DsRNA interference primer for regulating and controlling sex gene Dmrta2 of blue crabs as well as method and application of dsRNA interference primer
By designing specific dsRNA interference primers, precise regulation of the Dmrta2 gene splice variant in mud crab was achieved, solving the regulatory challenges in existing technologies and improving the breeding efficiency of mud crab seedlings.
Patent Information
- Application Number
- CN202510997277.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-18
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-07-18
AI Technical Summary
Existing technologies make it difficult to precisely control the spliceosome expression of the Dmrta2 gene during the development of the mud crab testes, making it difficult to achieve sex regulation. Furthermore, the degradation efficiency of exogenous RNA in crustaceans is low, affecting the breeding efficiency of seedlings.
We designed and synthesized specific dsRNA interference primers, and used in vitro transcription and in vivo injection to target and regulate the alternative splice of the Dmrta2 gene in mud crabs, achieving precise interference and observing changes in testis development.
Highly efficient RNA interference was achieved in vitro and in vivo, successfully observing the blockage or abnormality of spermatogenesis in the testes, precisely controlling the expression of the Dmrta2 gene, and improving seedling breeding efficiency.
Smart Images

Figure CN120843516A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of aquatic organism technology, specifically relating to a dsRNA interference primer for regulating the sex gene Dmrta2 in mud crabs, its method, and its application. Background Technology
[0002] The mud crab (Scylla paramamosain), commonly known as the blue crab, is one of the three major farmed economic crab species in my country (along with the Chinese mitten crab and the swimming crab). It plays a vital role in my country's fisheries economy and export earnings. However, the demand for mud crabs far exceeds the current production, reaching a total demand of 300,000 tons, resulting in a significant supply-demand imbalance and persistently high market prices. Although the scale of mud crab farming has been expanding in recent years, insufficient basic research on its reproductive biology has limited the development of large-scale artificial breeding technology, leading to a severe shortage of artificially bred seedlings and a high degree of market dependence on natural seedlings. This industrial model not only slows down the industrialization of artificial breeding of mud crabs but also seriously restricts the optimization of the aquaculture structure and green development.
[0003] Testicular development is a core component of research in the reproductive biology of mud crabs, and a crucial foundation and guarantee for seedling breeding. Normal testicular development is vital for ensuring sperm quality, co-existing male-female reproduction, optimizing seedling production, protecting genetic diversity, and upgrading the aquaculture industry. However, current research largely focuses on ovarian development, leaving many gaps in understanding the molecular mechanisms and regulatory networks of testicular development.
[0004] Testicular development involves multiple stages, including spermatogonial stem cell proliferation, meiosis, and spermatogenesis. It requires dynamic regulation of spliceosome genes (such as the SR protein family or U2AF35, key splicing factors involved in spermatogenesis) to achieve precise testicular development. Knockdown of different spliceosomes can interfere with key transcript splicing events at different developmental stages, leading to varying degrees of spermatogenesis arrest or abnormalities (such as sperm morphology defects and DNA fragmentation). Therefore, precise control of the timing and dosage of gene knockdown is necessary. Furthermore, the testes of the mud crab are located within the cephalothorax, encased in a hard exoskeleton, and the male reproductive system is relatively independent of the circulatory system. Additionally, crustaceans' hemolymph contains a large number of immune factors (such as the phenol oxidase system), which may degrade exogenous RNA or vectors, reducing knockdown efficiency. Therefore, failure to precisely control the timing and dosage of gene knockdown will make it difficult to directly target testicular tissue and the target gene. Finally, the molecular mechanisms of sex determination and testicular development in crustaceans are not yet fully understood. Spliceosomes may regulate the expression of sex-related genes (such as Dmrt1 and Sox9) through alternative splicing, and alternative splicing sequences have high consistency. If the target spliceosome is not accurately knocked down, it may cause undesirable phenotypic changes, resulting in an indistinct phenotype and making it difficult to determine the function of the gene.
[0005] Despite significant progress in genetic research on the mud crab *Scylla serrata* in recent years, many key regulatory genes for sex differentiation and reproductive development remain unknown. Among these, the Dmrta2 gene, a crucial gene already confirmed to be closely related to reproductive system development in other species (e.g., in zebrafish, Dmrta2 acts as an activator by directly binding to the cdkn2c promoter region, regulating spermatogenesis and testis development), is particularly important. Furthermore, mutations in Dmrta2 are associated with male infertility, highlighting its importance in spermatogenesis and testis development. In mud crabs, DmrtA2 is specifically expressed in the ovary and female brain tissue, suggesting its involvement in ovarian differentiation and maintenance. Similarly, in embryonic mice, Dmrta2 expression is higher in the ovary than in the testis, indicating a sex-specific role in gonadal development. It also exhibits similarly conserved roles in humans and *Heilongjiang sturgeon*, suggesting that DmrtA2 is also essential for normal female germ cell development. However, functional studies in *Scylla serrata* remain lacking.
[0006] Therefore, there is an urgent need for a dsRNA interference primer that can target and regulate the alternative splice variant of the Dmrta2 sex-regulating gene in mud crabs both in vivo and in vitro. Summary of the Invention
[0007] The purpose of this invention is to provide a dsRNA interference primer and method for regulating the alternative splice variant of the Dmrta2 gene in mud crabs, thereby interfering with the expression of the Dmrta2 gene alternative splice variant, and observing the inhibition or abnormality of spermatogenesis in the testes and the tissue changes of testicular cavity formation after interference with the Dmrta2 gene alternative splice variant.
[0008] In order to achieve the above object, the present invention provides the following technical solutions:
[0009] This invention provides a dsRNA for regulating the sex gene Dmrta2 in mud crabs, wherein the dsRNA is obtained by in vitro transcription using a spliceosome sequence as a template;
[0010] The spliceosome sequence includes AS1 or AS2;
[0011] The nucleotide sequence of AS1 is SEQ ID NO.11;
[0012] The nucleotide sequence of AS2 is SEQ ID NO.12.
[0013] This invention also provides a method for preparing dsRNA, the method comprising the following steps:
[0014] S1: Using cDNA from the testes of mud crabs as a template, a plasmid with a spliceosome sequence was synthesized.
[0015] S2: Using the plasmid of the spliceosome sequence obtained in step S1 as a template, design primer pairs with the T7 promoter sequence;
[0016] S3: Obtain the template for the dsRNA by PCR amplification;
[0017] S4: The template obtained in step S3 is transcribed in vitro to synthesize dsRNA and then purified.
[0018] Preferably, step S1 specifically includes: designing primers based on the Dmrta2 gene, using cDNA from the testes of the mud crab as a template, performing PCR amplification to obtain the target DNA band; recovering and purifying the obtained target band, ligating the purified DNA fragment with a vector to obtain a recombinant vector; transforming the recombinant vector into competent cells, screening positive clones and sequencing them for verification, and amplifying and culturing the correctly sequenced positive clones to extract plasmids.
[0019] Preferably, the primer pair includes dsDmrta2-AS1 or dsDmrta2-AS2;
[0020] The dsDmrta2-AS1 includes the forward primer dsDmrta2-AS1-F and the reverse primer dsDmrta2-AS1-R;
[0021] The sequence of dsDmrta2-AS1-F is shown in SEQ ID NO.3;
[0022] The sequence of dsDmrta2-AS1-R is shown in SEQ ID NO.4;
[0023] The dsDmrta2-AS2 includes the forward primer dsDmrta2-AS2-F and the reverse primer dsDmrta2-AS2-R;
[0024] The sequence of dsDmrta2-AS2-F is shown in SEQ ID NO.5;
[0025] The sequence of dsDmrta2-AS2-R is shown in SEQ ID NO.6.
[0026] Preferably, the primer pair containing the T7 promoter sequence in step S2 includes dsDmrta2-AS1-T7 or dsDmrta2-AS2-T7; the sequence of dsDmrta2-AS1-T7 is shown in SEQ ID NO.7 and SEQ ID NO.8; the sequence of dsDmrta2-AS2-T7 is shown in SEQ ID NO.9 and SEQ ID NO.10.
[0027] Preferably, the total PCR amplification reaction system in step S3 is 50 μL, comprising: 2 μL each of forward and reverse primers (10 μM), 25 μL of 2×Phanta Flash MasterMix (Dye Plus), 2 μL of cDNA template, and ddH2O to bring the total to 50 μL; the reaction program is: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 65℃ annealing for 5 s, 72℃ extension for 5 s, 72℃ final extension for 1 min, for 35 cycles; and finally stored at 4℃.
[0028] The present invention also provides a method for regulating the sex gene Dmrta2 in mud crabs using RNA interference, the method comprising the following steps: the method includes in vitro interference treatment and in vivo interference treatment;
[0029] The in vitro interference treatment includes: first, selecting testicular tissue from mud crabs for treatment, then co-culturing the aforementioned dsRNA, transfection reagent, and testicular tissue; finally, performing paraffin sectioning and phenotypic analysis on the co-cultured testicular tissue.
[0030] The in vivo processing includes: first, injecting the above-mentioned dsRNA into the body of the blue crab using a microinjector; 72 hours later, taking out the testis tissue for paraffin sectioning and phenotypic analysis.
[0031] Preferably, the testis tissue of the mud crab in step S1 is selected from testis stage III; the transfection reagent is spliceosome 1AS1 and spliceosome 2AS2; the transfection concentration of AS1 is 2.0 μg / mL and the transfection concentration of AS2 is 3.0 μg / mL; the co-culture time is 24 h.
[0032] Preferably, the reagent dosage of the micro-injection of dsRNA in step S2 is 1.0 ± 0.3 μg / g body weight; the injection time is once every 24 hours, and the number of injections is 3.
[0033] The present invention also provides the application of dsRNA prepared according to the above-described dsRNA primers or the method described above in the preparation of inhibitors for testicular development in mud crabs.
[0034] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0035] (1) This invention provides an RNA interference method for regulating the testis development of mud crab by Dmrta2 gene alternative splice variant. The method implements RNA interference in in vivo and in vitro tissue culture of mud crab, and can successfully complete the expression interference of Dmrta2 gene alternative splice variant. The inhibition or abnormality of spermatogenesis and testis cavity cavitation tissue changes after Dmrta2 gene alternative splice variant interference were successfully observed.
[0036] (2) This invention provides an RNA interference method for regulating the testis development of mud crabs by the alternative splice of the Dmrta2 gene. Based on the differential sequence of the alternative splice of the Dmrta2 gene, this method screens out highly specific target sequences to avoid off-target interference with other isoforms or homologous genes of Dmrta2, and achieves precise control of the knockdown timing and dosage.
[0037] (3) This invention provides an RNA interference method for regulating the testes of mud crabs by Dmrta2 gene alternative splice variants. This method enables the same primer to be used simultaneously for in vivo and in vitro interference of Dmrta2 gene alternative splice variants, and histological changes can be observed in a short time. Using the method of this invention, a clear gene function and morphological association can be established efficiently and quickly. Attached Figure Description
[0038] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0039] Figure 1 This is a schematic gel image of the synthesized alternative spliceosomes AS1, AS2, and EGFP dsRNA.
[0040] Figure 2 This is an analysis of the results of in vitro detection of interference efficiency of the testes of stage III mud crabs with the alternative spliceosomes AS1 and AS2.
[0041] Figure 3 The graph shows the results of the detection of interference efficiency of the altered spliceosomes AS1 and AS2 in the testes of stage III mud crabs.
[0042] Figure 4 This is a schematic diagram of the morphological changes of the testis after in vitro interference with the alternative spliceosomes AS1 and AS2 of the testis in stage III of *Scylla serrata*. St represents sperm cells; A, A', C, and C' are negative control groups; B and B' represent testis tissue after interference with SpDmrta2-AS1; and D and D' represent testis tissue after interference with SpDmrta2-AS2.
[0043] Figure 5 This is a schematic diagram of the morphological changes of the testes after interference with the alternative spliceosomes AS1 and AS2 in the testes of stage III mud crabs in vivo; where St: sperm cells, A, A', C, and C' are negative control groups, B and B' are testicular tissues after interference with SpDmrta2-AS1, and D and D' are testicular tissues after interference with SpDmrta2-AS2. Detailed Implementation
[0044] This invention uses the mud crab *Scylla serrata* as the research object and targets two splice variants of the Dmrta2 gene. The sequences of the two alternative splice variants, AS1 and AS2, are as follows:
[0045]
[0046]
[0047] The full-length CDS of the Dmrta2 gene splice variant AS1 is 1432 bp, and the full-length CDS of the splice variant AS2 is 1089 bp; the length of AS1-dsRNA used for synthesis is 239 bp, and the length of AS2-dsRNA is 151 bp.
[0048] Furthermore, the primer sequences used to amplify the Dmrta2 splice fragment are as follows:
[0049] dsDmrta2-AS1-F(SEQ ID NO.3):ACCACGACTCTTCCCCAGAT
[0050] dsDmrta2-AS1-R(SEQ ID NO.4):TCTCTCTGGTCTTGCAGGGA
[0051] dsDmrta2-AS2-F(SEQ ID NO.5):GGCTTCGTTGGCAAGATTGT
[0052] dsDmrta2-AS2-R(SEQ ID NO.6):TTCCGTCTTCAGCATCCACA
[0053] The synthesized gene fragment sequences are as follows:
[0054] AS1(SEQ ID NO.11):ACCACGACTCTTCCCCAGATCCCGCCGACGGG GACCTGGCGCGGCCGCCGACCACCTCACCGAGTATTCCATGCGCCATGACCTCCTGACACGCCCCGACCTGCGCCTCAACTTTGACCTGCGCCCTGACTTGCGTCTGCGGTCCCCAGCGGCCGAGGATAGTGCCTAAGGCTCTCGCCGCCCGCCGTCCGCCGCTCCGCCCTTCTCTCCAGGACCTGTCCCT
[0055] AS2 (SEQ ID NO. 12): GGCTTCGTTGGCAAGATTGTCCTCGATCTCGGC CTCGAAGTCAACGCGATAGACCTTGTCTTCCTTTGCCTTCTTCTCTTCTTTG TTAGGGCGTGTCTTCTTGATGAGTTTCTTAATGGCCTTCTTGAGGCTGTGG
[0056] This invention provides a dsRNA for regulating the sex gene Dmrta2 in mud crabs, wherein the dsRNA is obtained by in vitro transcription using a spliceosome sequence as a template.
[0057] In some embodiments of the present invention, the spliceosome sequence includes AS1 or AS2.
[0058] This invention also provides a method for preparing dsRNA, the method comprising the following steps:
[0059] S1: Using cDNA from the testes of mud crabs as a template, a plasmid with a spliceosome sequence was synthesized.
[0060] S2: Using the plasmid of the spliceosome sequence obtained in step S1 as a template, design primer pairs with the T7 promoter sequence;
[0061] S3: Obtain the template for the dsRNA by PCR amplification;
[0062] S4: The template obtained in step S3 is transcribed in vitro to synthesize dsRNA and then purified.
[0063] Preferably, the plasmid construction in step S1 includes the following steps:
[0064] T1. Using cDNA from the testes of *Scylla serrata* as a template, primers were designed to clone two splice variants of the Dmrta2 gene. A high-fidelity enzyme premix was used to prepare the reaction system, as follows:
[0065] Table 1 PCR reaction system
[0066]
[0067]
[0068] T2. Add each reaction component in sequence to a 200 μL RNase-free centrifuge tube, mix thoroughly, transfer to a PCR instrument, and perform the amplification reaction according to the following procedure;
[0069] Table 2 PCR reaction procedures
[0070]
[0071] After the T3 PCR amplification reaction, the DNA was separated by electrophoresis on a 1.5% agarose gel, the target DNA band was excised, the DNA fragment was recovered from the gel and purified, and the purified DNA fragment was ligated into the pEASY-T1 cloning vector.
[0072] T4. The obtained ligation reaction product is mixed with chemically competent cells on ice for transformation. After single colonies are clearly visible, positive clones are selected. After sequencing to confirm that they are correct, bacterial culture is carried out, and then plasmid is extracted.
[0073] Furthermore, the above gel recovery and purification includes the following steps:
[0074] ① Use a clean scalpel blade to accurately cut the target DNA band and precisely transfer it to a 1.5mL centrifuge tube. Weigh the gel (100mg is converted to 100μL volume).
[0075] ② Add 3 times the gel volume of GSB buffer to the centrifuge tube and incubate in a 55°C water bath for 10 minutes, vortexing once every 3 minutes until the gel is completely dissolved (to improve DNA recovery efficiency, isopropanol of the same volume as the gel can be selectively added).
[0076] ③ After the solution has cooled to room temperature, transfer it to a DNA purification column and equilibrate at room temperature for 1 min. Centrifuge at 1,000×g for 1 min and discard the filtrate;
[0077] ④ Add 650 μL of WB washing solution to the purification column, centrifuge at 1,000 × g for 1 min, and discard the effluent;
[0078] ⑤ Place the empty column in a 2 mL collection tube and centrifuge at 1,000 × g for 2 min to completely remove any residual washing solution;
[0079] ⑥ Transfer the purification column to a new sterile 1.5 mL centrifuge tube. Open the cap and let stand at room temperature for 1 min to allow residual ethanol to evaporate completely. Add 40 μL of EB elution buffer preheated to 70°C (ensuring the liquid completely covers the center of the column matrix). Let stand at room temperature for 1 min to allow the DNA to fully dissolve. Finally, centrifuge at 12,000 × g for 1 min and collect the DNA solution at the bottom of the tube. To improve elution efficiency, the collected solution can be added back to the purification column for a second elution.
[0080] ⑦ Centrifuge the purification column at 1,000×g for 1 min to ensure the DNA solution is fully collected at the bottom of the collection tube. Immediately transfer the collected DNA product to -20℃ for storage.
[0081] Furthermore, the specific steps for ligating the DNA fragment with the pEASY-T1 cloning vector are as follows:
[0082] The purified DNA fragments were ligated into the pEASY-T1 cloning vector in a specific reaction system (total volume 5 μL).
[0083] Table 3
[0084]
[0085] Add the above reagents sequentially to a 200 μL sterile centrifuge tube, and gently mix 10 times using a pipette. Incubate the reaction mixture in a PCR instrument at 25°C for 7 min, then immediately transfer to 4°C for storage.
[0086] Furthermore, the specific steps for the conversion, screening, and detection of the target fragment are as follows:
[0087] Take the ligation reaction product obtained in step T3 above and mix it with chemocompetent cells on ice. Gently pipette to mix thoroughly, then incubate on ice for 25 min. Next, transfer the mixture to a 42°C water bath for heat shock for 30 s, and immediately return it to ice for another 2 min. Then, add 300 μL of LB medium to the mixture and incubate at 37°C with shaking at 200 rpm for 2 h. After the culture is complete, centrifuge the bacterial culture at 1,500 × g for 1 min, carefully aspirate the supernatant using a pipette, and retain 50-100 μL of the residual liquid for resuspending the cells. Gently pipette to resuspend the cells, spread all the bacterial culture evenly on a plate, and place the transformed culture plate in a 37°C incubator, inverted, for 12-16 h until single colonies are clearly visible.
[0088] Furthermore, the specific steps for detecting positive clones are as follows:
[0089] ① Select regular white single colonies from the plate, pick them up with a sterile pipette tip, and inoculate them into 1 mL of LB liquid medium containing ampicillin (100 μg / mL). Place the culture tube in a constant temperature shaker (37℃) and incubate at 200 rpm for 6 h;
[0090] ② Take 0.6 μL of bacterial culture and add it to 12.5 μL of PCR reaction system. Use M13 Forward Primer and M13 Reverse Primer to screen for positive clones.
[0091] ③ Positive clones were screened by PCR amplification, excluding the 199bp vector self-ligation product. Agarose gel electrophoresis analysis was performed, and positive clones showing only a single target band (size as expected) were selected. 200 μL of this sample was sent to BGI Genomics in Shenzhen for sequencing, and the remaining bacterial culture was added to glycerol and stored at -80℃ for later use.
[0092] Furthermore, the specific steps for plasmid extraction are as follows:
[0093] Sequence alignment of the sequencing results was performed using the NCBI BLAST tool to screen for positive clones containing the correct recombinant plasmid. The validated strains were inoculated into 5 mL LB / Amp+ medium (ampicillin final concentration 100 μg / mL) for large-scale amplification. Plasmid extraction was performed using the TransGen Plasmid Mini Kit, following the specific steps outlined below:
[0094] Table 4 Reaction System
[0095]
[0096] ① Take the 14-hour culture medium, centrifuge at 10,000×g for 1 min, and carefully remove the supernatant;
[0097] ② Add buffer solution (containing 100 μg / mL RNase A) to the bacterial precipitate, and vortex at 2,000 rpm for 30 seconds until the precipitate is completely dispersed to form a homogeneous suspension;
[0098] ③ Add LB lysis buffer to the bacterial suspension and immediately gently invert and mix 5 times (with a 2-second interval between each inversion) until the solution turns into a uniform blue transparent state, indicating that the bacterial lysis is complete;
[0099] ④ Add NB solution to the blue lysis solution and gently invert and mix 6 times until the solution system turns bright yellow and forms a dense flocculent precipitate;
[0100] ⑤ Centrifuge the neutralized mixture at 12,000×g for 5 min. After centrifugation, a dense protein precipitate will be visible at the bottom of the tube. Slowly aspirate the supernatant using a pipette, avoiding disturbing the precipitate layer, and transfer the clear supernatant to a DNA purification column;
[0101] ⑥ Place the purified column containing the supernatant into a 2 mL collection tube and centrifuge at 12,000 × g for 1 min to ensure the solution passes fully through the column matrix. Discard the filtrate immediately after centrifugation, taking care to avoid touching the inside of the column.
[0102] ⑦ Add 650 μL of WB washing buffer (containing ethanol) to the purification column adsorbed with DNA, centrifuge at 12,000×g for 60s and discard the filtrate to remove residual protein and salt ions.
[0103] ⑧ Place the washed purification column in an empty collection tube and centrifuge at 12,000×g for 2 min to completely remove residual WB buffer;
[0104] ⑨ Place the centrifuge column in a new centrifuge tube, slowly add 40 μL of EB buffer along the center of the column, and let it stand at room temperature for 1 min;
[0105] ⑩ Centrifuge at 10,000×g for 1 min to complete DNA elution, collect the elution buffer into a sterile 1.5mL centrifuge tube, and store at -20℃ for later use.
[0106] Furthermore, the synthesis of dsRNA for gene interference includes the following steps:
[0107] E1. Using plasmids containing the spliceosome sequences AS1 and AS2 as templates, and spliceosome-specific primers containing the T7 sequence, PCR was performed using a high-fidelity enzyme. The system is as follows:
[0108] Table 5 PCR reaction system
[0109]
[0110] The reaction procedure is the same as described above.
[0111] E2. After the reaction is complete, the PCR products are detected by 1.5% agarose gel electrophoresis. The bands that meet the expectations are excised and the PCR products are purified.
[0112] In vitro transcription of E3 and dsRNA: The T7 in vitro transcription kit was used, and the system is as follows:
[0113] Table 6
[0114]
[0115] E4. Add each component to a 200μL sterile enzyme-free centrifuge tube, mix gently, transfer to a PCR instrument, and incubate at 37℃ for 30min to complete the transcription reaction.
[0116] E5. Add 1 μL of RNase-Free DNase I to the reaction system, mix thoroughly, and continue incubation at 37°C for 30 min to remove the DNA template.
[0117] Purification of E6 and dsRNA.
[0118] Furthermore, dsRNA purification includes the following steps:
[0119] P1, add 2.20 μL LiCl and 22 μL pre-cooled isopropanol (4℃), mix gently, and then transfer to an ultra-low temperature freezer at -80℃ for precipitation for 6-12 hours;
[0120] P2, 4℃ pre-cooled high-speed centrifuge, centrifuge at 12,000×g for 21 min to collect RNA precipitate;
[0121] P3. After discarding the supernatant, the precipitate is resuspended in 75% ethanol solution pre-cooled at 4°C and washed by centrifugation at 12,000×g for 10 min at 4°C. The washing process is repeated once.
[0122] Remove residual ethanol by centrifugation at 12,000×g and 4℃ for 1 min at P4.
[0123] P5. Place the centrifuge tubes on the pre-cooled ice box surface of the ultra-clean workbench, open the tube caps, and let them stand at room temperature for 10 minutes to ensure that the residual ethanol evaporates completely.
[0124] P6. Add 100 μL of RNase-free water to redissolve the precipitate and gently mix by blowing.
[0125] P7. The integrity of dsRNA was analyzed by 1.5% agarose gel electrophoresis, and its concentration (ng / μL) and purity (A260 / A280 ratio) were determined by UV spectrophotometer.
[0126] The present invention also provides a method for regulating the sex gene Dmrta2 in mud crabs using RNA interference, the method comprising in vitro interference treatment and in vivo interference treatment;
[0127] The in vitro interference treatment includes: first, selecting testicular tissue from mud crabs for treatment, then co-culturing the aforementioned dsRNA, transfection reagent, and testicular tissue; finally, performing paraffin sectioning and phenotypic analysis on the co-cultured testicular tissue.
[0128] The in vivo interference treatment includes: first, injecting the above-mentioned dsRNA into the body of the mud crab using a microinjector; 72 hours later, taking out the testis tissue for paraffin sectioning and phenotypic analysis.
[0129] The present invention also provides the application of dsRNA prepared according to the above-described dsRNA primers or the method described above in the preparation of inhibitors for testicular development in mud crabs.
[0130] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0131] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.
[0132] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.
[0133] Example 1: Synthesis and Validation of dsDNA Gene Fragments
[0134] Based on the specific sequences of the two spliceosomes of the Dmrta2 gene, specific primers were designed for amplifying different spliceosome fragments and synthesizing dsRNA. All specific primers in this invention were designed using Primer Premier 5.0 software and synthesized by BGI Genomics Co., Ltd. in PAGE plus mode. The two specific primer sequences designed in this invention are as follows:
[0135] dsDmrta2-AS1-T7F(SEQ ID NO.7):
[0136] GATCACTAATACGACTCAACCACGACTCTTCCCCAGAT
[0137] dsDmrta2-AS1-T7R(SEQ ID NO.8):
[0138] GATCACTAATACGACTCATCTCTCTGGTCTTGCAGGGA
[0139] dsDmrta2-AS2-T7F(SEQ ID NO.9):
[0140] GATCACTAATACGACTCAGGCTTCGTTGGCAAGATTGT
[0141] dsDmrta2-AS2-T7R(SEQ ID NO.10):
[0142] GATCACTAATACGACTCATTCCGTCTTTCAGCATCCACA
[0143] Using cDNA from the testes of *Scylla serrata* as a template, the AS1 and AS2 genes were amplified by PCR. The total PCR reaction volume was 50 μL, including: 2 μL each of forward and reverse primers (10 μM), 25 μL of 2×Phanta Flash Master Mix (Dye Plus), 2 μL of cDNA template, and ddH2O to a final volume of 50 μL. The PCR program was: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 65℃ annealing for 5 s, 72℃ extension for 5 s, and 72℃ final extension for 1 min, for 35 cycles; finally, stored at 4℃.
[0144] The AS1 and AS2 products were separated by electrophoresis on a 1.5% agarose gel. The target DNA bands were excised, recovered from the gel, and purified. The purified AS1 and AS2 DNA fragments were ligated into the pEASY-T1 cloning vector. The ligation products were then mixed with chemically competent cells on ice for transformation. After single colonies were clearly visible, positive clones were selected. After sequencing to confirm their correctness, the cells were cultured and then plasmids were extracted.
[0145] Synthesis of dsRNA: Using recombinant plasmids containing the AS1 and AS2 genes as templates, PCR reactions were performed using spliceosome-specific primers with T7 sequences and high-fidelity enzymes. After the reaction, the PCR products of AS1 and AS2 were detected by 1.5% agarose gel electrophoresis. The expected bands were excised, recovered, and purified. The purified AS1 and AS2 PCR products were transcribed in vitro using a T7 in vitro transcription kit. The transcription was incubated at 37°C for 30 min to remove the DNA template. The transcription products were then purified to obtain the dsRNA of AS1 and AS2.
[0146] Example 3: Interference of dsRNA in the Dmrta2 gene fragment of the mud crab *Scylla serrata*
[0147] In vitro interference treatment: Crabs in testicular stage III were selected and anesthetized with an ice bath for 10 min. Their body surface was then disinfected with 75% ethanol (prepared with DEPC water). Testicular tissue was quickly removed using autoclaved dissection tools and immediately placed in pre-cooled sterile 1×PBS solution (containing 1% penicillin-streptomycin and 1× gentamicin / amphomycin) for 30 min before being transferred to a cell culture chamber. Under aseptic conditions, the tissue to be cultured was transferred to 15 ml centrifuge tubes containing 1×PBS solution (containing 1% penicillin-streptomycin and 1× gentamicin / amphomycin), and washed 6 times for 5 min each time, with a new centrifuge tube used each time. The pretreated tissue samples were trimmed to 30±5 mg using sterilized scissors, washed 3 times with 1×PBS for 5 min each time, and then rinsed twice with L-15 medium containing 1% penicillin-streptomycin and 1× gentamicin / amphomycin B.
[0148] The processed tissue blocks were precisely placed in the center of each well of a 24-well culture plate, and 150 μL of the above-mentioned complete culture medium was added to each well to ensure that the tissue blocks were completely submerged. The culture plate was placed in a 26°C incubator, and after the tissues adhered to the plate for 30 min, the adherent culture medium was removed, and the 0 h sample was extracted.
[0149] Subsequently, 500 μL of L-15 medium containing 1% penicillin antibiotics was added to each well, and experimental and control groups were set up respectively: the final concentration of dsRNA added to the SpDmrta2-AS1-dsRNA group was 2.0 μg / mL, the final concentration of dsRNA added to the SpDmrta2-AS2-dsRNA group was 3.0 μg / mL, and the total concentration of E GFP-dsRNA added to the control group was 2.5 μg / mL. After the prepared 24-well culture plate was capped, it was transferred to a constant temperature incubator set at 26±0.5℃ for incubation.
[0150] Gradient sampling was performed on the AS1 experimental group, AS2 experimental group, and control group at time points of 0, 2h, 6h, 8h, 12h, and 24h after interference treatment.
[0151] In vivo interference treatment:
[0152] Scylla serrata at testicular stage III were selected, and the weight information of each crab was recorded and grouped by number. The experiment consisted of three groups: the SpDmrta2-AS1-dsRNA experimental group, the SpDmrta2-AS2-dsRNA experimental group, and the EGFP-dsRNA control group. Each group was injected with dsRNA at a dose of 1 μg / g body weight; for example, a 200g Scylla serrata crab was injected with 200 μg of dsRNA.
[0153] Injection method: Using a sterile syringe, draw up the dsRNA solution corresponding to the group and slowly inject it into the base of the swimming leg of the mud crab. Inject dsRNA once every 24 hours, for a total of 3 injections. The first injection is into the base of the left swimming leg, and the second injection is into the base of the right swimming leg, avoiding consecutive injections on the same side.
[0154] Post-injection treatment: After each injection, place the mud crabs in a bucket and let them stand for 5 minutes. After confirming that there are no abnormalities, return them to the breeding tank.
[0155] Dissection and sampling were performed 24 hours after the third injection. The crab was anesthetized with an ice bath for 10 minutes, followed by surface disinfection with 75% ethanol (prepared with DEPC water). In a laminar flow hood, the testis tissue was rapidly removed using autoclaved dissection tools and immediately placed into a pre-cooled 1.5mL sterile centrifuge tube. The tissue block was quickly rinsed three times with pre-cooled PBS solution to remove residual blood and other tissue debris. The surface liquid was gently blotted dry with filter paper to avoid excessive compression that could damage the tissue.
[0156] Microscopic observation of the slide:
[0157] Tissue blocks from the AS1 and AS2 experimental groups, as well as the control group, after in vivo and in vitro interference treatments, were transferred to 4% paraformaldehyde fixative and fixed at room temperature for 24 hours. After fixation, each tissue block was rinsed three times with 1×PBS for 10 minutes each time to remove the fixative. Subsequently, they underwent gradient ethanol dehydration (70%, 80%, 90%, 95%, and 100% ethanol, 30 minutes each), xylene clearing (I and II, 15 minutes each), and paraffin embedding. The embedded tissues were serially sectioned using a microtome to a thickness of 5 μm. After spreading and baking, the sections were stained with hematoxylin and eosin (HE) as usual. The morphological differences of each tissue were then observed under a microscope. Figure 1 As shown.
[0158] The results showed that the in vitro interference efficiency test results were as follows: Figure 2 As shown: the variable splice AS1 achieved the best interference efficiency after 6 hours, with an overall interference efficiency of 80%; the variable splice AS2 also achieved the best interference efficiency after 6 hours, with an overall interference efficiency of 90%.
[0159] In vivo interference efficiency test results are as follows Figure 3 As shown, the overall efficiency of the in-body interference efficiency of both the variable splice bodies AS1 and AS2 can reach 60%.
[0160] In vitro interference morphology observation results are as follows Figure 4 As shown, after interfering with SpDmrta2-AS1, the testis tissue exhibited a "vacuolar phenomenon," with almost no sperm cells present in the seminiferous tubules; after interfering with SpDmrta2-AS2, the number of sperm cells in the seminiferous tubules was greatly reduced; it can be concluded that the two alternative splice variants of the Dmrta2 gene play different important roles in testis development.
[0161] In vivo interference morphology observation results are as follows Figure 5 As shown, a significant reduction in sperm cells was also observed in the seminiferous tubules of the testis tissue, similar to the results of in vitro interference experiments. This suggests that the two alternative splice variants of the Dmrta2 gene play an important role in testis development.
[0162] In summary, the method provided by this invention can successfully interfere with the expression of the Dmrta2 gene alternative splice variant in both in vivo and in vitro tissue cultures of mud crabs using RNA interference. Furthermore, it has been successfully observed that the Dmrta2 gene alternative splice variant interference resulted in the inhibition or abnormality of spermatogenesis in the testes and tissue changes such as testicular cavity formation.
[0163] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A dsRNA for regulating the sex gene Dmrta2 in mud crabs, characterized in that, The dsRNA was obtained by in vitro transcription using a spliceosome sequence as a template. The spliceosome sequence includes AS1 or AS2; The nucleotide sequence of AS1 is SEQ ID NO.11; The nucleotide sequence of AS2 is SEQ ID NO.
12.
2. The method for preparing dsRNA as described in claim 1, characterized in that, The preparation method includes the following steps: S1: Using cDNA from the testes of mud crabs as a template, a plasmid with a spliceosome sequence was synthesized. S2: Using the plasmid of the spliceosome sequence obtained in step S1 as a template, design primer pairs with the T7 promoter sequence; S3: Obtain the template for the dsRNA by PCR amplification; S4: The template obtained in step S3 is transcribed in vitro to synthesize dsRNA and then purified.
3. The preparation method according to claim 2, characterized in that, The specific steps of step S1 include: designing primer pairs based on the Dmrta2 gene, using cDNA from the testes of the mud crab as a template, performing PCR amplification to obtain the target DNA band; recovering and purifying the obtained target band, ligating the purified DNA fragment with a vector to obtain a recombinant vector; transforming the recombinant vector into competent cells, screening positive clones and sequencing them for verification, and amplifying and culturing the correctly sequenced positive clones to extract plasmids.
4. The preparation method according to claim 3, characterized in that, The primer pair includes dsDmrta2-AS1 or dsDmrta2-AS2; The dsDmrta2-AS1 includes the forward primer dsDmrta2-AS1-F and the reverse primer dsDmrta2-AS1-R; The sequence of dsDmrta2-AS1-F is shown in SEQ ID NO.3; The sequence of dsDmrta2-AS1-R is shown in SEQ ID NO.4; The dsDmrta2-AS2 includes the forward primer dsDmrta2-AS2-F and the reverse primer dsDmrta2-AS2-R; The sequence of dsDmrta2-AS2-F is shown in SEQ ID NO.5; The sequence of dsDmrta2-AS2-R is shown in SEQ ID NO.
6.
5. The preparation method according to claim 2, characterized in that, The primer pair containing the T7 promoter sequence mentioned in step S2 includes dsDmrta2-AS1-T7 or dsDmrta2-AS2-T7; the sequence of dsDmrta2-AS1-T7 is shown in SEQ ID NO.7 and SEQ ID NO.8; the sequence of dsDmrta2-AS2-T7 is shown in SEQ ID NO.9 and SEQ ID NO.
10.
6. The preparation method according to claim 2, characterized in that, The total PCR amplification reaction system in step S3 is 50 μL, including: 2 μL each of forward and reverse primers (10 μM), 25 μL of 2×Phanta Flash Master Mix (Dye Plus), 2 μL of cDNA template, and ddH2O to bring the total to 50 μL; the reaction program is: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 65℃ annealing for 5 s, 72℃ extension for 5 s, 72℃ final extension for 1 min, for 35 cycles; and finally, storage at 4℃.
7. A method for RNA interference to regulate the sex gene Dmrta2 in mud crabs, characterized in that, The method includes in vitro interference treatment and in vivo interference treatment; The in vitro interference treatment includes: firstly, selecting testicular tissue from mud crabs for treatment, then co-culturing the dsRNA and transfection reagent described in claim 1 with the testicular tissue; finally, performing paraffin sectioning and phenotypic analysis on the co-cultured testicular tissue. The in vivo interference treatment includes: first, injecting the dsRNA described in claim 1 into the body of the blue crab using a microinjector; 72 hours later, taking out the testis tissue for paraffin sectioning and phenotypic analysis.
8. The method according to claim 7, characterized in that, The testis tissue of the mud crab was selected from stage III testis; the transfection reagents were spliceosome 1AS1 and spliceosome 2AS2; the transfection concentration of AS1 was 2.0 μg / mL and the transfection concentration of AS2 was 3.0 μg / mL; the co-culture time was 24 h.
9. The method according to claim 7, characterized in that, The dosage of the injected dsRNA was 1.0 ± 0.3 μg / g body weight; the injection was performed every 24 hours for a total of 3 injections.
10. The application of the dsRNA primer according to claim 1 or the dsRNA prepared by the method according to any one of claims 2-6 in the preparation of an inhibitor of testicular development in mud crabs.
Citation Information
Patent Citations
RNAi reagent for interfering portunus trituberculatus sex determining gene expression as well as RNAi method and application thereof
CN114015688A
RNA interference method for studying Abd-A gene regulation and control of abdominal limb development of scylla paramamosain larva
CN116769839A
Procambarus clarkii gene Dmrt1 as well as extraction and application thereof
CN117737074A