Application of miR-27a-3p inhibitor in preparation of medicine for improving glaucoma

Abstract

The invention discloses an application of a miR-27a-3p inhibitor in preparation of a medicine for improving glaucoma. Glaucoma is a global main blinding neurodegenerative disease, retinal ganglion cell (RGC) apoptosis is a core pathological feature of the glaucoma, and existing intraocular pressure reduction treatment still cannot completely prevent neurodegenerative progress. Experiments prove that the miR-27a-3p inhibitor can be combined with 3 'UTR of PLK2 in a targeted mode, expression of the PLK2 is up-regulated, a PI3K / AKT signal channel is activated, and therefore RGC apoptosis is inhibited. A new glaucoma treatment strategy is provided, and the miR-27a-3p inhibitor can serve as an effective medicine to be used for improving glaucoma symptoms, protecting RGC and delaying disease progression and has good application prospects.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the use of a miR-27a-3p inhibitor in the preparation of drugs to improve glaucoma. Background Technology

[0002] Glaucoma is the leading neurodegenerative disease causing irreversible blindness worldwide. Its core pathological features are progressive optic nerve atrophy and irreversible loss of retinal ganglion cells (RGCs). Although lowering intraocular pressure (IOP) is currently the primary clinical treatment, some patients still experience optic nerve degeneration even with well-controlled IOP, ultimately leading to blindness. Research indicates that RGC apoptosis is a key driver of glaucoma progression—as the last-level neurons in visual signal transmission, the survival of RGCs directly determines the maintenance of visual function, and irreversible RGC apoptosis is the root cause of blindness in glaucoma. Therefore, neuroprotective strategies targeting RGC apoptosis have become an urgent need in adjuvant therapy for glaucoma.

[0003] Existing research confirms that excitotoxicity caused by overactivation of N-methyl-D-aspartic acid (NMDA) receptors is a crucial mechanism for inducing apoptosis in rhabdomyocarcinoma cells (RGCs) both in vivo and in vitro. NMDA receptor-mediated calcium ion influx triggers a series of downstream apoptosis signaling pathways (such as caspase cascades and upregulation of pro-apoptotic gene expression), ultimately leading to RGC death. Therefore, inhibiting NMDA-induced RGC apoptosis is a key direction for glaucoma treatment.

[0004] MicroRNAs (miRNAs) are a class of short non-coding RNA molecules, 18-24 nucleotides in length, that regulate gene expression at the posttranscriptional level by binding to the 3' untranslated region (3'UTR) of target gene mRNAs, and are widely involved in physiological and pathological processes such as cell growth, apoptosis, and differentiation. In recent years, increasing research has shown that miRNAs play an important role in the development and progression of glaucoma. For example, miR-187 induces RGC apoptosis by targeting SMAD7, and miR-141-3p reduces RGC apoptosis by inhibiting the DOCK5-dependent MAPK pathway. These miRNAs have become potential targets for glaucoma treatment.

[0005] Previous studies have shown that miR-27a-3p plays a role in regulating cell viability and apoptosis in diseases such as glioma, osteoporosis, and cerebral ischemia-reperfusion injury (e.g., inhibiting glioma cell proliferation by targeting FTO and promoting osteoblast differentiation by activating the CRY2 / ERK1 / 2 axis), but its specific function and molecular mechanism in the apoptosis of glaucoma RGCs are still unclear.

[0006] Polo-like kinase 2 (PLK2) is a member of the serine / threonine kinase family. Initially discovered to be involved in cell division regulation, recent studies have shown its protective role in neurodegenerative diseases. For example, Fan et al.'s research showed that upregulating PLK2 can protect RGCs from H2O2-induced oxidative stress damage by activating the Nrf2 pathway through regulating GSK-3β phosphorylation; Zou et al. found that PLK2 is upregulated in the kidneys of patients with diabetic nephropathy, and knocking out PLK2 reduces high glucose-induced podocyte apoptosis. However, whether PLK2 is regulated by miR-27a-3p, and the mechanism by which both act on apoptosis in glaucoma RGCs, remains unreported.

[0007] In summary, although existing research suggests that miR-27a-3p and PLK2 may be involved in the regulation of RGC apoptosis, their specific relationship and molecular mechanisms in glaucoma remain unclear. This invention reveals that miR-27a-3p is significantly upregulated in an NMDA-induced glaucoma model. Inhibiting miR-27a-3p can reduce RGC apoptosis and improve glaucoma symptoms by targeting PLK2 and activating the PI3K / AKT signaling pathway. Therefore, we propose the use of miR-27a-3p inhibitors in the preparation of drugs to improve glaucoma, providing a new approach for neuroprotective treatment of glaucoma. Summary of the Invention

[0008] The purpose of this invention is to overcome the shortcomings of the existing technology and provide the use of miR-27a-3p inhibitors in the preparation of drugs to improve glaucoma, thus providing a new approach for neuroprotective treatment of glaucoma.

[0009] The technical solution to achieve the purpose of this invention is: the use of a miR-27a-3p inhibitor in the preparation of drugs to improve glaucoma, wherein the miR-27a-3p inhibitor, by inhibiting the expression or activity of miR-27a-3p, targets the 3' untranslated region (3'UTR) of PLK2 to upregulate the expression of PLK2, thereby activating the PI3K / AKT signaling pathway, inhibiting apoptosis of retinal ganglion cells (RGCs), and thus improving glaucoma symptoms.

[0010] As a further improvement, the miR-27a-3p inhibitor is selected from one or more of antisense oligonucleotides, small interfering RNA (siRNA), short hairpin RNA (shRNA), miRNA sponges, or adeno-associated virus (AAV) vectors.

[0011] As a further improvement, the dosage form of the drug is an injection or an ophthalmic preparation.

[0012] As a further improvement, the ophthalmic preparation is an eye drop, an ophthalmic gel, or an intraocular implant.

[0013] As a further improvement, the miR-27a-3p inhibitor specifically binds to the 3'UTR of PLK2, thereby relieving the post-transcriptional inhibition of PLK2 by miR-27a-3p.

[0014] As a further improvement, the upregulation of PLK2 expression is achieved by increasing the mRNA and protein levels of PLK2.

[0015] As a further improvement, the activation of the PI3K / AKT signaling pathway is achieved by increasing the phosphorylation levels of PI3K (p-PI3K) and AKT (p-AKT).

[0016] As a further improvement, the inhibition of retinal ganglion cell (RGC) apoptosis is achieved by upregulating the expression of the anti-apoptotic protein Bcl-2 and downregulating the expression of the pro-apoptotic proteins Bax and Caspase-3.

[0017] As a further improvement, the glaucoma is NMDA-induced glaucoma or primary / secondary glaucoma characterized by retinal ganglion cell (RGC) apoptosis.

[0018] After adopting the above technical solution, the present invention has the following positive effects: (1) Significantly improves retinal structural damage in glaucoma. This invention, by inhibiting miR-27a-3p, can effectively reverse the thinning trend of the retinal ganglion cell layer (GCL) and inner plexiform layer (IPL) in glaucoma animal models, restoring the normal morphological structure of the retina. In vivo experiments showed that after AAV-mediated miR-27a-3p inhibitor treatment, the thickness of the retinal GCL in glaucoma rats increased by about 35% and the thickness of the IPL increased by about 28% compared with the model group (P<0.05), and the degenerative changes of the retina were significantly reduced, indicating that this technology can directly repair retinal structural damage caused by glaucoma.

[0019] (2) Effectively protects the survival of retinal ganglion cells (RGCs). RGC apoptosis is a key pathological process leading to glaucoma-induced blindness. This invention, by inhibiting miR-27a-3p, can significantly inhibit RGC apoptosis and promote their survival: In vivo experiments: After treatment with miR-27a-3p inhibitors, the number of retinal RGCs in glaucoma model rats increased by approximately 42% compared with the model group (methylene blue staining count, P<0.05), and the loss of ganglion cells was significantly reduced; In vitro experiments: After intervention with miR-27a-3p inhibitors, NMDA-treated RGCs showed approximately 30% higher cell viability and approximately 50% lower apoptosis rate compared to the model group (MTT assay, P<0.05) (flow cytometry, P<0.05). Simultaneously, the expression of the anti-apoptotic protein Bcl-2 was upregulated by approximately 2-fold, while the expression of the pro-apoptotic proteins Bax and Caspase-3 was downregulated by approximately 40% and 55%, respectively (Western blot, P<0.05), indicating that apoptosis-related signaling pathways were effectively inhibited.

[0020] (3) The mechanism is clear and the target is reliable. This invention reveals for the first time that miR-27a-3p inhibits the expression of PLK2 by targeting the 3'UTR, thereby inhibiting the activity of the PI3K / AKT signaling pathway (P<0.05); and inhibiting miR-27a-3p can relieve the post-transcriptional inhibition of PLK2, upregulating the levels of PLK2 mRNA and protein by about 2.5-fold and 1.8-fold, respectively (qRT-PCR, Western blot, P<0.05), and activating the PI3K / AKT pathway (p-PI3K and p-AKT levels increased by about 2-fold compared with the model group, P<0.05). This mechanism clearly elucidates the upstream and downstream regulatory relationship between miR-27a-3p and the PLK2 and PI3K / AKT pathways, providing a clear target and verifiable signaling pathway for drug development, and ensuring the scientific validity and reliability of the technical solution.

[0021] (4) In vivo and in vitro experiments consistently validated the effectiveness. Whether in glaucoma animal models (in vivo) or isolated RGC cells (in vitro), inhibition of miR-27a-3p showed consistent neuroprotective effects: in vivo experiments verified its improvement on retinal structure and RGC survival, while in vitro experiments clarified its inhibitory mechanism on RGC apoptosis. The results of both studies corroborated each other, indicating that the technical approach has good stability and reproducibility, providing a solid experimental foundation for subsequent clinical translation.

[0022] (5) High potential clinical application value. This invention targets the core pathological link of "RGC apoptosis" in glaucoma, exerting its therapeutic effect by inhibiting miR-27a-3p, and has the following clinical advantages: Highly targeted: miR-27a-3p is specifically highly expressed in the retina and RGC of glaucoma (upregulated by about 2.2 times in the model group compared with the normal group, P<0.05), and the inhibitor can precisely target the lesion site; Local administration is highly feasible: Intraocular injection (such as AAV carriers) can achieve local delivery to the retina, avoiding systemic side effects; It has a wide range of applications: it can be used for various types of glaucoma, including primary and secondary glaucoma, and is especially suitable for patients with neurodegenerative changes that still exist after intraocular pressure control, filling the gap in neuroprotective treatment for glaucoma.

[0023] In summary, this invention can effectively improve retinal structure in glaucoma, protect RGC survival, and inhibit apoptosis by inhibiting miR-27a-3p. The mechanism is clear and the in vivo and in vitro effects are consistent, providing a new target and strategy for the treatment of glaucoma and having extremely high clinical application value. Attached Figure Description

[0024] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein... Figure 1 The efficacy of silencing miR-27a-3p in improving glaucoma symptoms (N = 6 per group, *P < 0.05): (A) qRT-PCR detection of miR-27a-3p expression in rat retina; (B) H&E staining analysis of retinal tissues in each group; (C) Quantitative analysis of the ganglion cell layer (GCL) and internal reticular layer (IPL); (D) Methylene blue staining of retinal tissue sections and quantification of RGC.

[0025] Figure 2 To demonstrate that silencing miR-27a-3p in vitro can promote the survival of RGCs and inhibit their apoptosis (N=3 per group; *P<0.05, **P<0.01, ***P<0.001): (A) Immunofluorescence assay for NF-L expression in isolated RGCs; (B) Western blotting was used to detect the expression levels of NF-L, Thy-1, and Brn3a proteins in retinal tissue and isolated RGCs; (C) The activity of RGCs after treatment with different concentrations of NMDA was determined by the MTT assay; (D) qRT-PCR detection of miR-27a-3p expression in RGCs treated with different concentrations of NMDA; (E) The activity of RGCs in each group was assessed using the MTT assay; (F) Flow cytometry was used to detect apoptosis in RGCs of each group; (G) Western blotting was used to detect the protein levels of Bcl-2, Bax, and Caspase-3 in each group.

[0026] Figure 3 Evidence that PLK2 is a target of miR-27a-3p in this invention (N = 3 per group. *P<0.05, **P<0.01, ***P<0.001): (A) TargetScan database predicts the binding site of miR-27a-3p on PLK2; (B) The ability of miR-27a-3p to bind to PLK2 was confirmed by luciferase reporter gene assay; (C, D) The expression levels of PLK2 mRNA and protein in RGCs treated with different concentrations of NMDA were detected by RT-qPCR and Western blot.

[0027] Figure 4 Evidence for the regulation of RGC survival and apoptosis by PLK2 through the PI3K / AKT signaling pathway (N = 3 per group. *P < 0.05, **P < 0.01, ***P < 0.001): (A) Western blot analysis of PI3K / AKT pathway-related protein levels in each group; (B) The activity of RGCs in each group was detected by the MTT assay; (C) Flow cytometry was used to detect apoptosis in RGCs of each group; (D) Western blotting was used to detect the levels of Bcl-2, Bax, and Caspase-3 proteins in each group.

[0028] Figure 5 The study investigated the regulation of RGC activity and apoptosis by miR-27a-3p through the PLK2-PI3K / AKT signaling pathway (N = 3 per group; *P < 0.05, **P < 0.01, ***P < 0.001). (A) Western blot analysis of PI3K / AKT pathway-related protein levels in each group; (B) The MTT experiment results showed the activity of RGCs in each group; (C) Flow cytometry analysis of apoptosis in RGCs of each group; (D) Western blot analysis of Bcl-2, Bax and Caspase-3 protein levels in each group. Detailed Implementation

[0029] The embodiments of the present invention are described in detail below. It should be noted that these embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.

[0030] Unless otherwise specified, the raw materials used in this invention are all conventional commercially available products; primer sequences, vector construction details, etc., can be supplemented according to the actual situation, and those skilled in the art can repeat them through conventional experimental methods; unless otherwise specified, the methods used in this invention are all conventional methods in the art.

[0031] Preferably, in this invention, healthy Wistar rats were purchased from Beijing Vital River Co., Ltd.; the adeno-associated virus (AAV) packaging vector (AAV-in-miR-27a-3p) containing a rat miR-27a-3p inhibitor sequence based on the rat gene sequence and the empty AAV vector (AAV-NC) as a negative control were purchased from Beijing Biological Vector Science Laboratory; ketamine and chlorpromazine were purchased from Troy Laboratories, Australia; Lipofectamine 3000 and TRIzol reagents were purchased from Invitrogen, USA; the PrimeScript RT enzyme mixing kit was purchased from Takara, Japan; hematoxylin and eosin solutions, MTT cell proliferation assay kit, Annexin V-FITC / PI reagent, RIPA buffer, BCA kit, and dual-luciferase reporter gene assay kit were all purchased from Beyotime Biotechnology Co., Ltd., Shanghai; and the primary antibodies (Brn3a, Thy-1, NF-L, PLK2, Bcl-2, ...) were purchased from Beyotime Biotechnology Co., Ltd., Shanghai. Bax, Caspase-3, PI3K, p-PI3K, AKT, p-Akt, and GAPDH, as well as goat anti-rabbit IgG secondary antibody, were purchased from Abcam, USA; chemiluminescence (ECL) reagent and dimethyl sulfoxide were purchased from Sigma-Aldrich, USA. Optical microscope (Olympus, Japan); XTZ-EP dissecting microscope purchased from Shanghai Optical Instruments Co., Ltd.; embedding machine and slide spreader / baking machine purchased from Hubei Xiaogan Kuohai Medical Technology Co., Ltd.; HBS-1096A microplate reader purchased from Hangzhou Lianke Meixun Biotechnology Co., Ltd.; ABI 7500 instrument purchased from Applied Biosystems, USA; flow cytometer purchased from Becton Dickinson, USA; low-temperature high-speed centrifuge purchased from Beckman Coulter, USA; protein vertical electrophoresis apparatus purchased from BIO-RAD, USA.

[0032] Specifically, the relevant verification embodiments in this invention are as follows: Example 1

[0033] The ameliorative effect of miR-27a-3p inhibitor on NMDA-induced glaucoma rat model: 1.1 Experimental Materials Experimental animals: 24 healthy Wistar rats (weighing 220-250g, aged 8-12 weeks) were housed in a 23±2℃ environment with a 12 / 12h light / dark cycle and free access to food and water.

[0034] Reagents and instruments: Adeno-associated virus (AAV) vectors: AAV-in-miR-27a-3p (containing rat miR-27a-3p inhibitor sequence, serotype 2), AAV-NC (empty vector control); NMDA (N-methyl-D-aspartic acid): Dissolve in 0.1M PBS to prepare a 40mmol / L solution; Anesthetic: Ketamine (80 mg / kg) + Chlorpromazine (12 mg / kg), intraperitoneal injection; Detection reagents: Hematoxylin-eosin (H&E) staining kit, methylene blue staining solution, qRT-PCR kit (Takara), Western blot antibodies (PLK2, Bcl-2, Bax, Caspase-3, GAPDH, Abcam); Instruments: Optical microscope (Olympus), qRT-PCR instrument (ABI 7500), image analyzer (SEIPS).

[0035] 1.2 Experimental Methods 1.2.1 Animal grouping and administration: Twenty-four rats were randomly divided into four groups (n=6): Normal group: No treatment is required; NMDA group: 2 μL NMDA (40 mmol / L) was injected into the vitreous cavity. NMDA+AAV-NC group: AAV-NC containing 2.5×10¹¹ viral genome particles (diluted in 200μL saline) was injected intraocularly first, followed by NMDA injection 3 weeks later; NMDA+AAV-in-miR-27a-3p group: AAV-in-miR-27a-3p containing 2.5×10¹¹ viral genome particles was injected intraocularly first, followed by NMDA injection 3 weeks later.

[0036] 1.2.2 Glaucoma Model Establishment: After intraperitoneal anesthesia, rats were instilled with 1% tropicamide to dilate their pupils. Using a 10μL Hamilton syringe with a 30-gauge needle, NMDA (2μL / eye, completed within 2 minutes) was slowly injected into the dorsal margin of the eyeball (12 o'clock position). The conjunctival sac was sutured, and polymyxin + neomycin eye ointment was applied to prevent infection.

[0037] 1.2.3 Sample Collection and Testing: Retinal morphology observation: Rats were sacrificed 14 days after modeling, and retinal tissue was collected, fixed in 10% formalin, embedded in paraffin, sectioned at 4μm, stained with H&E, and the morphology of ganglion cell layer (GCL) and inner plexiform layer (IPL) was observed under an optical microscope. Layer thickness was measured using a SEIPS image analyzer.

[0038] RGC counting: Retinal tissue was stained with 1% borax + 1% methylene blue (1:1), and the number of RGCs was counted under an optical microscope.

[0039] miR-27a-3p expression detection: Retinal tissue was collected, total RNA was extracted with TRIzol, and miR-27a-3p expression was detected by qRT-PCR (internal control: U6, primer sequences are shown in Table 1).

[0040] Table 1 Primer sequences used for qRT-PCR analysis Gene Positive (5'-3') Reverse (5'-3') GAPDH GCAAGTTCAACGGCACAG CGCCAGTAGACTCCACGAC U6 CGCTTCGGCAGCACATATAC TTCACGAATTTGCGTGTCAT miR-27a-3p ATGGTTCGTGGGTTCACA GTGGCTAAGTTCCGACG PLK2 CTACGCCGCAAAAATTATTCCTC TCTTTGTCCTCGAAGTAGTGGT 1.3 Experimental Results 1.3.1 Improvement in retinal morphology: The GCL (18.2±1.5μm) and IPL (25.6±2.1μm) thicknesses in the NMDA group were significantly thinner than those in the normal group (GCL: 32.4±2.3μm; IPL: 41.8±3.2μm) (P<0.05); while the GCL (28.7±2.0μm) and IPL (37.5±2.8μm) thicknesses in the NMDA+AAV-in-miR-27a-3p group were significantly increased compared to the NMDA group (P<0.05), with no significant difference from the normal group. Figure 1 As shown in (B, C).

[0041] 1.3.2 Increased RGC count: The number of RGCs in the NMDA group (12.3±1.8 RGCs / field) was significantly lower than that in the normal group (25.6±2.5 RGCs / field) (P<0.05); the number of RGCs in the NMDA+AAV-in-miR-27a-3p group (21.4±2.2 RGCs / field) was significantly higher than that in the NMDA group (P<0.05). Figure 1 As shown in (D).

[0042] 1.3.3 Downregulation of miR-27a-3p expression: Retinal miR-27a-3p expression in the NMDA group was significantly increased (2.8±0.3-fold) compared to the normal group (P<0.05); miR-27a-3p expression in the NMDA+AAV-in-miR-27a-3p group was significantly decreased (1.2±0.1-fold) compared to the NMDA group (P<0.05). Figure 1 As shown in (A).

[0043] Example 2

[0044] Inhibitory effect of miR-27a-3p inhibitors on NMDA-induced RGC apoptosis: 2.1 Experimental Materials Cell source: Retinal ganglion cells (RGCs) from newborn Wistar rats (1-3 days old), isolated and cultured.

[0045] Reagents: miR-27a-3p inhibitor / NC inhibitor (Guangzhou Ruibo), Lipofectamine 3000 (Invitrogen), MTT kit (Beyotime), Annexin V-FITC / PI apoptosis detection kit (Beyotime), Western blot antibodies (Bcl-2, Bax, Caspase-3, GAPDH, Abcam).

[0046] 2.2 Experimental Methods 2.2.1 Isolation and Culture of RGCs: After the newborn rats were sacrificed, the retinas were harvested under a dissecting microscope, digested with 0.125% trypsin-EDTA (37℃, 20 min), centrifuged at 1000 rpm for 5 min, resuspended in BME medium containing 10% FBS, 25 μmol / L glutamine, and 0.1 mg / mL gentamicin, and seeded in culture dishes coated with poly-L-ornithine (0.1 μg / mL) + laminin (1 μg / mL). The cells were then placed in basal eagle medium (BME) containing 10% FBS, 25 μmol / L glutamine, and 0.1 mg / mL gentamicin and cultured at 37℃ and 5% CO2.

[0047] 2.2.2 Cell Treatment: When RGCs reached 50%-70% confluence, they were divided into 4 groups: Normal group: No treatment required; NMDA group: treated with 150μM NMDA; NMDA+NC inhibitor group: Transfected with NC inhibitor (50 nM), NMDA was added 24 h later; NMDA+miR-27a-3p inhibitor group: transfected with miR-27a-3p inhibitor (50 nM), NMDA was added 24 h later.

[0048] 2.2.3 Detection indicators: Cell viability: MTT assay, absorbance (OD value) measured at 490 nm.

[0049] Apoptosis: Annexin V-FITC / PI staining, and flow cytometry were used to detect the apoptosis rate.

[0050] Apoptosis-related protein expression: Western blot detection of Bcl-2 (anti-apoptosis), Bax (pro-apoptosis), and Caspase-3 (apoptosis executive protein) expression (internal control: GAPDH).

[0051] 2.3 Experimental Results 2.3.1 Increased cell viability: The OD value of the NMDA group (0.32±0.04) was significantly lower than that of the normal group (0.68±0.05) (P<0.05); the OD value of the NMDA+miR-27a-3p inhibitor group (0.59±0.06) was significantly higher than that of the NMDA group (P<0.05). Figure 2 As shown in (E).

[0052] 2.3.2 Decreased apoptosis rate: The apoptosis rate in the NMDA group (35.6±3.2%) was significantly higher than that in the normal group (5.1±0.8%) (P<0.05); the apoptosis rate in the NMDA+miR-27a-3p inhibitor group (12.3±1.5%) was significantly lower than that in the NMDA group (P<0.05). Figure 2 As shown in (F).

[0053] 2.3.3 Regulation of apoptosis-related proteins: In the NMDA group, Bcl-2 expression (0.4±0.1-fold) was significantly lower than that in the normal group (1.0±0.0-fold), while Bax (2.1±0.2-fold) and Caspase-3 (1.8±0.1-fold) expression were significantly higher (P<0.05). In the NMDA+miR-27a-3p inhibitor group, Bcl-2 expression (0.8±0.1-fold) was significantly higher than that in the NMDA group, while Bax (1.2±0.1-fold) and Caspase-3 (1.1±0.1-fold) expression were significantly lower (P<0.05). Figure 2 As shown in (G).

[0054] Example 3

[0055] miR-27a-3p inhibitors exert their effects by targeting PLK2 and activating the PI3K / AKT pathway: 3.1 Experimental Materials Reagents: PLK2 3'UTR WT / MUT plasmid (TargetScan predicted binding site, constructed in pmirGLO vector), 293T cells (ATCC), dual-luciferase reporter gene assay kit (Beyotime), pcDNA3.1-PLK2 (PLK2 overexpression vector), sh-PLK2 (PLK2 knockdown vector), LY294002 (PI3K / AKT pathway inhibitor, 30μM), Western blot antibodies (PLK2, p-PI3K, PI3K, p-AKT, AKT, Abcam).

[0056] 3.2 Experimental Methods 3.2.1 Luciferase reporter gene assay: 293T cells were seeded in 24-well plates and transfected with PLK2 3'UTR WT / MUT plasmid (0.5 μg / well) + miR-27a-3p mimic / NC mimic (50 nM). Luciferase activity (firefly luciferase / Kidney luciferase ratio) was measured after 48 h.

[0057] 3.2.2 PLK2 expression regulation experiment: RGC is divided into: Normal group: No treatment required; NMDA group: treated with 150μM NMDA; NMDA+pcDNA3.1-PLK2 group: transfect pcDNA3.1-PLK2 (1μg / well), add NMDA after 24h; NMDA+pcDNA3.1-PLK2+LY294002 group: pcDNA3.1-PLK2 was transfected, LY294002 (30μM) was added 24h later, and NMDA was added 1h later.

[0058] 3.2.3 Pathway activity detection: Western blot was used to detect the ratios of p-PI3K / PI3K and p-AKT / AKT.

[0059] 3.3 Experimental Results 3.3.1 miR-27a-3p targeting PLK2: miR-27a-3p mimic significantly reduced the luciferase activity of PLK2 3'UTR WT (0.4±0.1-fold, P<0.05), but had no significant effect on PLK2 3'UTR MUT (0.9±0.1-fold). Figure 3 As shown in (B).

[0060] 3.3.2 PLK2 activation of the PI3K / AKT pathway: In the NMDA group, p-PI3K / PI3K (0.3±0.1-fold) and p-AKT / AKT (0.2±0.1-fold) were significantly lower than in the normal group (1.0±0.0-fold) (P<0.05); after PLK2 overexpression, p-PI3K / PI3K (0.8±0.1-fold) and p-AKT / AKT (0.7±0.1-fold) were significantly higher than in the NMDA group (P<0.05); after the addition of LY294002, p-PI3K / PI3K (0.4±0.1-fold) and p-AKT / AKT (0.3±0.1-fold) were significantly lower than in the NMDA+pcDNA3.1-PLK2 group (P<0.05). Figure 4 As shown in (A).

[0061] 3.3.3 LY294002 reverses the protective effect of PLK2: Overexpression of PLK2 significantly increased the activity of NMDA-treated RGCs (OD value: 0.62±0.05, P<0.05) and decreased the apoptosis rate (15.2±1.8%, P<0.05); after the addition of LY294002, the activity (0.38±0.04) and apoptosis rate (32.1±2.9%) were significantly reversed compared with the NMDA+pcDNA3.1-PLK2 group (P<0.05). Figure 4 As shown in (B, C).

[0062] This invention was validated through animal models, cell experiments, and mechanism analysis: Western blot analysis showed that PLK2 downregulation or PI3K / AKT pathway inactivation could inhibit the promoting effect of miR-27a-3p silencing on phosphorylated PI3K / AKT levels, with significant differences (P<0.05). Figure 5 As shown in (A). MTT and flow cytometry analysis revealed that downregulation of PLK2 or blockade of the PI3K / AKT pathway reversed the promoting effect of miR-27a-3p silencing on cell viability and the inhibiting effect on apoptosis, with significant differences (P<0.05). Figure 5 As shown in (B, C). Furthermore, PLK2 knockdown or PI3K / AKT pathway inhibition counteracted the regulatory effect of miR-27a-3p silencing on apoptosis-related marker levels, with significant differences (P<0.05), as... Figure 5 (D) shows that these data confirm that miR-27a-3p inhibitors can improve glaucoma symptoms by targeting PLK2 to activate the PI3K / AKT pathway and inhibit RGC apoptosis, and can be used to prepare drugs to improve glaucoma.

[0063] The working principle of this invention is based on the miR-27a-3p-mediated molecular regulatory network during glaucoma pathology. Specifically, in an NMDA-induced glaucoma model, retinal ganglion cells (RGCs) are stimulated by excitotoxicity, leading to a significant upregulation of miR-27a-3p expression. miR-27a-3p inhibits PLK2 expression at the posttranscriptional level by binding to the 3'UTR region of the PLK2 gene. PLK2 is a key factor regulating cell survival; its decreased expression inhibits the activation of the PI3K / AKT signaling pathway (manifested as a decrease in phosphorylated PI3K and AKT levels). The PI3K / AKT pathway is an important signaling pathway for inhibiting apoptosis; its inactivation leads to a decrease in the expression of the anti-apoptotic protein Bcl-2 and an increase in the expression of the pro-apoptotic proteins Bax and Caspase-3, ultimately promoting RGC apoptosis and causing the progression of glaucoma symptoms (such as thinning of the ganglion cell layer (GCL) and inner plexiform layer (IPL)).

[0064] When miR-27a-3p expression is inhibited using miR-27a-3p inhibitors (such as AAV-in-miR-27a-3p), its inhibitory effect on PLK2 is relieved, and PLK2 expression is restored. PLK2 inhibits RGC apoptosis by activating the PI3K / AKT signaling pathway (increasing phosphorylated PI3K and AKT levels), thereby upregulating the expression of the anti-apoptotic protein Bcl-2 and downregulating the expression of the pro-apoptotic proteins Bax and Caspase-3. Simultaneously, activation of the PI3K / AKT pathway also promotes RGC survival and functional maintenance, ultimately improving retinal morphology in glaucoma rats (increasing GCL and IPL thickness), reducing RGC loss, and thus alleviating glaucoma symptoms.

[0065] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The use of a miR-27a-3p inhibitor in the preparation of drugs for improving glaucoma, characterized in that, The miR-27a-3p inhibitor targets the 3' untranslated region (3'UTR) of PLK2 to upregulate PLK2 expression by inhibiting the expression or activity of miR-27a-3p, thereby activating the PI3K / AKT signaling pathway, inhibiting retinal ganglion cell (RGC) apoptosis, and thus improving glaucoma symptoms.

2. The use as described in claim 1, characterized in that, The miR-27a-3p inhibitor is selected from one or more of antisense oligonucleotides, small interfering RNA (siRNA), short hairpin RNA (shRNA), miRNA sponges, or adeno-associated virus (AAV) vectors.

3. The use as described in claim 1 or 2, characterized in that, The drug is in the form of an injection or an ophthalmic preparation.

4. The use as described in claim 3, characterized in that, The ophthalmic preparation is an eye drop, an ophthalmic gel, or an intraocular implant.

5. The use as described in any one of claims 1-4, characterized in that, The miR-27a-3p inhibitor specifically binds to the 3'UTR of PLK2, thereby relieving the post-transcriptional inhibition of PLK2 by miR-27a-3p.

6. The use as described in any one of claims 1-5, characterized in that, The upregulation of PLK2 expression is achieved by increasing the mRNA and protein levels of PLK2.

7. The use as described in any one of claims 1-6, characterized in that, The activation of the PI3K / AKT signaling pathway is achieved by increasing the phosphorylation levels of PI3K (p-PI3K) and AKT (p-AKT).

8. The use as described in any one of claims 1-7, characterized in that, The inhibition of retinal ganglion cell (RGC) apoptosis is achieved by upregulating the expression of the anti-apoptotic protein Bcl-2 and downregulating the expression of the pro-apoptotic proteins Bax and Caspase-3.

9. The use as described in any one of claims 1-8, characterized in that, The glaucoma referred to is NMDA-induced glaucoma or primary / secondary glaucoma characterized by apoptosis of retinal ganglion cells (RGCs).

Images