A live attenuated strain of Streptococcus agalactiae, a vaccine and its application
By knocking out the marR gene of the virulent Streptococcus agalactiae strain HN016 to construct an attenuated strain, a vaccine was prepared, solving the problem of the lack of Streptococcus agalactiae vaccines for fish and improving the survival rate and prevention and control effect of aquatic animals.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HUAZHONG AGRI UNIV
- Filing Date
- 2025-07-02
- Publication Date
- 2026-05-26
AI Technical Summary
Currently, there is no available vaccine for Streptococcus agalactiae in fish. Existing prevention and control strategies face challenges due to antibiotic overuse leading to bacterial resistance and antibiotic residues.
By knocking out the marR gene of the virulent Streptococcus agalactiae strain HN016, an attenuated Streptococcus agalactiae strain was constructed and prepared into a vaccine for the prevention and treatment of Streptococcus agalactiae infection in aquatic animals.
It significantly improves the survival rate of aquatic animals infected with Streptococcus agalactiae and reduces virulence, showing promising application prospects.
Smart Images

Figure CN120843391B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of veterinary biological products technology, specifically relating to a live attenuated strain of Streptococcus agalactiae, a vaccine, and its application. Background Technology
[0002] agalactococcus ( Streptococcus. agalactiae Streptococcus agalactiae (SAE) is widely distributed in water and soil. It is a Gram-positive bacterium with a broad host range, acting as a zoonotic pathogen that can infect various mammals, including humans (such as horses, cattle, and pigs), reptiles, and fish. In aquaculture, SAE is the primary pathogen causing streptococcal disease in tilapia. Tilapia infected with SAE develop rapidly and have high mortality rates, causing significant economic losses to the global tilapia farming industry. Outbreaks of SAE are closely related to environmental factors such as water temperature and pH, especially in summer when water temperatures reach 30–33°C and the pH remains between 7.0 and 7.5. This seasonal epidemic characteristic may be related to the upregulation of SAE's metabolic activity and virulence factor expression under high temperatures. In aquatic environments, damage to fish epidermal tissues (including skin and mucous membrane rupture, mechanical damage to fins, or scale loss) and stress responses caused by high-density farming environments can significantly increase the probability of SAE outbreaks. Tilapia infected with Streptococcus agalactiae can also release bacteria in their feces, which can spread the bacteria through the fecal-oral route.
[0003] Currently, the main control method for Streptococcus agalactiae disease in tilapia is antibiotic control. However, the increasing prevalence of antibiotic overuse and misuse in aquaculture has led to bacterial resistance and antibiotic residues in fish, posing a serious challenge to existing control strategies. Recent clinical monitoring shows that Streptococcus agalactiae has significantly increased resistance to antibiotics such as penicillin and enrofloxacin, and the detection rate of multidrug-resistant strains continues to rise. The environmental and ecological risks caused by horizontal transfer of drug-resistant genes have attracted widespread attention.
[0004] Vaccination is the safest and most effective way to prevent infectious diseases in fish. However, there are currently no commercially available vaccines to prevent Streptococcus agalactiae infection in fish. Summary of the Invention
[0005] The purpose of this invention is to provide an attenuated strain of Streptococcus agalactiae, a vaccine, and its application. This addresses the current lack of available Streptococcus agalactiae vaccines for fish.
[0006] In a first aspect, the present invention provides a potent attenuated strain of Streptococcus agalactiae, which is obtained by knocking out the potent Streptococcus agalactiae strain HN016. marR The genes were obtained later; among them, marR The nucleotide sequence of the gene is shown in SEQ ID NO:1.
[0007] In this invention, the inventors discovered that by knocking out the highly virulent strain HN016 of Streptococcus agalactiae... marR After gene modification, a significantly reduced virulence strain of Streptococcus agalactiae was obtained. When this strain was used to prepare a vaccine, it significantly improved the survival rate of aquatic animals infected with Streptococcus agalactiae. Therefore, this strain of Streptococcus agalactiae has good application prospects in the preparation of drugs for the prevention and / or treatment of Streptococcus agalactiae infection in aquatic animals.
[0008] In a second aspect, the present invention provides a method for constructing a virulent strain of Streptococcus agalactiae as described above, comprising the following steps: S1, using the genome of a virulent strain of Streptococcus agalactiae HN016 as a template, amplifying the genome using a first primer pair and a second primer pair respectively. marR S1. The upstream and downstream homologous arms of the gene are amplified to obtain the upstream and downstream homologous arms; S2. The amplified upstream and downstream homologous arms are ligated by overlap PCR to obtain the ligated upstream and downstream homologous arms; S3. The ligated upstream and downstream homologous arms are ligated with a heat-sensitive suicide plasmid to obtain the homologous recombination plasmid; S4. The homologous recombination plasmid is transformed into the virulent strain of Streptococcus agalactiae HN016 to obtain the attenuated strain of Streptococcus agalactiae.
[0009] In some implementations, in step S1, the nucleotide sequence of the first primer pair is shown in SEQ ID NO:2-3.
[0010] In some implementations, in step S1, the nucleotide sequence of the second primer pair is shown in SEQ ID NO:4-5.
[0011] In some implementations, in step S3, the thermosensitive suicide plasmid includes the pSET4S plasmid.
[0012] In some implementations, step S4 includes electroconversion.
[0013] In a third aspect, the present invention provides a vaccine comprising the above-described attenuated Streptococcus agalactiae strain or the attenuated Streptococcus agalactiae strain constructed by any of the above-described construction methods.
[0014] In some implementations, vaccines also include pharmaceutically acceptable excipients.
[0015] In a fourth aspect, the present invention provides the use of the above-described attenuated Streptococcus agalactiae strain, the attenuated Streptococcus agalactiae strain constructed by any of the above-described construction methods, and any of the above-described vaccines in the preparation of medicaments for the prevention and / or treatment of Streptococcus agalactiae infection in aquatic animals.
[0016] In some implementations, aquatic animals include tilapia.
[0017] The beneficial effects of this invention are: unlike the prior art, this invention eliminates the virulent strain HN016 of Streptococcus agalactiae. marR After gene modification, a significantly reduced virulence strain of Streptococcus agalactiae was obtained. When this strain was used to prepare a vaccine, it significantly improved the survival rate of aquatic animals infected with Streptococcus agalactiae. Therefore, this strain of Streptococcus agalactiae has good application prospects in the preparation of drugs for the prevention and / or treatment of Streptococcus agalactiae infection in aquatic animals. Attached Figure Description
[0018] Figure 1 Figure 1 shows the results of alignment and structural analysis of different marR protein sequences in Example 1 of the present invention. Figure (A) shows the alignment results of different marR protein sequences, and Figure (B) shows the structural analysis results of different marR proteins.
[0019] Figure 2A In Example 2 of this invention, the virulent strain HN016 and the attenuated strain Δ of Streptococcus agalactiae were tested. marR The gel electrophoresis results of the products after amplification of the genome are shown. Lane M represents the standard molecular weight of DNA, and lanes 1-4 represent: lane 1 is the detection using the wild-type HN016 genome as a template and the third primer pair (SEQ ID NO: 6-7). marR Does the gene exist? 2 is the deletion strain Δ marR Using the genome as a template, a third primer pair was used for detection. marR The presence of the gene was determined; step 3 involved using the wild-type HN016 genome as a template and detecting it with the fourth primer pair (SEQ ID NO: 8-9). marR Does the gene exist? 4 represents the deletion strain Δ marR Using the genome as a template, the fourth primer pair was used for detection. marR Does the gene exist?
[0020] Figure 2B In Example 2 of this invention, qPCR was used to detect virulent Streptococcus agalactiae strain HN016 and attenuated Streptococcus agalactiae strain Δ. marR of marR The result of genes and their neighboring genes;
[0021] Figure 3 The attenuated strain Δ of Streptococcus agalactiae in Example 3 of this invention marR In vitro growth results;
[0022] Figure 4 The attenuated strain Δ of Streptococcus agalactiae in Example 4 of this invention marR The results of growth in tilapia blood;
[0023] Figure 5A The attenuated strain Δ of Streptococcus agalactiae in Example 5 of this inventionmarR Adhesion results of TiB cells in tilapia brain cells;
[0024] Figure 5B The attenuated strain Δ of Streptococcus agalactiae in Example 5 of this invention marR Results of TiB invasion into tilapia brain cells;
[0025] Figure 5C The attenuated strain Δ of Streptococcus agalactiae in Example 5 of this invention marR Results of toxicity tests on tilapia;
[0026] Figure 5D The attenuated strain Δ of Streptococcus agalactiae in Example 5 of this invention marR Results of bacterial load in different tissues after tilapia injection. Detailed Implementation
[0027] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0028] Experimental methods not specifically described in the examples are generally performed according to conventional experimental methods in the field of molecular biology, including but not limited to those described in *Molecular Cloning: A Laboratory Manual* by MR. Green and *Molecular Biology* by Robert F. Weaver, or according to the experimental methods recommended by the reagent kit and instrument manufacturers. Unless otherwise specified, all reagents and biological materials used in the examples are commercially available.
[0029] To address the current lack of available vaccines against Streptococcus agalactiae for fish, this invention provides a live attenuated strain of Streptococcus agalactiae, a vaccine, and its application.
[0030] In a first aspect, the present invention provides a potent attenuated strain of Streptococcus agalactiae, which is obtained by knocking out the potent Streptococcus agalactiae strain HN016. marR The genes were obtained later; among them, marR The nucleotide sequence of the gene is shown in SEQ ID NO:1.
[0031] In this invention, the inventors discovered that by knocking out the highly virulent strain HN016 of Streptococcus agalactiae... marRAfter gene modification, a significantly reduced virulence strain of Streptococcus agalactiae was obtained. When this strain was used to prepare a vaccine, it significantly improved the survival rate of aquatic animals infected with Streptococcus agalactiae. Therefore, this strain of Streptococcus agalactiae has good application prospects in the preparation of drugs for the prevention and / or treatment of Streptococcus agalactiae infection in aquatic animals.
[0032] In a second aspect, the present invention provides a method for constructing a virulent strain of Streptococcus agalactiae as described above, comprising the following steps: S1, using the genome of a virulent strain of Streptococcus agalactiae HN016 as a template, amplifying the genome using a first primer pair and a second primer pair respectively. marR S1. The upstream and downstream homologous arms of the gene are amplified to obtain the upstream and downstream homologous arms; S2. The amplified upstream and downstream homologous arms are ligated by overlap PCR to obtain the ligated upstream and downstream homologous arms; S3. The ligated upstream and downstream homologous arms are ligated with a heat-sensitive suicide plasmid to obtain the homologous recombination plasmid; S4. The homologous recombination plasmid is transformed into the virulent strain of Streptococcus agalactiae HN016 to obtain the attenuated strain of Streptococcus agalactiae.
[0033] The method for constructing a low-virulence Streptococcus agalactiae strain provided by this invention is simple, and it has the advantage of high knockout efficiency by using a heat-sensitive suicide plasmid to knock out the target gene.
[0034] In some implementations, in step S1, the nucleotide sequence of the first primer pair is shown in SEQ ID NO:2-3.
[0035] Understandably, the first primer pair can be conventionally designed based on the sequence of the upstream homologous arm of the target gene, as long as the sequence of the upstream homologous arm of the target gene can be efficiently amplified. For example, in this invention, the preferred nucleotide sequence of the first primer pair is as shown in SEQ ID NO:2-3.
[0036] In some implementations, in step S1, the nucleotide sequence of the second primer pair is shown in SEQ ID NO:4-5.
[0037] Understandably, the second primer pair can be conventionally designed based on the sequence of the downstream homologous arm of the target gene, as long as the sequence of the downstream homologous arm of the target gene can be efficiently amplified. For example, in this invention, the nucleotide sequence of the second primer pair is preferably as shown in SEQ ID NO:4-5.
[0038] In some implementations, in step S3, the thermosensitive suicide plasmid includes the pSET4S plasmid.
[0039] Understandably, the thermosensitive suicide plasmid can be selected from conventional thermosensitive suicide plasmids in the prior art, as long as it can efficiently knock out the target gene. For example, in this invention, the thermosensitive suicide plasmid preferably includes the pSET4S plasmid.
[0040] In some implementations, step S4 includes electroconversion.
[0041] It is understood that the transformation can be carried out using conventional transformation methods in the prior art, as long as they can efficiently introduce homologous recombination plasmids into the target strain. For example, in this invention, the transformation preferably includes electrotransformation.
[0042] In a third aspect, the present invention provides a vaccine comprising the above-described attenuated Streptococcus agalactiae strain or the attenuated Streptococcus agalactiae strain constructed by any of the above-described construction methods.
[0043] In this invention, the inventors further discovered that preparing a vaccine from a weakened strain of Streptococcus agalactiae can significantly improve the survival rate of aquatic animals infected with Streptococcus agalactiae, and the vaccine has good protective efficiency against Streptococcus agalactiae infection in aquatic animals.
[0044] In some implementations, vaccines also include pharmaceutically acceptable excipients.
[0045] Understandably, pharmaceutically acceptable excipients can be routinely added as needed for actual use, as long as they maintain the activity of the vaccine. For example, pharmaceutically acceptable excipients can include stabilizers, protectants, and excipients.
[0046] In a fourth aspect, the present invention provides the use of the above-described attenuated Streptococcus agalactiae strain, the attenuated Streptococcus agalactiae strain constructed by any of the above-described construction methods, and any of the above-described vaccines in the preparation of medicaments for the prevention and / or treatment of Streptococcus agalactiae infection in aquatic animals.
[0047] In some implementations, aquatic animals include tilapia.
[0048] Understandably, the aquatic animals can also be conventional aquatic animals in the prior art. The vaccine in this invention has good protective efficiency against Streptococcus agalactiae infection in aquatic animals.
[0049] The following are some specific embodiments. It should be noted that the embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.
[0050] In this invention, the virulent Streptococcus agalactiae strain HN016 is described in the literature (Li LP, Wang R, Liang WW, et al. Development of live attenuated Streptococcus agalactiae vaccine fortilapia via continuous passage in vitro [J]. Fish & Shellfish Immunology, 2015, 45(2): 955-963.), and can be obtained by the public from the College of Fisheries, Huazhong Agricultural University.
[0051] Example 1: Sequence and structural analysis of the marR protein in virulent Streptococcus agalactiae strain HN016
[0052] Searching for the marR protein sequence in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) yielded the marR protein sequence of the virulent strain HN016 of *Streptococcus agalactiae* (accession number: WP_000431168.1) and that of *Streptococcus dolphinus* (…). S. iniae The marR protein sequence (accession number: WP_003100233.1), Enterococcus faecalis ( S. faecalis The marR protein sequence of ) (accession number: WP_195675185.1), Streptococcus chrysogenum ( S. gallinaceus The marR protein sequence of *Streptococcus ursoris* (accession number: WP_253363590.1), the marR protein sequence of *Streptococcus ursoris* (accession number: WP_193522822.1), and *Streptococcus mongolica* (accession number: WP_193522822.1) were obtained. S. merionis The sequence of the marR protein (accession number: WP_018372988.1).
[0053] The above marR protein sequence was aligned and its three-dimensional structure predicted using Clustal Omega and Swiss-Model software, respectively. The results are as follows: Figure 1 As shown.
[0054] from Figure 1 As can be seen, the marR protein sequence of the highly virulent Streptococcus agalactiae strain HN016 shares 49.2%, 62.86%, 59.72%, 50.00%, and 48.23% similarity with the marR protein sequences of Streptococcus dolphinus, Streptococcus faecalis, Streptococcus gallinarum, Streptococcus ursevieriae, and Streptococcus mongolicus, respectively. Figure 1A) The RMSD values of the differences in the three-dimensional structure of the marR protein between the virulent strain HN016 of Streptococcus agalactiae and Streptococcus dolphinus and Streptococcus faecalis were 0.121 and 0.902, respectively (RMSD values less than 1 indicate that there is no significant difference in the three-dimensional structure of the protein). Figure 1 B); The above results indicate that the marR protein in different streptococcal species is highly conserved.
[0055] Example 2: Attenuated strain Δ of Streptococcus agalactiae marR Construction
[0056] This embodiment provides a live attenuated strain Δ of Streptococcus agalactiae. marR The construction method includes the following steps:
[0057] S1. Using the genome of the virulent strain HN016 of Streptococcus agalactiae (extracted using a DNA extraction kit) as a template, amplification was performed using the first primer pair and the second primer pair, respectively. marR The upstream and downstream homologous arms of the gene (nucleotide sequence as shown in SEQ ID NO:1) were obtained to produce the amplified upstream and downstream homologous arms.
[0058] in, marR The gene nucleotide sequence SEQ ID NO:1 is shown below:
[0059] ATGGAGAATCCTCTTCAAAAAGCACGAATACTTGTTAATCAACTTGAAAAGTATTTAGATCGTTATGCAAAAGAGTATGATGTTGAACATTTAGCGGGTCCACAAGGACACTTAGTGATGCATCTCTATAAAACATCCTGACAAGGATATGTCTATAAAAGATGCTGAAGAAATTTTACACATCTCTAAGTCTGTAGCTTCTAATTTGGTAAAACGGATGGA AAAAAATGGATTTATTGCGATTGTTCCATCTAAGACAGATAAGCGTGTGAAATACCTTTATTTGACTCATCTAGGTAAACAAAAGGCTACACAATTTGAAATTTTCTTAGAAAAATTGCACAGTACCATGTTAGCAGGTATTACTAAAGAAGAGATACGTACTACCAAAAAGGTTATTAGAACATTAGCTAAAAATATGGCGATGGAAGATTTTGATTAA;
[0060] The nucleotide sequence of the first primer pair is shown below:
[0061] marR-A:(SEQ ID NO:2)
[0062] 5'-CGGGGATCCTCTAGAGTCGACATAACGATAATAACCGCTAC-3';
[0063] marR-B: (SEQ ID NO:3)
[0064] 5'-TATTTGACGAATGATAGGTGTAAATATGAAAGTAAAAGGAG-3';
[0065] The nucleotide sequence of the second primer pair is shown below:
[0066] marR-C:(SEQ ID NO:4)
[0067] 5'-CTCCTTTTACTTTCATATTTACACCTATCATTCGTCAAATA-3';
[0068] marR-D:(SEQ ID NO:5)
[0069] 5'-CTTGCATGCCTGCAGGTCGACATTCATGGTTACCTAATGTG-3'.
[0070] S2. The amplified upstream and downstream homologous arms were ligated by overlapping PCR to obtain the ligated upstream and downstream homologous arms.
[0071] S3. The upstream and downstream homologous arms and pSET4S plasmid (Beijing Solarbio Science & Technology Co., Ltd.) were digested with Sma I / Sal I (Thermo Fisher Scientific) and then ligated with T4 ligase (Thermo Fisher Scientific) to obtain homologous recombinant plasmids.
[0072] S4. The homologous recombinant plasmid was transformed into the virulent Streptococcus agalactiae strain HN016 by electroporation to obtain the attenuated Streptococcus agalactiae strain Δ. marR .
[0073] Using virulent strain HN016 and attenuated strain Δ of Streptococcus agalactiae marRUsing the genome as a template, amplification was performed using primer pairs (third primer pair marR-E: 5'-CCTGCTAACATGGTACTGTGC-3' (SEQ ID NO:6) and marR-F: 5'-AGGACACTTAGTGATGCATCTC-3' (SEQ ID NO:7); fourth primer pair marR-G: 5'-CTCCTTTTACTTTCATAT-3' (SEQ ID NO:8) and marR-H: 5'-CGTCAGGCATATTTGCTGTTC-3' (SEQ ID NO:9)). The amplified products were detected by agarose gel electrophoresis, and the results are as follows: Figure 2A As shown.
[0074] from Figure 2A As can be seen, *Streptococcus agalactiae* strain HN016 can amplify *Streptococcus agalactiae*. marR Genes in attenuated Streptococcus agalactiae strain Δ marR Unable to amplify marR Gene analysis showed that the attenuated Streptococcus agalactiae strain Δ marR In marR The gene was knocked out.
[0075] Furthermore, qPCR was used to detect the virulent strain HN016 (WT) and the attenuated strain (Δ) of Streptococcus agalactiae. marR In ) marR Genes, and marR Expression levels of genes adjacent to the gene;
[0076] Among them, used for marR The primer pairs for gene testing have the following sequences:
[0077] marR-qF (SEQ ID NO:10): 5'-CCTGCTAACATGGTACTGTGC-3';
[0078] marR-qR (SEQ ID NO:11): 5'-CCATCTAAGACAGATAAGCGTG-3';
[0079] For marR The sequences of the primer pairs for detecting adjacent genes are as follows:
[0080] Up gene-qF (SEQ ID NO:12): 5'-TCACAGGATTCATAAGCGACAT-3';
[0081] Up gene-qR (SEQ ID NO:13): 5'-TGGTGTTAGAGTTATTCGTGCC-3';
[0082] Down gene-qF (SEQ ID NO:14): 5'-TATGCCTGACGGAAAAGTTAC-3';
[0083] Down-qR (SEQ ID NO:15): 5'-CTTGAAGAAGCCCTGAGTTAG-3';
[0084] qPCR test results as follows Figure 2B As shown.
[0085] from Figure 2B As can be seen, *Streptococcus agalactiae* strain HN016 can amplify *Streptococcus agalactiae*. marR Genes in attenuated Streptococcus agalactiae strain Δ marR Unable to amplify marR Genes, and marR Gene knockout does not affect marR Expression of adjacent genes.
[0086] Example 3: Attenuated strain Δ of Streptococcus agalactiae marR In vitro growth assay
[0087] The virulent strain HN016 and the attenuated strain Δ of Streptococcus agalactiae cultured overnight were used. marR The bacterial culture was diluted 1:100 into fresh THB medium and cultured until mid-log (OD2). 600nm =0.4~0.5). The culture was diluted to OD in fresh THB medium. 600nm The value was 0.1. 200 μL of the diluted culture was transferred to a 96-well microplate and incubated at 37°C, shaking for 10 seconds every hour before measuring the OD. 600nm Values, set 4 techniques to repeat, results are as follows Figure 3 As shown.
[0088] from Figure 3 It can be seen that the virulent strain HN016 and the attenuated strain Δ of Streptococcus agalactiae... marR The growth curves showed no significant difference. p >0.05); the results show that, marR The deletion of the gene does not affect the growth of Streptococcus agalactiae.
[0089] Example 4: Attenuated strain Δ of Streptococcus agalactiae marR Growth experiment in tilapia blood
[0090] Cultured virulent strain HN016 and attenuated strain Δ of Streptococcus agalactiae separately. marR When its concentration reaches 1×10 7At CFU / mL, the bacteria were transferred to THB medium containing 10% tilapia serum and incubated at 37°C for 90 min. The virulent strain HN016 and the attenuated strain Δ were then assessed by counting colonies on plate agar. marR Growth in tilapia blood, results as follows Figure 4 As shown.
[0091] from Figure 4 As can be seen, in a culture medium containing tilapia serum, the attenuated strain Δ of Streptococcus agalactiae... marR The growth fold was 7.7 times, significantly lower than the growth fold of 14.6 times for the highly virulent strain of Streptococcus agalactiae HN016. p <0.01); the results showed that the attenuated strain Δ of Streptococcus agalactiae... marR Growth is inhibited in the blood of tilapia.
[0092] Example 5: Attenuated strain Δ of Streptococcus agalactiae marR Toxicity test
[0093] 5.1 Adhesion of *Streptococcus agalactiae* to TiB in tilapia brain cells
[0094] Streptococcus agalactiae (highly virulent strain HN016 and attenuated strain Δ) marR The bacteria were co-incubated with tilapia brain cells (TiB) at a ratio of 10:1. After 2 hours of incubation, Streptococcus agalactiae that had not adhered to the TiB cells were washed away with PBS. The TiB cells were then lysed, and the ability of Streptococcus agalactiae to adhere to TiB cells was assessed by counting colonies on agar plates. The results are shown below. Figure 5A As shown.
[0095] from Figure 5A It can be seen from this that the attenuated strain Δ marR The adhesion ability of the virus to TiB in tilapia brain cells was reduced by 2.7 times compared to the more potent strain HN016. p <0.05).
[0096] 5.2 Invasion of TiB by Streptococcus agalactiae in Tilapia Brain Cells
[0097] Streptococcus agalactiae (highly virulent strain HN016 and attenuated strain Δ) marR The cells were co-incubated with tilapia brain cells (TiB) at a ratio of 10:1. After 2 hours of incubation, penicillin and streptomycin (Thermo Fisher Scientific) were added to a final concentration of 100 µg / mL, and incubation continued for another 2 hours. The TiB cells were then lysed, and the ability of *Streptococcus agalactiae* to invade TiB cells was assessed by counting colonies on agar plates. The results are shown below. Figure 5B As shown.
[0098] from Figure 5B It can be seen from this that the attenuated strain ΔmarR The ability of the virus to invade TiB cells in tilapia brain cells was reduced by 3 times compared to the more virulent strain HN016. p <0.05).
[0099] 5.3 Virus Challenge Experiment
[0100] Healthy tilapia (body length 15±2 cm, weight 50±5 g) were randomly divided into 9 groups (n=20). Three groups of tilapia were injected intraperitoneally with 2×10 8 CFU / tail of the highly virulent strain HN016 was administered via intraperitoneal injection to three groups of tilapia at 2×10⁻⁶ doses. 8 CFU / tail attenuated strain Δ marR The remaining three groups of tilapia were injected with the same volume of PBS. They were observed for 14 consecutive days, and mortality rates were recorded. The results are as follows: Figure 5C As shown.
[0101] from Figure 5C It can be seen from this that the attenuated strain Δ marR The survival rate of tilapia after challenge with the virus was as high as 70%, significantly higher than the 16.7% survival rate after challenge with the virulent strain HN016. p <0.001).
[0102] 5.4 Determination of tissue bacterial load
[0103] Healthy tilapia (body length 15±2 cm, weight 50±5 g) were randomly divided into 6 groups (n=5). Three groups of tilapia were injected intraperitoneally with 5×10 5 The highly virulent strain HN016 was administered via CFU / tail, and three other groups of tilapia were injected intraperitoneally with 5×10 5 CFU / tail attenuated strain Δ marR Twelve hours after viral challenge, blood, spleen, and brain tissue were collected from tilapia. The tissues were homogenized and plated; colony count was used to assess the bacterial load in the tilapia tissues after challenge. The results are as follows: Figure 5D As shown.
[0104] from Figure 5D It can be seen from this that the attenuated strain Δ marR After challenge, the bacterial load in blood and spleen tissue was reduced by 323 times compared to the challenge with the virulent strain HN016. p <0.0001) and 12.3 times ( p <0.01).
[0105] The above results indicate that the attenuated strain Δ of Streptococcus agalactiae... marR The virulence of this strain is significantly lower than that of the more virulent strain HN016.
[0106] Example 6: Attenuated strain Δ of Streptococcus agalactiae marR LD50 50 Measurement
[0107] Healthy tilapia (body length 15±2 cm, weight 50±5 g) were randomly divided into 21 groups (n=40), and each group was treated with 1×10 3 CFU / tail, 1×10 4 CFU / tail, 1×10 5 CFU / tail, 1×10 6 CFU / tail, 1×10 7 CFU / tail, 1×10 8 CFU / tail and 1×10 9 CFU / tail of virulent or attenuated Streptococcus agalactiae strain HN016 or strain Δ marR The patients were challenged with PBS, while the control group received PBS. They were observed for 14 consecutive days, and mortality rates were recorded. The results are shown in Table 1 below.
[0108] Table 1. Median Lethal Concentration (LD50) 50 Measurement results
[0109]
[0110] As can be seen from Table 1, under the same conditions, the attenuated strain Δ of Streptococcus agalactiae... marR The mortality rate in the challenge group was significantly lower than that in the challenge group with the virulent Streptococcus agalactiae strain HN016; the Δ mortality rate of the attenuated Streptococcus agalactiae strain was calculated. marR LD 50 The median lethal concentration (LD50) is 2.1 × 10⁻⁶. 8 CFU was significantly higher than that of the virulent Streptococcus agalactiae strain HN016 (5.9 × 10⁻⁶). 5 CFU (LD) 50 The above results indicate that the attenuated strain Δ of *Streptococcus agalactiae*... marR Its virulence was significantly lower than that of the highly virulent Streptococcus agalactiae strain HN016.
[0111] Example 7: Attenuated strain Δ of Streptococcus agalactiae marR Immunopotency trials of vaccines
[0112] Using 1×10 5 CFU / tail, 1×10 6 CFU / tail, 1×10 7 CFU / tail, 1×10 8 CFU / tail of attenuated Streptococcus agalactiae strain Δ marR Healthy tilapia (body length 15±2 cm, weight 50±5 g) were immunized with an equal volume of PBS. 15 and 30 days after immunization, 20 tilapia were randomly selected from each of the different immunization groups and treated with 5.9×10⁻⁶ PBS. 8CFU was used to challenge the highly virulent strain HN016 of Streptococcus agalactiae. The patients were observed for 14 consecutive days, and the mortality rate was recorded. The results are shown in Table 2 below.
[0113] Table 2. Attenuated live strains of Streptococcus agalactiae Δ marR Results of vaccine immunization efficacy
[0114]
[0115] As can be seen from Table 2, with the increase of attenuated Streptococcus agalactiae strain Δ marR The higher the concentration of the vaccine, the higher the survival rate of tilapia challenged with the virulent Streptococcus agalactiae strain HN016; the higher the concentration of the attenuated Streptococcus agalactiae strain Δ... marR The vaccine immunization concentration is 1×10 7 At a concentration of CFU / tail, the attenuated strain of Streptococcus agalactiae Δ marR The vaccine provides 100% protection.
[0116] In summary, this invention achieves its goal by knocking out the highly virulent strain HN016 of Streptococcus agalactiae. marR After gene modification, a significantly reduced virulence strain of Streptococcus agalactiae was obtained. When this strain was prepared into a vaccine, it significantly improved the survival rate of aquatic animals infected with Streptococcus agalactiae.
[0117] The embodiments described above are merely illustrative of implementation methods of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A live attenuated strain of Streptococcus agalactiae, characterized in that, The attenuated Streptococcus agalactiae strain is obtained by knocking out the marR gene of the virulent Streptococcus agalactiae strain HN016; The nucleotide sequence of the gene is shown as SEQ ID NO:
1. marR The nucleotide sequence of the gene is shown as SEQ ID NO:
1.
2. A method for constructing an avirulent strain of Streptococcus agalactiae as claimed in claim 1, characterized in that, Includes the following steps: S1, using the genome of the virulent strain of Streptococcus agalactiae HN016 as a template, using a first primer pair and a second primer pair to amplify marR the upstream homologous arm and the downstream homologous arm of the gene, to obtain the amplified upstream homologous arm and the downstream homologous arm; S2. The amplified upstream homologous arm and downstream homologous arm are ligated by overlapping PCR to obtain the ligated upstream and downstream homologous arms. S3. Connect the upstream and downstream homologous arms and the thermosensitive suicide plasmid to obtain a homologous recombinant plasmid. S4. The homologous recombinant plasmid is transformed into the virulent strain of Streptococcus agalactiae HN016 to obtain a weak virulent strain of Streptococcus agalactiae.
3. The construction method according to claim 2, characterized in that, In step S1, the nucleotide sequence of the first primer pair is shown in SEQ ID NO:2-3.
4. The construction method according to claim 2, characterized in that, In step S1, the nucleotide sequence of the second primer pair is shown in SEQ ID NO:4-5.
5. The construction method according to claim 2, characterized in that, In step S3, the thermosensitive suicide plasmid includes the pSET4S plasmid.
6. The construction method according to claim 2, characterized in that, In step S4, the conversion includes electrical conversion.
7. A vaccine, characterized in that, This includes the attenuated Streptococcus agalactiae strain as described in claim 1 or the attenuated Streptococcus agalactiae strain constructed by the construction method described in any one of claims 2-6.
8. The vaccine according to claim 7, characterized in that, The vaccine also includes pharmaceutically acceptable excipients.
9. The use of the attenuated Streptococcus agalactiae strain as described in claim 1, the attenuated Streptococcus agalactiae strain constructed by the construction method of any one of claims 2-6, and the vaccine as described in any one of claims 7-8 in the preparation of a drug for the prevention and / or treatment of Streptococcus agalactiae infection in aquatic animals.
10. The application according to claim 9, characterized in that, The aquatic animals include tilapia.