Multiple nucleic acid detection kit for plasmodium and matched artificial chromosome engineering bacterium quality control product

Abstract

The invention relates to the technical field of gene engineering and nucleic acid detection, and particularly discloses a plasmodium multiple nucleic acid detection kit and a matched artificial chromosome engineering bacterium quality control product. The kit comprises a plasmodium falciparum specific primer probe group, a plasmodium vivax specific primer probe group, a plasmodium malaria malaria specific primer probe group and a plasmodium ovale specific primer probe group, and other PCR reaction system components, and can realize high-specificity, high-sensitivity and high-accuracy typing detection of target genes of the four kinds of plasmodium. The establishment of a fluorescence PCR and digital PCR quantitative detection gradient dilution standard curve and the performance verification requirements of a nucleic acid extraction kit are met. The quality control product is escherichia coli engineering bacteria carrying recombinant artificial chromosomes, 18S rRNA gene consistency sequence fragments of plasmodium falciparum, plasmodium vivax, plasmodium malaria and plasmodium ovale are integrated in the chromosomes of the escherichia coli engineering bacteria, and the quality control product has good species specificity, nuclease tolerance, structural stability and simulation sample extraction characteristics.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and gene detection technology, specifically to a Plasmodium multiplex nucleic acid detection kit and a matching quality control product for engineered bacteria with artificial chromosomes. Background Technology

[0002] Malaria, one of the most widespread and deadliest vector-borne infectious diseases globally, is caused by Plasmodium. In 2023, there were 263 million new cases and 597,000 deaths worldwide, with approximately 94% of cases and 95% of deaths occurring in Africa. The four causative Plasmodium species are Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale.

[0003] Among them, Plasmodium, with the highest mortality rate, dominates endemic areas in Africa and exhibits widespread resistance to multiple antimalarial drugs; Plasmodium malariae is widely distributed outside sub-Saharan Africa, and together they constitute the largest disease burden of malaria. Of the remaining species, Plasmodium malariae can cause long-term chronic infection in humans; Plasmodium vivax and Plasmodium ovale can both form dormant forms in the liver, requiring combined treatment with primaquine to eradicate them and prevent relapse. Therefore, accurate identification of the infecting species is crucial for developing regionally targeted prevention and control strategies and precise clinical interventions.

[0004] The 18S rRNA gene (approximately 2,100 bp) in the Plasmodium nuclear genome is an ideal target for nucleic acid detection due to its combination of conservation and interspecies diversity. Studies have shown that the 18S rRNA genes of Plasmodium vivax and Plasmodium ovale exhibit species-specific variations in their variable regions. For example, the 18S rRNA gene of Plasmodium ovale in Vietnamese isolates shows two nucleotide deletions and one substitution mutation, rendering traditional probes ineffective for recognition. The 18S rRNA gene of Plasmodium malariae possesses a characteristic sequence in the probe-binding region. These differences provide a molecular biological basis for the development of multiplex PCR detection methods.

[0005] Although the 18S rRNA gene is widely used in patent literature for malaria parasite detection published in applications CN201280072439.4, CN202010113300.6, CN202410346433.6, and CN201610800142.5, traditional plasmid DNA quality control products have significant limitations. For example, the supercoiled structure of conventional plasmids is susceptible to temperature and pH changes, leading to Ct value drift.

[0006] Therefore, developing a multiplex quality control product and a multiplex detection kit for Plasmodium based on recombinant artificial chromosome engineered bacteria has significant technical value and application prospects. It can not only improve the accuracy, sensitivity and specificity of detection of different types of Plasmodium, but also meet the needs of large-scale production and multi-scenario applications. Summary of the Invention

[0007] To address the shortcomings of existing technologies, the present invention provides the following technical solution:

[0008] This invention provides a Plasmodium multiplex fluorescent PCR nucleic acid detection kit and a matching quality control product for engineered bacteria with artificial chromosomes.

[0009] This invention precisely targets species-specific targets through multidimensional evolutionary analysis, effectively avoiding interference from homologous sequences between species: First, download the 18S rRNA gene sequence library of Plasmodium falciparum covering the epidemic strains of five continents (Plasmodium falciparum n=120, Plasmodium vivax n=98, Plasmodium malariae n=45, Plasmodium ovale n=62) from NCBI GenBank, and use MEGA software to perform a three-level screening process: (1) perform global multiple sequence alignment using the ClustalW algorithm to identify conserved homologous regions; (2) construct a maximum likelihood phylogenetic tree (Bootstrap=1000 times) to locate the interspecific differentiation branch nodes; (3) extract ≥50bp species-specific diagnostic regions (SSDRs) on both sides of the differentiation nodes, requiring that the SSDR must contain ≥3 non-contiguous single nucleotide variant sites (SNPs), and be verified by BLASTn to have <85% homology with other species. The four Plasmodium homologous sequences obtained in this way effectively avoided the high homology risk region of the V4-V9 variable region, ensuring that each target gene has absolute species uniqueness.

[0010] The accompanying engineered bacterial quality control product containing artificial chromosomes includes engineered Escherichia coli carrying recombinant artificial chromosomes. The artificial chromosomes contain target fragments of the consistent full-length 18S rRNA gene sequences of Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale. The consistent sequences are selected by downloading 18S rRNA gene sequences from multiple species, performing global alignment and phylogenetic tree analysis, and screening out highly conserved full-length consistent sequences of each Plasmodium species as target genes for the quality control product. The engineered *E. coli* strain was prepared by integrating the homologous 18S rRNA sequences of *Plasmodium falciparum*, *Plasmodium vivax*, *Plasmodium malariae*, and *Plasmodium ovale* into the *E. coli* artificial chromosome using homologous recombination technology, thus completely preserving the engineered bacterial cell structure. The *Plasmodium falciparum* 18S rRNA sequence is shown in SEQ ID NO:1, the *Plasmodium vivax* 18S rRNA sequence is shown in SEQ ID NO:2, the *Plasmodium malariae* 18S rRNA sequence is shown in SEQ ID NO:3, and the *Plasmodium ovale* 18S rRNA sequence is shown in SEQ ID NO:4.

[0011] In the method for preparing the engineered bacteria carrying the recombinant artificial chromosome of Plasmodium 18S rRNA gene fragment, the artificial chromosome is constructed through homologous recombination mediated by Tn7 transposons using the shuttle plasmid vector pBac-N-EGFP (Beyotime, catalog number D2805) and DH10Bac competent cells (Beyotime, catalog number D0346) system derived from Beyotime Biotechnology. The original application of this system was to transfer the recombinant artificial chromosome into insect cells and package it to produce recombinant baculoviruses. However, this application only involves generating a recombinant artificial chromosome carrying the target gene through homologous recombination mediated by a shuttle plasmid, which is another application of this system. It should be noted that the construction of recombinant artificial chromosomes in this invention is not limited to using the shuttle plasmid vector pBac-N-EGFP and DH10Bac competent cells; other shuttle plasmids and artificial chromosome systems can also achieve this technical objective. The 18S rRNA gene fragment of Plasmodium falciparum is integrated into the artificial chromosome of engineered Escherichia coli via homologous recombination mediated by this shuttle plasmid vector. The construction method includes: firstly, using a seamless ligation method, the 18S rRNA gene fragments of Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale are respectively ligated into the shuttle plasmid vector pBac-N-EGFP. The obtained recombinant shuttle plasmid vector is further transformed into the host bacteria. After screening and identification, engineered bacteria carrying recombinant artificial chromosomes of 18S rRNA gene fragments of Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale are obtained.

[0012] In this invention, the engineered bacterial culture obtained is heat-inactivated and then diluted with phosphate buffer to a concentration containing recombinant artificial chromosomes of 18S rRNA gene fragments from Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale. This engineered bacterial quality control product has the following characteristics: the preparation process preserves the engineered bacterial cell structure, providing a protective layer against exogenous nuclease degradation of internal nucleic acids, and retains the characteristic attribute that nucleic acid extraction is required for PCR amplification. It also exhibits good uniformity and stability when stored at -20°C to room temperature. The recombinant artificial chromosome exists stably in the engineered bacteria at a low copy number, with each engineered bacterium carrying only 1-2 copies of the artificial chromosome. Batch-to-batch consistency is good, overcoming the variability of natural pathogen culture and the instability of synthesized fragments. Compared to the hundreds of copies of general plasmids, it is more stable. The copy number concentration of the Plasmodium 18S rRNA target gene carried by the recombinant artificial chromosome in the engineered bacterial quality control product is determined by digital PCR.

[0013] The quality control material for malaria parasite nucleic acid detection can be used in the following scenarios:

[0014] Quality control of accuracy and precision in high and low concentration ranges of fluorescent PCR.

[0015] Establish a standard curve that meets the requirements of accurate quantitative detection specifications for fluorescent PCR and digital PCR.

[0016] This quality control sample is used for performance validation of nucleic acid extraction kits. By testing this quality control sample, the extraction efficiency and quality of the nucleic acid extraction kit can be evaluated.

[0017] It should be understood that the application of the Plasmodium nucleic acid detection quality control product of the present invention is not limited to this, and any commercial application of the Plasmodium nucleic acid detection quality control product of the present invention is within the protection scope of the present invention.

[0018] According to another aspect of the present invention, the present invention further provides a Plasmodium multiplex fluorescent PCR nucleic acid detection kit, which comprises the above-mentioned quality control materials, PCR reaction solution, Taq enzyme, and specific primer and probe sets for Plasmodium falciparum (upstream primer: SEQ ID NO:15, probe: SEQ ID NO:17, downstream primer: SEQ ID NO:16), Plasmodium vivax (upstream primer: SEQ ID NO:18, probe: SEQ ID NO:20, downstream primer: SEQ ID NO:19), Plasmodium ovale (upstream primer: SEQ ID NO:21, probe: SEQ ID NO:23, downstream primer: SEQ ID NO:22), and Plasmodium malariae (upstream primer: SEQ ID NO:24, probe: SEQ ID NO:26, downstream primer: SEQ ID NO:25). The quality control materials are preferably room temperature storable, and the Taq enzyme is also preferably room temperature storable, facilitating the transportation and use of the kit. The quality control samples contained in the kit can be serially diluted at least five times to establish a standard curve that meets the requirements of fluorescence PCR and digital PCR quantitative detection, thereby achieving accurate quantitative detection.

[0019] The quality control material for Plasmodium nucleic acid detection provided by this invention inserts the optimized full-length sequence of the Plasmodium 18S rRNA gene into the artificial chromosome of engineered bacteria, enabling it to stably replicate and propagate within the engineered bacteria. This engineered bacteria form of quality control material has the following significant technical advantages:

[0020] (1) The core breakthrough of this invention lies in effectively solving the problem of cross-reaction caused by homologous sequences between species in multiplex genotyping of Plasmodium based on 18S rRNA genes. By constructing a phylogenetic tree covering 18S rRNA genes of Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale, species-specific single nucleotide variant sites (SNPs) of the four pathogens were located, and full-length consistent sequences were screened as target genes for quality control products. This strategy avoids the risk of non-specific probe binding caused by the high similarity of homologous regions in traditional targets from the source, ensuring that each target gene has ≥3 absolute species-specific SNP markers. Compared with conventional local sequence alignment methods, the global evolutionary analysis of the phylogenetic tree can accurately identify interspecific differentiation branches, eliminate interference from horizontal gene transfer or gene chimeras, and achieve a species uniqueness verification accuracy of 100% for the target genes of quality control products, effectively improving the detection specificity of the accompanying kit.

[0021] (2) The engineered bacterial quality control product carrying the recombinant artificial chromosome of Plasmodium in this invention has a better ability to simulate the nucleic acid extraction process in the sample than plasmids and synthetic DNA, and is more suitable for use as a quality control product for nucleic acid detection.

[0022] (3) Compared with conventional plasmids, the engineered bacteria quality control products prepared by this invention are less likely to produce nucleic acid topological structures (such as supercoiled structures), are suitable for inserting long fragments, and have high stability. Even under high temperature, different pH values ​​or other adverse conditions, the engineered bacteria can still maintain the integrity of the target gene and its PCR amplification efficiency.

[0023] (4) Each engineered bacterium carries only 1-2 copies of artificial chromosome, and the exogenous DNA is not easily rearranged or lost. Compared with the hundreds of copies of general plasmids, it is more stable, accurate and reliable.

[0024] (5) The developed multiplex fluorescent PCR kit designs orthogonal primer-probe combinations for the conserved and variant regions of four types of Plasmodium, and combines them with fluorescent PCR to achieve highly specific amplification of four targets in a single tube reaction. At the same time, it integrates internal control genes and positive controls to comprehensively monitor the efficiency of nucleic acid extraction and amplification.

[0025] (6) At the level of using quality control products and reagent kits together, this invention establishes a standardized quality control system for the entire process: the quality control product of recombinant artificial chromosome engineered bacteria retains the cell structure, simulates the nucleic acid extraction characteristics of the sample, and undergoes lysis, purification and amplification steps synchronously with the sample, accurately reflecting the detection limit and anti-interference ability of the reagent kit; furthermore, it achieves accurate traceability of pathogen load through the linear range of the quantitative standard curve, providing a standardized tool for malaria typing diagnosis and efficacy evaluation. Attached Figure Description

[0026] Figure 1 Electrophoresis diagrams of bacterial culture PCR identification of plasmid vectors pBac-PF-18S-M (Plasmodium falciparum), pBac-PV-18S-M (Plasmodium vivax), pBac-PO-18S-M (Plasmodium ovale), and pBac-PM-18S-M (Plasmodium malariae) in Example 2 of this invention.

[0027] Figure 2 The plasmid vector maps of pBac-PF-18S-M (Plasmodium falciparum), pBac-PV-18S-M (Plasmodium vivax), pBac-PO-18S-M (Plasmodium ovale), and pBac-PM-18S-M (Plasmodium malariae) constructed in Example 2 of this invention are shown, with only the elements relevant to this application marked.

[0028] Figure 3The results of nuclease treatment were obtained for the engineered Plasmodium strain quality control and control plasmid in Example 6 of this invention. The results showed that the Ct value of the engineered strain quality control did not differ significantly before and after nuclease treatment; however, the Ct value of the plasmid changed significantly after nuclease treatment.

[0029] Figure 4 This document presents the verification results of the extraction and monitoring capabilities of the engineered Plasmodium strain quality control and plasmid (E6 copies / mL) in Example 7 of this invention. The results show that the Ct values ​​of the quality control strain differed significantly before and after extraction; however, there was no significant difference in Ct values ​​between plasmid extraction and non-extraction conditions.

[0030] Figure 5 The Ct values ​​of the engineered Plasmodium strains and plasmids in Example 8 of this invention are statistically analyzed at 4°C, 25°C, and 37°C for storage stability. The results show that the Ct values ​​of the control samples did not differ significantly at the three storage temperatures.

[0031] Figure 6 The results show the linearity and amplification efficiency of the quality control sample and plasmid in Example 9 of *Plasmodium ovale*. The results show that the linear correlation coefficient and amplification efficiency of the quality control sample both meet the standard (R2 > 0.99, amplification efficiency E in the range of 0.9 to 1.1).

[0032] Figure 7 The results show the linearity and amplification efficiency of the quality control sample and plasmid in Example 9 of *Plasmodium falciparum*. The results show that the linear correlation coefficient and amplification efficiency of the quality control sample both meet the standard (R2 > 0.99, amplification efficiency E in the range of 0.9 to 1.1).

[0033] Figure 8 The results show the linearity and amplification efficiency of the quality control sample and plasmid in Example 9 of *Plasmodium malariae*. The results show that the linear correlation coefficient and amplification efficiency of the quality control sample both meet the standard (R2 > 0.99, amplification efficiency E in the range of 0.9 to 1.1).

[0034] Figure 9 The results show the linearity and amplification efficiency of the quality control sample and plasmid in Example 9 of *Plasmodium vivax*. The results show that the linear correlation coefficient and amplification efficiency of the quality control sample both meet the standard (R2 > 0.99, amplification efficiency E in the range of 0.9 to 1.1).

[0035] Figure 10 The results of cross-genotyping tests on individual engineered Plasmodium strains in Example 10 of this invention are shown. The results indicate that all quality control samples showed amplification only in their corresponding channels, and there was no cross-signal.

[0036] Figure 11 The results of the typing test of the combined engineered bacteria and Plasmodium malariae quality control samples in Example 10 of this invention show that the mixed quality control samples can still accurately type the bacteria. Detailed Implementation

[0037] The following describes embodiments of the present invention, but the present invention is not limited thereto. The present invention is not limited to the various configurations described below, and various modifications can be made within the scope of the claims. Embodiments and examples obtained by appropriately combining the technical means disclosed in different embodiments and examples are also included in the technical scope of the present invention.

[0038] definition

[0039] In this invention, the range of values ​​represented by “value A ~ value B” or “value A - value B” refers to the range that includes the endpoint values ​​A and B.

[0040] In this invention, the numerical range indicated by "above" or "below" refers to the numerical range that includes the stated number.

[0041] In this invention, the word "may" has both the meaning of performing a certain process and the meaning of not performing a certain process. In this specification, "optional" or "optionally" means that the event or situation described below may or may not occur, and the description includes both the case where the event occurs and the case where the event does not occur.

[0042] In this invention, the terms "a", "an", or "the" may refer to "one", "one or more", "at least one", or "one or more".

[0043] In this invention, the terms "comprising," "having," "including," or "containing" can mean included or open-ended, and do not exclude additional, uncited elements or method steps. At the same time, "comprising," "having," "including," or "containing" can also mean closed-ended, excluding additional, uncited elements or method steps.

[0044] In this invention, the term "about" can mean that a value includes the standard deviation of the error of the apparatus or method used to determine that value. The numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains a standard deviation due to the aforementioned testing apparatus or method. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this invention are modified with "about". Here, "about" generally means that the actual value is within ±10%, ±5%, ±1%, or ±0.5% of a particular value or range.

[0045] In this invention, "target gene" refers to the gene targeted by nucleic acid detection. For example, when nucleic acid detection is performed using PCR, the target gene includes the gene fragment to be amplified by PCR.

[0046] In this invention, a "vector" is a replicon, such as a plasmid, bacteriophage, virus, artificial chromosome, or granule, to which another DNA segment (i.e., an "insertion") may be attached to the replicon to induce replication of the attached segment in the cell. Further, the vector may include, for example, a collection of genetic elements that regulate gene expression, such as promoters and enhancers; (2) a structural or coding sequence transcribed into mRNA and translated into protein; and (3) a transcriptional subunit containing appropriate transcription and translation initiation and termination sequences.

[0047] In this invention, an artificial chromosome is constructed via Tn7 transposon-mediated homologous recombination using the shuttle plasmid vector pBac-N-EGFP (Beyotime, catalog number D2805) and DH10Bac competent cells (Beyotime, catalog number D0346) system derived from Beyotime Biotechnology. The original application of this system was to transfer recombinant artificial chromosomes into insect cells and package them to produce recombinant baculoviruses. However, this invention only involves generating a recombinant artificial chromosome carrying the target gene via shuttle plasmid-mediated homologous recombination, representing another application of this system. It should be noted that the construction of recombinant artificial chromosomes in this invention is not limited to using the shuttle plasmid vector pBac-N-EGFP and DH10Bac competent cells; other shuttle plasmids and artificial chromosome systems can also achieve this technical objective. Furthermore, "engineered bacteria carrying artificial chromosomes" refers to *E. coli* engineered bacteria carrying an artificial chromosome with the 18S homologous sequence of the *Plasmodium* target gene.

[0048] In this invention, "consistent sequence" or "optimized sequence" or "consistent optimized sequence" refers to a representative nucleotide sequence generated by performing site-specific statistical analysis on a set of functional or evolutionarily related nucleotide sequences using multiple sequence alignment (MSA) technology.

[0049] In this invention, "standard curve conforming to the requirements of fluorescence PCR and digital PCR quantitative detection specifications" refers to...

[0050] By serially diluting standards of known concentrations (such as plasmid DNA or purified PCR products), followed by fluorescent PCR amplification, a linear relationship curve is established between the cycle threshold (Ct value) and the logarithm of the initial template concentration. This standard curve must meet the requirements of the specification "Performance Evaluation Requirements for Biotechnology Nucleic Acid Target Sequence Quantification Methods: qPCR and dPCR" (GB / T 42077-2022), namely, a linear correlation coefficient (R²).2 The amplification efficiency (E) was greater than 0.99 and within the range of 0.9 to 1.1, to verify the accuracy, sensitivity and quantitative reliability of the detection system.

[0051] Unless otherwise defined, other technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0052] The 18S rRNA sequence of Plasmodium falciparum in this application (SEQ ID NO:1).

[0053] The 18S rRNA sequence of Plasmodium vivax in this application (SEQ ID NO:2).

[0054] The 18S rRNA sequence of Plasmodium malariae in this application (SEQ ID NO:3).

[0055] The 18S rRNA sequence of Plasmodium ovale in this application (SEQ ID NO:4).

[0056] The nucleotide sequence of the upstream primer PF-18S-MF for Plasmodium falciparum (SEQ ID NO:5).

[0057] The nucleotide sequence of the downstream primer PF-18S-MR of Plasmodium falciparum (SEQ ID NO:6).

[0058] The nucleotide sequence of the upstream primer PV-18S-MF for Plasmodium vivax (SEQ ID NO:7).

[0059] The nucleotide sequence of the downstream primer PV-18S-MR of Plasmodium vivax (SEQ ID NO:8).

[0060] The nucleotide sequence of the upstream primer PM-18S-MF for Plasmodium malariae (SEQ ID NO:9).

[0061] The nucleotide sequence of the downstream primer PM-18S-MR of Plasmodium malariae (SEQ ID NO:10).

[0062] The nucleotide sequence of the upstream primer PO-18S-MF for Plasmodium ovale (SEQ ID NO:11).

[0063] The nucleotide sequence of the downstream primer PO-18S-MR of Plasmodium ovale (SEQ ID NO:12).

[0064] pUC / M13-F primer sequence (SEQ ID NO:13).

[0065] pUC / M13-R primer sequence (SEQ ID NO:14).

[0066] The upstream primer sequence for fluorescent PCR of Plasmodium falciparum (SEQ ID NO:15).

[0067] The downstream primer sequence for fluorescent PCR of Plasmodium falciparum (SEQ ID NO:16).

[0068] Probe sequence for fluorescent PCR of Plasmodium falciparum (SEQ ID NO:17).

[0069] The upstream primer sequence for fluorescent PCR of Plasmodium vivax (SEQ ID NO:18).

[0070] The downstream primer sequence for fluorescent PCR of Plasmodium vivax (SEQ ID NO:19).

[0071] Probe sequence for fluorescent PCR of Plasmodium vivax (SEQ ID NO:20).

[0072] The upstream primer sequence for fluorescent PCR of Plasmodium ovale (SEQ ID NO:21).

[0073] The downstream primer sequence for fluorescent PCR of Plasmodium ovale (SEQ ID NO:22).

[0074] Probe sequence for fluorescent PCR of Plasmodium ovale (SEQ ID NO:23).

[0075] The upstream primer sequence for Plasmodium malariae fluorescence PCR (SEQ ID NO:24).

[0076] The downstream primer sequence for Plasmodium malariae fluorescence PCR (SEQ ID NO:25).

[0077] The probe sequence for fluorescent PCR of Plasmodium malariae (SEQ ID NO:26).

[0078] The preparation method of recombinant artificial chromosome engineered bacteria is as follows:

[0079] (1) Obtaining the full-length identical sequence of 18S rRNA from Plasmodium and digesting and recovering the pBac vector

[0080] First, the full-length 18S rRNA gene was optimized and analyzed. The obtained homologous sequences were named PF-18S-M (Plasmodium falciparum), PV-18S-M (Plasmodium vivax), PO-18S-M (Plasmodium ovale), and PM-18S-M (Plasmodium malariae), which are the sequences shown in SEQ ID NO:1-4. Each sequence is approximately 2100 bp in length. The fragment was amplified using the corresponding specific primer pairs (sequences shown in SEQ ID NO:5-12) and Q5 enzyme (NEB, catalog number M0493L). Simultaneously, the pBac-N-EGFP vector (Beyotime Biotech, catalog number D2805) was digested with EcoRI and HindIII restriction endonucleases. The digestion system consisted of 5 μL of 10×M buffer, 1 μL each of EcoRI and HindIII restriction endonucleases, 1.5 μg of plasmid, and ddH2O added to a final volume of 50 μL. Digestion was carried out at 37°C for 3 h. The amplified fragment PF-18S-M and the pBac-N-EGFP linear vector were purified and recovered using a Takara gel extraction kit (Takara Bio Inc, catalog number 9762).

[0081] (2) Ligation of 18S rRNA fragment with pBac-N-EGFP linear vector

[0082] The purified and recovered PF-18S-M fragment was seamlessly ligated into the pBac linear vector to construct the pBac-PF-18S-M plasmid vector. The ligation system consisted of 2 μL of 5×In-Fusion HD Enzyme Premix, 2 μL of pBac linear vector, 2 μL of the gel-recovered PF-18S-M fragment, and 4 μL of ddH2O, forming a 10 μL reaction mixture. Ligation was carried out at 50°C for 15 min. (The In-Fusion HDEnzyme Premix was sourced from Takara Bio Inc., catalog number 638911).

[0083] (3) Transformation and extraction of pBac-PF-18S-M plasmid vector

[0084] DH5α (Takara Bio Inc., catalog number 9057) was selected as the competent strain. This competent strain was transformed using the aforementioned ligation product and inoculated into ampicillin (Amp)-resistant LB agar plates, incubated overnight at 32-37°C. Clones that survived and amplified due to the Amp resistance tag on the plasmid were considered successfully transformed. The plasmid was isolated using alkaline lysis extraction, purified by ion-exchange column chromatography, TE buffer elution, and endotoxin removal. Positive clones were identified using PCR. After successful sequencing identification, the next experimental step was performed.

[0085] (4) Construction of artificial chromosomes of engineered bacteria

[0086] The pBac-PF-18S-M plasmid vector was added to *E. coli* DH10Bac competent cells (Beyotime Biotechnology Co., Ltd., catalog number D0346) containing the vector bMON14272 and a helper plasmid (used to express the transposable protein necessary for transposition). Transformation of this strain with the pBac recombinant plasmid resulted in transposition between the mini-Tn7 element in the pBac recombinant plasmid and the mini-attTN7 element on the vector bMON14272, thus forming a recombinant artificial chromosome. Site-specific transposition disrupts the host's lacZα gene, allowing for blue-white screening of recombinant clones. Homologous recombination was then performed in DH10Bac bacterial cells after a treatment involving ice bath-heat shock-ice bath followed by shaking at 37°C for 4 hours. The cultured bacterial suspension was evenly spread onto LB fixation medium containing kanamycin, tetracycline, gentamicin, X-Gal, and IPTG (Shanghai Sangon Biotech Co., Ltd., catalog number B541007), and incubated at an incubator to screen for homologous recombinant artificial chromosome clones. Positive white monoclonal colonies were picked and incubated on LB liquid medium containing kanamycin, tetracycline, and gentamicin at 37°C to obtain engineered bacteria carrying homologous recombinant artificial chromosomes.

[0087] DNA was extracted from engineered bacteria carrying artificial chromosomes using the Omega BAC / PAC Large Basic Plasmid Extraction Kit (Omega Bio-Tek, catalog number D2156). The DNA was used as a template, and PCR amplification and sequencing of the bacterial strain were performed using pUC / M13-F (sequence shown in SEQ ID NO:13) and pUC / M13-R (sequence shown in SEQ ID NO:14) as primers. After successful PCR identification and sequencing alignment, the bacterial strain was preserved, and glycerol-containing bacteria were prepared for further experiments.

[0088] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified, specific conditions in the examples are performed under conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, all materials and instruments used are conventional products that can be purchased.

[0089] Example 1: Screening and Validation of Species-Specific Sequences of Plasmodium 18S rRNA

[0090] 1.1 Data Sources and Preprocessing: Full-length 18S rRNA gene sequences of prevalent Plasmodium strains from five continents worldwide were downloaded from NCBI GenBank, including Plasmodium falciparum (120 sequences, covering African / Southeast Asian strains), Plasmodium vivax (98 sequences, including temperate / tropical subtypes), Plasmodium malariae (45 sequences), and Plasmodium ovale (62 sequences, including curtis / wallikeri subtypes). Sequences <1800 bp or containing >1% N bases were removed using BioEdit 7.2.5 software, ultimately retaining 300 high-quality sequences to construct the database.

[0091] 1.2 Multiple sequence alignment and homology region identification: ClustalW global alignment was performed using MEGA 11.0 (parameters: GapOpening Penalty=15, Gap Extension Penalty=6.66), and cross-species high homology fragments were found in the V4-V9 variable region.

[0092] 1.3 Phylogenetic Tree Construction and SSDR Localization: The phylogenetic tree was constructed using the maximum likelihood method (model: GTR+G+I, Bootstrap=1000). The 50-200bp interval was extracted from the flanking of the interspecific divergence nodes with a self-expansion support rate >90% as candidate SSDRs.

[0093] 1.4 SSDR Screening and Validation:

[0094] -SNP density requirement: The candidate SSDR must contain ≥3 non-contiguous species-specific SNPs.

[0095] - Homology threshold: BLASTn validation showed that the candidate SSDR had the highest homology with the other four Plasmodium species <85% (E value <1e-30).

[0096] -Secondary structure adaptation: RNAfold prediction showed that SSDR was located in the 18S rRNA loop region.

[0097] The SSDR sequences of four Plasmodium species were finally obtained, and the differences in Tm values ​​between pairwise comparisons between the species were all >5℃ (calculated using OligoCalcv3.27).

[0098] 1.5 Synthesis of Plasmodium 18S rRNA gene sequences: SSDR sequences of four Plasmodium species were BLASTn-matched to obtain the full-length 18S rRNA sequences of Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale. The non-SSDR sequences with the highest homology were extracted and combined with the SSDR sequences obtained in 1.4 above, and the sequences were assembled according to the start and stop sites of the 18S rRNA gene. The resulting full-length identical sequences of the 18S rRNA of Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale (SEQ ID NO: 1-4) were obtained, abbreviated as PF-18S-M (Plasmodium falciparum), PV-18S-M (Plasmodium vivax), PO-18S-M (Plasmodium ovale), and PM-18S-M (Plasmodium malariae). These sequences were then sent to GenScript Biotech Co., Ltd. for synthesis, yielding 18S rRNA sequences of Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale. The conventional pUC plasmids containing the full-length rRNA target fragment are named pUC57-PF-18S-M (Plasmodium falciparum), pUC57-PV-18S-M (Plasmodium vivax), pUC57-PO-18S-M (Plasmodium ovale), and pUC57-PM-18S-M (Plasmodium tertianum), respectively.

[0099] Example 2: Construction of the pBac-PF-18S-M plasmid vector for Plasmodium malariae

[0100] 2.1 PCR amplification and purification recovery of the optimized 18S sequence of Plasmodium malariae

[0101] Table 2.1 Nucleotide sequences of amplification primers for PF design sequences

[0102]

[0103] PCR primer pairs (PF-18S-MF / R, PV-18S-MF / R, PO-18S-MF / R, and PM-18S-MF / R, SEQ ID NO:5-12) for Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale were designed for plasmid vector construction, as shown in Table 2.1. PCR amplification of synthesized fragments, each approximately 2100 bp in length, was performed using the primers in Table 2.1, as shown in SEQ ID NO:1-4. The PCR reaction system is shown in Table 2.2 below.

[0104] Table 2.2 PCR reaction system

[0105]

[0106] The PCR reaction procedure is shown in Table 2.3 below.

[0107] Table 2.3 PCR reaction procedure

[0108]

[0109] After the reaction was completed, the amplification product was subjected to agarose gel electrophoresis, and the target fragment was purified and recovered using a Takara gel recovery kit.

[0110] 2.2 Preparation of the linear vector pBac-N-EGFP for plasmids

[0111] The plasmid pBac-N-EGFP was double-digested with restriction endonucleases Hind III and EcoRI. The digestion reaction system is shown in Table 2.4 below.

[0112] Table 2.4 Enzyme digestion reaction system

[0113] Components Added amount pBacl-N-EGFP plasmid 1.5μg EcoRI (Restriction Endonuclease) 1.0μL Hind III restriction endonuclease 1.0μL 10×M buffer 5.0μL <![CDATA[ddH2O]]> Add to 50uL

[0114] The enzyme digestion reaction procedure is shown in Table 2.5 below.

[0115] Table 2.5 Enzyme digestion reaction procedure

[0116] temperature time 37℃ 3h

[0117] The linear vector pBac-N-EGFP was purified and recovered using a Takara gel recovery kit and used for fragment ligation.

[0118] 2.3 Ligation of linear vector with target fragment

[0119] Using Takara's homologous recombination kit HD Cloning Plus was used to seamlessly ligate the target fragments (SEQ ID NO: 1-4) into the linear vector pBac-N-EGFP. The 10 μL reaction mixture is shown in Table 2.6 below, and ligation was performed at 50°C for 15 minutes.

[0120] Table 2.6 Connection Reaction System

[0121] Components Added amount 5×In-Fusion HD Enzyme Premix 2μL Target fragment PF-18S-M 50-100ng linear vector pBac-N-EGFP 50-100ng

[0122] 2.4 Transformation

[0123] The ligation product was added to Takara competent E. coli DH5α competent cells and mixed gently. After incubating on ice for 10-30 minutes, the cells were placed in a 42°C water bath for 30-60 seconds, then immediately removed and placed on ice for 2-5 minutes. 700 μL of SOC medium (pre-incubated at 37°C) was added, and the cells were incubated at 37°C with shaking for 1 hour (180 rpm). An appropriate amount was then spread onto LB solid medium (ampicillin, Amp, final concentration 100 μg / mL), and the plates were incubated upside down at 37°C overnight.

[0124] 2.5 Identification of positive plasmids

[0125] Two monoclonal strains of each of the following species were selected for PCR: Plasmodium ovale, Plasmodium falciparum, Plasmodium malariae, and Plasmodium vivax. Primers used are shown in Table 2.7 below.

[0126] Table 2.7 Primer Sequences

[0127]

[0128] The PCR reaction system is shown in Table 2.8 below:

[0129] Table 2.8 PCR reaction system

[0130]

[0131] The PCR reaction procedure is shown in Table 2.9 below:

[0132] Table 2.9 PCR reaction procedure

[0133]

[0134] After the reaction, a small amount of the amplification product was taken for agarose gel electrophoresis. The results showed that both single clones produced bands of approximately 2100 bp (e.g., Figure 1 (As shown). Sequencing analysis confirmed that the sequences of the positive clones were identical to the corresponding target sequences, and they were named pBac-PF-18S-M (Plasmodium falciparum), pBac-PV-18S-M (Plasmodium vivax), pBac-PO-18S-M (Plasmodium ovale), and pBac-PM-18S-M (Plasmodium malariae), respectively. The diagram is shown below. Figure 2 As shown.

[0135] Example 3: Construction and PCR Verification of Engineered Bacteria Carrying Artificial Chromosomes

[0136] 3.1 Construction of engineered bacteria carrying artificial chromosomes:

[0137] Add 100 ng of plasmids pBac-PF-18S-M (Plasmodium falciparum), pBac-PV-18S-M (Plasmodium vivax), pBac-PO-18S-M (Plasmodium ovale), and pBac-PM-18S-M (Plasmodium malariae), respectively, to competent DH10Bac cells and place them on ice for 30 min. Heat shock in a 42℃ water bath for 50-100 s, then immediately place on ice for 2-5 min. Add 700 μL of LB medium and incubate at 37℃ with a shaker at 200 rpm for 2-4 h. Spread 200 μL of the culture solution evenly onto LB fixation medium containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, 10 μg / mL gentamicin, 40 μg / mL X-Gal, and 40 μg / mL IPTG. Invert the plate and incubate it in a 37℃ constant temperature incubator for 24-72 hours.

[0138] Select positive white monoclonal colonies and incubate them in 3-5 mL of LB liquid medium containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, and 10 μg / mL gentamicin at 37°C and 200 rpm for 20-30 h. Extract artificial chromosome DNA from the engineered bacteria using the Omega BAC / PAC large basic plasmid extraction kit.

[0139] 3.2 PCR verification of engineered bacteria using artificial chromosomes:

[0140] Using 1 μg of engineered bacterial artificial chromosome DNA as a template, PCR verification and sequencing were performed using pUC / M13-F (CCCAGTCACGACGTTGTAAAACG) (SEQ ID NO:13) and pUC / M13-R (AGCGGATAACAATTTCACACAGG) (SEQ ID NO:14) as primers. After confirming the PCR identification and sequencing alignment were correct, the next step of the experiment was performed. The PCR verification system was as follows: 25 μL of 2×T5 buffer, 23 μL of ddH2O, 1 μL each of 10 μmol / L pUC / M13 upstream primers, and 1 μg of artificial chromosome DNA.

[0141] The PCR amplification reaction conditions are shown in Table 3.1 below:

[0142] Table 3.1 PCR reaction conditions

[0143]

[0144] The PCR products were sequenced, and the results showed that the sequence contained in the positive clones was consistent with the corresponding target sequence, indicating that the engineered bacteria carrying the recombinant artificial chromosome was successfully constructed.

[0145] Example 4: Preservation and Use of Engineered Bacterial Strains Carrying Artificial Chromosomes

[0146] 4.1 Preservation of engineered bacterial strains carrying artificial chromosomes:

[0147] First, prepare the bacterial culture preservation solution: aliquot and sterilize glycerol and LB liquid medium to prepare LB medium with a final concentration of 50 μg / mL kanamycin, 7 μg / mL tetracycline, and 10 μg / mL gentamicin, and use it to dilute the glycerol (ratio 1:1); take 500 μL of the bacterial culture for preservation, add 500 μL of diluted glycerol, mix well, place in a 1.5 mL EP tube, and label with the strain number, strain name, preservation date, operator, and other information; then store the glycerol culture backup in a -80℃ freezer.

[0148] 4.2 Instructions for using engineered bacteria carrying artificial chromosomes:

[0149] Remove the glycerol bacteria and rewarm them at room temperature or 2–8°C until thawed. Spread a small amount of the bacterial suspension onto a plate and incubate it in LB broth containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, 10 μg / mL gentamicin, 40 μg / mL X-Gal, and 40 μg / mL IPTG. Invert the plate and incubate at 37°C for 24–48 hours. Pick positive white monoclonal colonies and transfer them to 3–5 mL of LB liquid broth containing 50 μg / mL kanamycin, 7 μg / mL tetracycline, and 10 μg / mL gentamicin. Incubate at 37°C and 200 rpm for 20–30 hours. The bacterial suspension is used to extract artificial chromosome DNA for subsequent quality control testing.

[0150] Example 5: Preparation and Production of Raw Materials and Finished Products for Engineered Microorganism Quality Control Products

[0151] 5.1 Heat inactivation of engineered bacterial cultures carrying artificial chromosomes

[0152] Place the centrifuge tubes containing the engineered bacterial culture into a 60°C water bath. Ensure a tight seal to prevent leakage during heating. After heating for 1 hour, remove the inactivated culture as raw material for quality control of the engineered bacteria.

[0153] 5.2 Extraction and preparation of bacterial artificial chromosome DNA

[0154] The engineered bacterial control samples were serially diluted with phosphate-buffered saline to obtain sufficient concentrations of engineered bacteria. Nucleic acid was extracted from the engineered bacterial control samples at different concentrations using the MagaBio plus Viral DNA / RNA Purification Kit (Hangzhou Bori Technology Co., Ltd., catalog number BSC86S1E). Following the kit instructions, purified nucleic acid solutions were finally obtained.

[0155] 5.3 Digital PCR (ddPCR) Assay

[0156] Using the extracted nucleic acid as a template, prepare a reaction system containing the nucleic acid template, ddPCR reaction premix, primers, and probes, referring to the finished kit. Ensure the proportions of each component are accurate. Transfer the prepared reaction system to a digital PCR instrument for testing (ddPCR reaction system and conditions are shown in Tables 5.1 and 5.2). PCR primers and probes are shown in Table 5.3. Directly obtain the absolute concentration of the target nucleic acid in the sample, and then calculate the nucleic acid concentration in the engineered bacterial quality control sample.

[0157] Table 5.1 ddPCR reaction system

[0158] Components Added amount PCR reaction solution 19μL enzyme mixture 1μL sample 5μL

[0159] Table 5.2 ddPCR reaction conditions

[0160]

[0161] Table 5.3 PCR Primer and Probe Sequence Listing

[0162] sequence name Sequence (5′-3′) PF-F CTTTTGAGAGGTTTTGTTACTTTGAGCAA (SEQ ID NO: 15) PF-R TATTCCATGCTGTAGTATTCAAACACAA (SEQ ID NO: 16) PF-PB VIC-TGTTCATAACAGACGGGTAGTCATGATTGAGTTC-BHQ1 (SEQ ID NO: 17) PV-F CAACGCTTCTAGCTTAATCCACGTA (SEQ ID NO: 18) PV-R CAAGCCGAAGCAAAGAAAGTC (SEQ ID NO: 19) PV-PB CY5-S-TCGTATCGACTTTGTGCGCATTTTGC-BHQ2 (SEQ ID NO: 20) PO-F TGCTACACTGATATGTAWAACGAG (SEQ ID NO: 21) PO-R CAATAATCTATCCCCATCACGA (SEQ ID NO: 22) PO-PB ROX-TCGGCGGAGGAAAAGTATACTATTTGAGAGAG-BHQ2 (SEQ ID NO: 23) PM-F ACTAGGTGTTGGATGATAGAGTA (SEQ ID NO: 24) PM-R CCCCAGAACCCAAAGACTT (SEQ ID NO: 25) PM-PB FAM-TGAGTGTTTCTTTTAGATAGCTTCCTTCAGTACC-BHQ1 (SEQ ID NO: 26)

[0163] 5.4 Preparation of engineered microbial quality control products

[0164] The known concentrations of Plasmodium ovale, Plasmodium falciparum, Plasmodium malariae, and Plasmodium vivax, along with the quality control materials, were diluted and mixed to obtain the desired finished product of a combined quality control material of multiple engineered Plasmodium strains at different concentrations.

[0165] Example 6: Verification of nuclease tolerance in engineered bacterial quality control samples

[0166] The engineered bacterial control sample prepared in Example 5 and the conventional pUC57 plasmid of Plasmodium from Example 1 (hereinafter referred to as plasmid) (both E8 copies / mL) were digested with Thermo#EN0521 DNase I at 37℃ for 30 min (working concentration: 0.1 U per ng of nucleic acid), and then inactivated at 70℃ for 10 min. A control without any treatment was also provided. Each group was tested in duplicate. The samples were then cumulatively diluted 100-fold and subjected to Q-PCR detection (Q-PCR reaction system and conditions are shown in Tables 6.1 and 6.2). Each sample was tested twice. The results are as follows: Figure 3 As shown in Tables 6.3-6.6, there was no difference in the Q-PCR detection results of the engineered bacteria quality control samples before and after DNaseI digestion, while the results of the plasmids before and after DNaseI digestion were very different. This indicates that the engineered Plasmodium quality control samples prepared in this invention have superior nuclease tolerance, which is much higher than that of conventional plasmids.

[0167] Table 6.1 Q-PCR reaction system

[0168] Components Added amount PCR reaction solution 19μL enzyme mixture 1μL sample 5μL

[0169] Table 6.2 Q-PCR reaction conditions

[0170]

[0171] Table 6.3 Data on the quality control samples and plasmid nuclease treatment results of Plasmodium falciparum

[0172]

[0173] Note: NoCt was not detected; C T An increase in the value indicates that the template has been degraded by nucleases.

[0174] Table 6.4 Data on the quality control samples and plasmid nuclease treatment results of Plasmodium falciparum

[0175]

[0176] Note: NoCt was not detected; C T An increase in the value indicates that the template has been degraded by nucleases.

[0177] Table 6.5 Data on the quality control samples and plasmid nuclease treatment results of Plasmodium malariae.

[0178]

[0179] Note: NoCt was not detected; C T An increase in the value indicates that the template has been degraded by nucleases.

[0180] Table 6.6 Data on the quality control samples and plasmid nuclease treatment results of Plasmodium vivax.

[0181]

[0182] Note: NoCt was not detected; C T An increase in the value indicates that the template has been degraded by nucleases.

[0183] Example 7: Verification of the ability of engineered bacterial quality control samples to monitor nucleic acid extraction

[0184] Nucleic acid extraction and non-extraction tests were performed on the engineered Plasmodium strains at concentrations of 5.00E+06 copies / mL and 5.00E+03 copies / mL, and the corresponding pUC57 plasmids were tested (qPCR reaction conditions were the same as in Example 6). The results are shown in Tables 7.1-7.4. Figure 4As shown, the quality control product of engineered Plasmodium can only be detected after nucleic acid extraction; it cannot be detected without nucleic acid extraction. However, the plasmid can be detected regardless of whether nucleic acid extraction is performed, and the Ct value is the same. This indicates that the quality control product of engineered Plasmodium prepared in this invention can effectively monitor the nucleic acid extraction process, which is not possible with conventional plasmids.

[0185] Table 7.1 Data Table of Quality Control Products and Plasmid Extraction Monitoring Capability Validation Results for Engineered Plasmodium ovale Bacteria

[0186]

[0187] Note: NoCt was not detected.

[0188] Table 7.2 Data Table of Quality Control Products and Plasmid Extraction Monitoring Capability Validation Results for Engineered Plasmodium falciparum Bacteria

[0189]

[0190] Note: NoCt was not detected.

[0191] Table 7.3 Data table of quality control samples and plasmid extraction monitoring results for engineered Plasmodium malariae bacteria.

[0192]

[0193] Note: NoCt was not detected.

[0194] Table 7.4 Data Table of Quality Control Products and Plasmid Extraction Monitoring Capability Validation Results for Engineered Plasmodium vivax Bacteria

[0195]

[0196] Note: NoCt was not detected.

[0197] Example 8: Stability test of engineered microbial quality control samples

[0198] Referring to standard JJF1343-2022 "Assignment and Homogeneity and Stability Assessment of Standard Reference Materials", stability was assessed by storing the reference material at three different temperatures: 4℃, 25℃, and 37℃ for 0 days and 3 days. Two units were sampled at each time point and temperature, and q-PCR was used for detection (qPCR reaction conditions were the same as in Example 6). Each unit was tested twice. The test results are shown in Tables 8.1-8.4 and... Figure 5 The quality control samples of engineered Plasmodium strains showed no significant differences in performance after storage at different temperatures; however, the Ct of the plasmid decreased after storage at 4℃, and gradually increased after storage at 25℃ and 37℃. This indicates that the quality control samples of engineered Plasmodium strains prepared in this invention have outstanding and excellent stability, while conventional plasmids have poor stability.

[0199] Table 8.1 Statistical results of Ct values ​​for the storage stability of engineered Plasmodium ovale bacterial control products at 4℃, 25℃, and 37℃.

[0200]

[0201] Table 8.2 Statistical results of Ct values ​​for the storage stability of engineered Plasmodium falciparum bacterial quality control products at 4℃, 25℃, and 37℃.

[0202]

[0203] Table 8.3 Statistical results of Ct values ​​for the storage stability of engineered Plasmodium malariae strains at 4℃, 25℃, and 37℃.

[0204]

[0205] Table 8.4 Statistical results of Ct values ​​for the storage stability of engineered Plasmodium vivax bacteria quality control products at 4℃, 25℃, and 37℃.

[0206]

[0207] Example 9: Linearity and amplification efficiency of engineered bacterial quality control samples

[0208] The engineered bacterial control sample and pUC57 plasmid were each serially diluted 10-fold at an initial concentration of 1E+09 copies / mL to obtain a series of serially diluted products. Nucleic acid extraction was performed followed by Q-PCR detection (QPCR reaction conditions were the same as in Example 6), with two replicates per concentration. The results are shown in Tables 9.1-9.4. Figures 6-9 As shown, according to the "Performance Evaluation Requirements for Biotechnology Nucleic Acid Target Sequence Quantification Methods (qPCR and dPCR)" (GB / T42077-2022), the linear correlation coefficient and amplification efficiency of the engineered bacteria quality control samples both met the standards (R0). 2 >0.99, amplification efficiency E in the range of 0.9 to 1.1). This shows that the engineered Plasmodium strain quality control prepared by this invention has good linearity and amplification efficiency, and is more suitable for quality control or quantitative detection research of Plasmodium nucleic acid detection than conventional plasmids.

[0209] Table 9.1 Results of Quality Control and Gradient Dilution Tests of Engineered Plasmodium ovale Bacteria

[0210]

[0211] Table 9.2 Results of Quality Control Samples and Gradient Dilution Tests of Engineered Plasmodium falciparum Bacteria

[0212]

[0213] Table 9.3 Results of Quality Control Samples and Gradient Dilution Tests of Plasmodium malariae Engineered Bacteria

[0214]

[0215] Table 9.4 Results of Quality Control Samples and Gradient Dilution Tests of Plasmodium vivax Engineered Bacteria

[0216]

[0217] Example 10: Verification of Type Detection of Engineered Microorganism Quality Control Samples

[0218] The typing capability for four Plasmodium species was verified using a Plasmodium multiplex fluorescent PCR nucleic acid detection kit (including engineered bacterial control samples). A single-tube quadruple fluorescent PCR system was used to simultaneously detect Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale. Control samples were prepared by diluting engineered bacteria carrying recombinant artificial chromosomes of the four Plasmodium species (preparation details in Example 5) with PBS to 1E6 copies / mL; negative controls were homologous background Escherichia coli engineered bacteria. qPCR was used for detection (qPCR reaction conditions as in Example 6), with each unit tested twice. Results showed that all control samples showed amplification only in their corresponding channels (…). Figure 10 (Table 10), and there was no cross signal. Meanwhile, the mixed quality control samples could still be accurately genotyped ( Figure 11 This demonstrates the orthogonality of the primers and probes, and shows that the kit, when used in conjunction with engineered bacterial quality control samples, can achieve accurate typing and meet typing requirements.

[0219] Table 10. Verification Results of Type Detection of Engineered Microorganism Quality Control Samples

[0220]

[0221] Note: NoCt was not detected.

[0222] Example 11: Application of engineered microbial quality control products

[0223] The engineered Plasmodium bacteria quality control material prepared by this invention can be used as a standard reference material to monitor the detection limit (LOD) of the kit (as shown in Table 11, which uses the engineered Plasmodium ovale bacteria quality control material as an example for kit LOD analysis), accuracy, precision, and sensitivity. It can also serve as an internal control to help determine the reliability of the detection results. Furthermore, for some quantitative detection kits, it can be used to plot standard curves. This demonstrates that the engineered bacteria quality control material of this invention plays a crucial role in the kit and also helps improve the operational skills of laboratory personnel and the quality control level of the laboratory.

[0224] Table 11 Results of using engineered Plasmodium ovale bacteria quality control samples in reagent kit detection limit tests

[0225]

[0226] Note: NoCt was not detected.

Claims

1. A primer for multiplex fluorescent PCR nucleic acid detection of Plasmodium, characterized in that: The primers used for multiplex fluorescent PCR nucleic acid detection of malaria parasites include primers for Plasmodium falciparum, primers for Plasmodium vivax, primers for Plasmodium ovale, and primers for Plasmodium malariae. When the primers used for the multiplex fluorescent PCR nucleic acid detection of Plasmodium falciparum are Plasmodium falciparum primers, the Plasmodium falciparum primers include: an upstream primer with a nucleotide sequence as shown in SEQ ID NO:15 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:16; The probe sequence used for amplifying the Plasmodium primers is SEQ ID NO:17; When the primers used for the multiplex fluorescent PCR nucleic acid detection of Plasmodium are Plasmodium vivax primers, the Plasmodium vivax primers include: an upstream primer with a nucleotide sequence as shown in SEQ ID NO:18 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:19; The probe sequence used for amplifying the primer fragment of Plasmodium vivax is SEQ ID NO:20; When the primers used for the multiplex fluorescent PCR nucleic acid detection of Plasmodium are Plasmodium ovale primers, the Plasmodium ovale primers include: an upstream primer with a nucleotide sequence as shown in SEQ ID NO:21 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:22; The probe sequence used for amplifying the Plasmodium ovoformis primers is SEQ ID NO:23; When the primers used for the multiplex fluorescent PCR nucleic acid detection of Plasmodium are Plasmodium malariae primers, the Plasmodium malariae primers include: an upstream primer with a nucleotide sequence as shown in SEQ ID NO:24 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:25; The probe sequence used for amplifying the primer fragment of the Plasmodium ovale is SEQ ID NO:

26.

2. The primers for multiplex fluorescent PCR nucleic acid detection of Plasmodium as described in claim 1, characterized in that: The 5' ends of the probes used for the amplification fragments of the Plasmodium falciparum primers, the Plasmodium vivax primers, the Plasmodium ovale primers, and the Plasmodium terrestris primers all contain fluorescent labels.

3. A multiplex fluorescent PCR nucleic acid detection kit for Plasmodium, characterized in that: The Plasmodium multiplex fluorescent PCR nucleic acid detection kit includes the primers for Plasmodium multiplex fluorescent PCR nucleic acid detection as described in claim 1.

4. The application of the Plasmodium multiplex fluorescent PCR nucleic acid detection kit as described in claim 3 in the detection of Plasmodium falciparum nucleic acid.

5. The application of the Plasmodium multiplex fluorescent PCR nucleic acid detection kit as described in claim 3 in the detection of Plasmodium vivax nucleic acid.

6. The application of the Plasmodium multiplex fluorescent PCR nucleic acid detection kit as described in claim 3 in the detection of Plasmodium ovale nucleic acid.

7. The application of the Plasmodium multiplex fluorescent PCR nucleic acid detection kit as described in claim 3 in the detection of Plasmodium tertianum nucleic acid.

8. An engineered Escherichia coli strain carrying a recombinant artificial chromosome, characterized in that, The engineered *E. coli* strain was prepared by integrating the homologous 18S rRNA sequences of *Plasmodium falciparum*, *Plasmodium vivax*, *Plasmodium malariae*, and *Plasmodium ovale* into the *E. coli* artificial chromosome using homologous recombination technology, thus completely preserving the engineered bacterial cell structure. The *Plasmodium falciparum* 18S rRNA homologous sequence is shown in SEQ ID NO:1, the *Plasmodium vivax* 18S rRNA homologous sequence is shown in SEQ ID NO:2, the *Plasmodium malariae* 18S rRNA homologous sequence is shown in SEQ ID NO:3, and the *Plasmodium ovale* 18S rRNA homologous sequence is shown in SEQ ID NO:

4.

9. A quality control product for multiplex nucleic acid detection of Plasmodium, characterized in that, The quality control sample is prepared from the engineered Escherichia coli of claim 8 through the following steps: (a) Cultivate the engineered Escherichia coli and heat-inactivate it; (b) Dilute with phosphate buffer to different concentration gradients; (c) Obtain a quality control sample containing the target gene of Plasmodium for multiplex nucleic acid detection, extract the DNA of the quality control sample, and accurately determine its nucleic acid copy number by digital PCR and qPCR.

10. The application of the quality control product for disease diagnosis as described in claim 9, characterized in that, The application is any one of the following: (a) Quality control of accuracy and precision of multiplex fluorescent PCR and digital PCR; (b) Establishment of multi-gradient standard curves for multiplex nucleic acid detection of Plasmodium using fluorescent PCR and digital PCR for quantitative detection; (c) Performance validation of the multiplex nucleic acid detection kit for Plasmodium malariae.

Images