, about 100 mg / mL to about 110 mg / mL, or about 100 mg / mL to about 105 mg / mL. In some aspects, the concentration of the stabilizer is at least, at most, exactly equal to, or between any two of: 10 mg / mL, 20 mg / mL, 50 mg / mL, 100 mg / mL, 101 mg / mL, 102 mg / mL, 103 mg / mL, 104 mg / mL, 105 mg / mL, 106 mg / mL, 107 mg / mL, 108 mg / mL, 109 mg / mL, 110 mg / mL, 150 mg / mL, 200 mg / mL, 300 mg / mL, 400 mg / mL, or higher.

[0476] In another aspect, the amount of stabilizer by mass is in a particular ratio to the amount of RNA by mass. In one aspect, the ratio of stabilizer to the amount of RNA by mass is no more than 5000. In another aspect, the ratio of stabilizer to the amount of RNA by mass is no more than 2000. In another aspect, the ratio of stabilizer to the amount of RNA by mass is no more than 1000. In another aspect, the ratio of stabilizer to the amount of RNA by mass is no more than 500. In another aspect, the ratio of stabilizer to the amount of RNA by mass is no more than 100. In another aspect, the ratio of stabilizer to the amount of pharmaceutical substance by mass is no more than 50. In another aspect, the ratio of stabilizer to the amount of RNA by mass is no more than 10. In another aspect, the ratio of stabilizer to the amount of RNA by mass is no more than 1. In another aspect, the ratio of stabilizer to the amount of RNA by mass is no more than 0.5. In another aspect, the ratio of stabilizer to the amount of RNA by mass is no more than 0.1. In another aspect, the stabilizer and RNA comprise a mass ratio of stabilizer to RNA of about 200 to 2000: 1.

[0477] In some aspects, the immunogenic composition comprising a lipid-based delivery system further comprises a buffer. Examples of buffers include, but are not limited to, citrate buffered solutions, acetate buffered solutions, phosphate buffered solutions, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glucoheptonate, calcium gluconate, d-gluconic acid, glycerophosphates calcium, calcium lactate, calcium lactobionate, propionic acid, calcium levulinate, valeric acid, calcium hydrogen phosphate, phosphoric acid, calcium phosphate, calcium hydrogen phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dipotassium hydrogen phosphate, monopotassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, disodium hydrogen phosphate, monosodium phosphate, sodium phosphate mixtures, tromethamine, Tris hydrochloric acid (HC1), sulfamate buffers (e.g., HEPES), magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethanol, and / or combinations thereof. In some aspects, the buffer is a HEPES buffer, a Tris buffer, or a PBS buffer. In one aspect, the buffer is a Tris buffer. In another aspect, the buffer is a HEPES buffer. In another aspect, the buffer is a PBS buffer. For example, the buffer concentration can be at least, at most, exactly equal to, or between any two of: 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, or 20 mM, or any range or value derived therefrom. The buffer can be at neutral pH, pH 6.5 to 8.5, pH 7.0 to pH 8.0, or pH 7.2 to pH 7.6. For example, the buffer can be at least, at most, exactly, or between any two of the following pH: 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, or 8.5, or any range or value derived therefrom. In particular aspects, the buffer is at pH 7.4.

[0478] In some aspects, the immunogenic compositions comprising a lipid-based delivery system can further comprise a salt. Examples of salts include, but are not limited to, sodium salts and / or potassium salts. In one aspect, the salt is a sodium salt. In one particular aspect, the sodium salt is sodium chloride. In one aspect, the salt is a potassium salt. In some aspects, the potassium salt comprises potassium chloride. The concentration of the salt in the composition can be from about 70 mM to about 140 mM. For example, the concentration of the salt can be at least, at most, exactly equal to, or between any two of, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM, 120 mM, 130 mM, 140 mM, 150 mM, 160 mM, 170 mM, 180 mM, 190 mM, or 200 mM.

[0479] In some aspects, the concentration of the salt includes, but is not limited to, a concentration of from about 1 mg / mL to about 100 mg / mL, from about 1 mg / mL to about 50 mg / mL, from about 1 mg / mL to about 40 mg / mL, from about 1 mg / mL to about 30 mg / mL, from about 1 mg / mL to about 20 mg / mL, from about 1 mg / mL to about 10 mg / mL, or from about 1 mg / mL to about 15 mg / mL. In some aspects, the concentration of the salt is at least, at most, exactly equal to, or between any two of, 1 mg / mL, 2 mg / mL, 3 mg / mL, 4 mg / mL, 5 mg / mL, 6 mg / mL, 7 mg / mL, 8 mg / mL, 9 mg / mL, 10 mg / mL, 11 mg / mL, 12 mg / mL, 13 mg / mL, 14 mg / mL, 15 mg / mL, 16 mg / mL, 17 mg / mL, 18 mg / mL, 19 mg / mL, 20 mg / mL, or higher. The salt can be at neutral pH, at pH 6.5 to 8.5, at pH 7.0 to pH 8.0, or at pH 7.2 to pH 7.6. For example, the salt can be at a pH that is at least, at most, exactly equal to, or between any two of, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, or 8.5.

[0480] In some aspects, the immunogenic composition comprising a lipid-based delivery system further comprises a surfactant, a preservative, any other excipient, or a combination thereof. As used herein, "any other excipient" includes, but is not limited to, an antioxidant, glutathione, EDTA, methionine, desferal, an antioxidant, a metal chelator, or a free radical scavenger. In one aspect, the surfactant, preservative, excipient, or combination thereof is sterile water for injection (sWFI), bacteriostatic water for injection (BWFI), saline, dextrose solution, a polysorbate, a poloxamer, a Triton, a divalent cation, lactated Ringer's solution, an amino acid, a sugar, a polyol, a polymer, or a cyclodextrin.

[0481] An excipient refers to a component of the immunogenic composition that is not an active ingredient, examples of which include, but are not limited to, a carrier, a binder, a diluent, a lubricant, a thickening agent, a surfactant, a preservative, a stabilizer, an emulsifier, a buffer, a flavoring agent, a disintegrant, a coating, a plasticizer, a compression agent, a wet granulating agent, or a coloring agent. Preservatives for use in the compositions disclosed herein include, but are not limited to, benzalkonium chloride, chlorobutanol, parabens, and thimerosal. As used herein, "a pharmaceutically acceptable carrier" includes any and all aqueous solvents (e.g., water, alcohol / water solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc.), non-aqueous solvents (e.g., propylene glycol, polyethylene glycol, vegetable ...

Claims

1. A method of inducing an immune response against varicella-zoster virus (VZV) in a human subject, the method comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE-binding antibodies are induced in the subject.

2. A method for preventing, treating, ameliorating and / or reducing the risk of an infection, disease or condition associated with VZV in a human subject, the method comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE-binding antibodies are induced in the subject.

3. A method for preventing herpes zoster in a human subject, the method comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE binding antibodies are induced in the subject.

4. A method of preventing postherpetic neuralgia in a human subject, the method comprising administering to the subject an effective amount of an immunogenic composition comprising an RNA molecule encoding a VZV glycoprotein E (gE) polypeptide, wherein VZV gE antibodies are induced in the subject.

5. The method of any one of claims 1 to 4, wherein the geometric mean concentration (GMC) of VZV gE antibodies in the subject is greater than the GMC of VZV gE antibodies in the subject at baseline about 1 month after the first dose.

6. The method of any one of claims 1 to 5, wherein the GMC of the VZV gE antibody in the subject is at least 25,000, 30,000, 35,000, 40,000, 45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000 mIU / mL or more about 1 month after the first dose.

7. The method of any one of claims 1 to 6, wherein a dose response is observed in the subject about 1 month after the first dose.

8. The method of any one of claims 1 to 7, wherein the GMC of VZV gE antibodies in the subject is at least 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold, or 40-fold greater than baseline at about 1 month after the first dose.

9. The method of any one of claims 1 to 8, wherein about one month after the first dose, the percentage of subjects with at least a 4-fold increase in GMC is at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

10. The method of any one of claims 1 to 9, wherein the geometric mean fold increase (GMFR) of VZV gE antibodies is at least 15, 20, 25, 30, 35, or 40 or more at about 1 month after the first dose.

11. The method of any one of claims 1 to 10, wherein the second dose is administered after the first dose.

12. The method of any one of claims 1 to 11, wherein the second dose is administered about 2 months or 6 months after the first dose.

13. The method of any one of claims 1 to 12, wherein the GMC of the VZV gE antibody in the subject is higher at about 1 month after the second dose than the GMC of the antibody in the subject at baseline and 1 month after the first dose.

14. The method of any one of claims 1 to 13, wherein the GMC of the VZV gE antibody in the subject is at least 35,000, 40,000, 45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000, 90,000, 95,000, 100,000, 105,000, 110,000, or 115,000 mIU / mL or more one month after the second dose.

15. The method of any one of claims 1 to 14, wherein a dose response is observed in the subject about 1 month after the second dose.

16. The method of any one of claims 1 to 15, wherein the GMC of VZV gE antibodies in the subject is at least 5-fold, 10-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, 55-fold, or 60-fold greater than baseline at about 1 month after the second dose.

17. The method of any one of claims 1 to 16, wherein about one month after the second dose, the percentage of subjects with at least a 4-fold increase in GMC is at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

18. The method of any one of claims 1 to 17, wherein the geometric mean fold increase (GMFR) of VZV gE antibodies is at least 25, 30, 35, 40, 45, 50, 60, 65, 70, or 75 or more about 1 month after the second dose.

19. The method of any one of claims 1 to 18, wherein about 1 month after the first dose, the GMC of VZV gE antibodies in the subject is The amount of the antibody is about 1.1-fold, 1.2-fold, 1.3-fold, or 1.4-fold greater than the GMC of the VZV gE antibody in the human subject about 1 month after administration of the antibody.

20. The method of any one of claims 1 to 19, wherein about one month after the second dose, the GMC of VZV gE antibodies in the subject is The GMC of VZV gE antibodies in human subjects was approximately 1.1 times that of the GMC after approximately 1 month.

21. The method of any one of claims 1 to 20, wherein about one month after the first dose, GMFR is The results are shown in Table 1. The results are shown in Table 1. The results are shown in Table 1. The results are shown in Table 1. The results are shown in Table 1. The results are shown in Table 1.

22. The method of any one of claims 1 to 21, wherein about one month after the second dose, GMFR is The amount of the drug administered orally is about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, or 1.9-fold greater than the GMFR in human subjects one month after administration.

23. The method of any one of claims 1 to 22, wherein the GMFR at about 1 month after the first dose is about the same as that at the second dose. The GMFR of human subjects was similar 1 month later.

24. The method of any one of claims 1 to 23, wherein the immunogenic composition is administered in a single dose or a two-dose regimen.

25. The method of any one of claims 1 to 24, wherein the immunogenic composition is administered at a dosage range of about 1 μg to 100 μg or more per administration.

26. The method of any one of claims 1 to 25, wherein the immunogenic composition is administered at a dose of about 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, 90 μg, 100 μg or more per administration.

27. The method of any one of claims 1 to 26, wherein the human subject is an adult.

28. The method of any one of claims 1 to 27, wherein the human subject is an adult who is 18 years of age or older, about 20 years of age or older, about 30 years of age or older, about 40 years of age or older, about 45 years of age or older, about 50 years of age or older, about 55 years of age or older, about 60 years of age or older, about 65 years of age or older, about 70 years of age or older.

29. The method of any one of claims 1 to 28, wherein the immunogenic composition induces VZV gE binding antibodies and / or cell-mediated immune responses.

30. The method of any one of claims 1 to 29, wherein the immunogenic composition is administered as a vaccine.

31. The method of any one of claims 1 to 30, wherein the immunogenic composition is administered by intramuscular injection.

32. The method of any one of claims 1 to 31, wherein the immunogenic composition is lyophilized.

33. The method of any one of claims 1 to 32, wherein the VZV gE polypeptide is full-length, a truncated, a fragment or a variant thereof.

34. The method of any one of claims 1 to 33, wherein the VZV gE polypeptide comprises at least one mutation.

35. The method of any one of claims 1 to 34, wherein the VZV gE polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to any one of the amino acid sequences selected from SEQ ID NOs: 1 to 11.

36. The method of any one of claims 1 to 35, wherein the VZV gE polypeptide is transcribed from a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to any one of SEQ ID NOs: 12 to 145.

37. The method of any one of claims 1 to 36, wherein the RNA molecule comprises a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98% or 99% identical to any one of SEQ ID NOs: 146 to 279.

38. The method of any one of claims 1 to 37, wherein the RNA molecule comprises a nucleic acid sequence selected from any one of SEQ ID NOs: 146 to 279.

39. The method of any one of claims 1 to 38, wherein the VZV gE polypeptide is localized to the trans-Golgi network (TGN).

40. The method of any one of claims 1 to 38, wherein the VZV gE polypeptide is secreted.

41. The method of any one of claims 1 to 38, wherein the VZV gE polypeptide is localized to the cell membrane.

42. The method of any one of claims 1 to 41, wherein the RNA molecule comprises a 5' untranslated region (5'UTR) comprising a sequence selected from any one of SEQ ID NOs: 281, 312, or 313.

43. The method of any one of claims 1 to 42, wherein the RNA molecule comprises a 3' untranslated region (3'UTR) comprising a sequence selected from any one of SEQ ID NOs: 284, 314, or 317.

44. The method of any one of claims 1 to 43, wherein the RNA molecule comprises a poly(A) tail comprising a sequence selected from any one of SEQ ID NOs: 287 or 315.

45. The method of any one of claims 1 to 44, wherein the RNA molecule comprises a modified RNA in which uridine is substituted with N1-methylpseudouridine (Ψ).

46. ​​The method of any one of claims 1 to 45, wherein the immunogenic composition comprises an RNA molecule formulated in a lipid nanoparticle (LNP).

47. The method of claim 46, wherein the lipid nanoparticles comprise at least one of a cationic lipid, a pegylated lipid, a neutral lipid, and a steroid or a steroid analog.

48. The method of claim 47, wherein the cationic lipid is (4-hydroxybutyl)azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315).

49. The method of claim 47, wherein the PEGylated lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159).

50. The method of claim 47, wherein the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

51. The method of claim 47, wherein the steroid or steroid analog is cholesterol.

52. The method of any one of claims 1 to 51, wherein the immunogenic composition comprises an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule encodes a VZV gE polypeptide comprising an amino acid sequence selected from any one of SEQ ID NOs: 1 to 11.

53. The method of any one of claims 1 to 52, wherein the immunogenic composition comprises an RNA molecule formulated in a lipid nanoparticle, wherein the RNA molecule comprises a nucleic acid sequence selected from any one of SEQ ID NOs: 146 to 279.

Images