A Highly Efficient sgRNA for Improving Gene Editing Efficiency and Its Applications

Abstract

This invention belongs to the field of gene editing, specifically relating to a highly efficient sgRNA for improving gene editing efficiency and its application. The highly efficient sgRNA is Vp-sgRNA-01 or Vp-sgRNA-02, with the nucleotide sequence of Vp-sgRNA-01 shown in SEQ ID NO:1 and the nucleotide sequence of Vp-sgRNA-02 shown in SEQ ID NO:2. The application refers to its use in editing plant genes within a highly efficient CRISPR / VpCas9 gene editing system. The combination of the highly efficient sgRNA provided by this invention and a three-point mutant of the VpCas9 protein achieves a gene editing efficiency of up to 85%. The VpCas9 protein mutant provided by this invention can be stably and efficiently expressed in plant cells, thereby better regulating the expression of target genes. The highly efficient CRISPR / VpCas9 gene editing system has high cutting efficiency and low off-target effects, greatly improving the efficiency of plant gene editing and showing broad application prospects in the field of plant gene editing.

Description

Technical Field

[0001] This invention belongs to the field of gene editing, specifically relating to a highly efficient sgRNA that improves gene editing efficiency and its applications. Background Technology

[0002] The CRISPR / Cas system (Clustered Regularly Interspaced Palindromic Repeats / CRISPR-ass ociated proteins system), as the third-generation gene editing tool, has advantages over first-generation ZFNs (Zinc Finger Nucleases) and TALENs (Transcription Activator-like Effector Nucleases) in terms of simple design, lower cost, and higher editing efficiency, making it the most mainstream gene editing system today. The CRISPR / Cas system is an adaptive immune system that helps bacteria and archaea defend against foreign nucleic acid invasion. Its mechanism of action is as follows: when certain bacteria are invaded by a virus, they can store a small segment of the viral gene into their own DNA. When the virus invades again, the bacteria can recognize the viral gene based on their memory and cut it to silence its expression.

[0003] The CRISPR / Cas9 system contains tracrRNA (trans-activating RNA) and crRNA (CRISPR-derived RNA), which together with Cas9 form a complex to perform their functions. tracrRNA and crRNA can fuse into single-stranded guide RNA (sgRNA) through a linker sequence. When DNA breaks occur, two main DNA damage repair mechanisms in the cell are responsible for repair: non-homologous end-joining (NHEJ) and homologous recombination (HR). NHEJ repair results in base deletions or insertions, which can be used for gene knockout; when a homologous template is provided, HR repair can be used for site-specific gene insertion and precise base substitution.

[0004] In existing technologies, the type II CRISPR / Cas9 system, derived from Streptococcus pyogene Cas (SpCas9), is the most widely used gene editing system due to its high cleavage efficiency. This system targets and cleaves PAM sequences with the NGG cleavage pattern. However, off-target effects still occur at some target sites, resulting in lower editing efficiency. Based on the shortcomings of the type II CRISPR / Cas9 system, a new CRISPR / VpCas9 gene editing system has been developed. However, its targeting specificity in gene editing needs improvement, and there are still gaps in its application in plant gene editing. Therefore, it is essential to optimize this CRISPR / VpCas9 gene editing system and apply it to the field of plant gene editing. This is of great significance for breeding transgenic plant varieties that better meet the needs of agricultural production and improving agricultural production efficiency. Summary of the Invention

[0005] The present invention aims to at least solve the technical problems existing in the prior art. To this end, the present invention provides a highly efficient sgRNA for improving gene editing efficiency and its application.

[0006] This invention provides a highly efficient sgRNA for improving gene editing efficiency. The highly efficient sgRNA is Vp-sgRNA-01 or Vp-sgRNA-02. The nucleotide sequence of Vp-sgRNA-01 is shown in SEQ ID NO:1, and the nucleotide sequence of Vp-sgRNA-02 is shown in SEQ ID NO:2.

[0007] This invention provides a VpCas9 protein mutant, the amino acid sequence of which is shown in SEQ ID NO:3. The VpCas9 protein mutant is a mutant obtained by mutating any one of the amino acid sequences I439E, E430K, or N301D, or by simultaneously mutating all three amino acids I439E, E430K, and N301D, into the amino acid sequence shown in SEQ ID NO:3.

[0008] The present invention provides an expression vector containing the aforementioned high-efficiency sgRNA.

[0009] This invention provides a highly efficient CRISPR / VpCas9 gene editing system, wherein the highly efficient CRISPR / VpCas9 gene editing system includes the highly efficient sgRNA.

[0010] Experiments have shown that the Cas9 nuclease domain sequence derived from Vagococcus penaei can be used for the application of a novel Cas9 protein, namely VpCas9 protein. The corresponding nucleotide sequence encoding VpCas9 protein is shown in SEQ ID NO:4.

[0011] The CRISPR / VpCas9 system is a novel RNA-guided DNA endonuclease-VpCas9 system with high DNA cleavage activity and low off-target rate. It is expected to be used for specific site mutagenesis in gramineous plants such as rice, corn, and wheat, as well as dicotyledonous plants such as soybean and cotton.

[0012] The amino acid sequence of the VpCas9 protein is shown in SEQ ID NO:3; or has one or more amino acid substitutions, deletions or additions compared to the sequence shown in SEQ ID NO:3, and has the same or similar biological function; or has at least 90% identity with the sequence shown in SEQ ID NO:3, and has the same or similar biological function.

[0013] In some embodiments, the VpCas9 protein shares 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% homology with the sequence shown in SEQ ID NO:3. In some embodiments, the VpCas9 protein is 1034 amino acids in size. In this invention, the biological functions of the above sequence include, but are not limited to, guide RNA binding activity, endonuclease activity, and the activity of binding to and cleaving a target sequence at a specific site under the guidance of guide RNA.

[0014] The efficient CRISPR / VpCas9 gene editing system described in this invention also includes the exonuclease Trex2 and any one of the following:

[0015] 1) The VpCas9 protein or a plasmid expressing the VpCas9 protein;

[0016] 2) The VpCas9 protein mutant or a plasmid expressing the VpCas9 protein mutant;

[0017] 3) The VpCas9 protein or a VpCas9 protein mutant-derived protein, or a plasmid expressing the derived protein.

[0018] Specifically, the derived protein is any one of the following:

[0019] 1) The VpCas9 protein and other polypeptides;

[0020] 2) The VpCas9 protein mutant and other peptides;

[0021] The other polypeptides include nuclear localization signal (NLS) sequences, signal peptides, selection markers, and regulatory factors. The other polypeptides are linked to the VpCas9 protein or VpCas9 protein mutants via chemical coupling, gene fusion, or non-covalent linkage.

[0022] In some embodiments, the VpCas9 protein mutant of the present invention is linked to a nuclear localization signal (NLS) sequence to endow the VpCas9 protein mutant of the present invention with the ability to enter the cell nucleus.

[0023] In some embodiments, the VpCas9 protein mutant of the present invention is interconnected with a signal peptide to enable the VpCas9 protein mutant of the present invention to target organelles.

[0024] In some embodiments, the VpCas9 protein mutant of the present invention is interconnected with a regulatory factor so that the VpCas9 protein mutant of the present invention can be efficiently transformed into plants.

[0025] The derived proteins of this invention do not affect the expected activity of VpCas9 protein mutants (e.g., activity with guide RNA, endonuclease activity, and activity with guide RNA-guided binding to and cleavage at specific sites of the target sequence). The proteins and fusion proteins of this invention are not limited by their mode of production; for example, they can be produced by genetic engineering methods (recombinant technology) or by chemical synthesis.

[0026] In some embodiments, when the target sequence is DNA, the target sequence is located at the 5' end of the protospacer adjacent motif (PAM), and the PAM has a sequence shown as 5'-NGG, wherein N is selected from A, G, T, and C.

[0027] In some embodiments, the VpCas9 protein mutant is linked to one or more nuclear localization signal (NLS) sequences. In some embodiments, the NLS sequence is linked to the N-terminus or C-terminus of the VpCas9 protein mutant.

[0028] The present invention provides a composition comprising the aforementioned high-efficiency CRISPR / VpCas9 gene editing system.

[0029] This invention provides a method for large-fragment knockout of a target gene, the specific steps of which include: transferring the composition into a host cell to achieve large-fragment knockout of the target gene.

[0030] The present invention provides a method for obtaining mutant plants, the specific steps of which include: introducing the composition into a target plant, performing targeted editing on the target gene in the target plant, and then cultivating to obtain mutant plants.

[0031] In some embodiments, the target plant is any one of a monocotyledonous plant (such as rice, corn, or wheat) or a dicotyledonous plant (such as soybean); in some embodiments, the target plant is preferably rice.

[0032] In some embodiments, the method further includes contacting the DNA template to be edited with the target gene, or delivering it to a cell containing the target gene. In such embodiments, the method repairs the broken target gene by homologous recombination with a foreign template polynucleotide, wherein the repair results in a mutation, including the insertion, deletion, or substitution of one or more nucleotides of the target gene. In some embodiments, the mutation results in a change in one or more amino acids in a protein expressed from a gene containing the target sequence.

[0033] This invention provides an application of a highly efficient CRISPR / VpCas9 gene editing system in the field of plant gene editing, the application including any one of the following:

[0034] 1) Obtain mutants with missing gene function.

[0035] 2) Increase the scope of editing of plant target genes, resulting in larger fragment deletions.

[0036] 3) Improve the efficiency of plant gene editing. Specifically, the combination of optimized high-efficiency sgRNA sequences and VpCas9 protein three-point mutants in the high-efficiency CRISPR / VpCas9 gene editing system significantly improves gene editing efficiency, reaching up to 85%.

[0037] 4) Plant genetic transformation or plant bio-breeding.

[0038] 5) Quickly obtain homozygous mutant plants.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] (1) This invention provides a highly efficient sgRNA that improves gene editing efficiency. Compared with known sgRNA and esgRNA, it has higher editing efficiency, with an average improvement of 9 times.

[0041] (2) The present invention provides a VpCas9 protein mutant, which can be stably and efficiently expressed in plant cells, thereby better regulating the expression of target genes.

[0042] (3) This invention provides a highly efficient and stable gene editing system (highly efficient CRISPR / VpCas9 gene editing system). The highly efficient CRISPR / VpCas9 gene editing system of this invention can efficiently generate gene knockout fragments in eukaryotes, while the gene knockout fragment range of the traditional CRISPR / SpCas9 gene editing system composed of SpCas9 protein and exonuclease Trex2 is limited (usually <1kb). The highly efficient CRISPR / VpCas9 gene editing system of this invention has high cutting efficiency and low off-target effect, which greatly improves the efficiency of plant gene editing.

[0043] the term

[0044] In this invention, the term "target sequence" or "target polynucleotide" can refer to any endogenous or exogenous polynucleotide for a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or useless DNA). In some cases, the target sequence should be associated with a protospacer adjacent motif (PAM). The precise sequence and length requirements for the PAM vary depending on the Cas effector enzyme used, but the PAM is typically a 2-5 base pair sequence adjacent to the protospacer sequence (i.e., the target sequence). Those skilled in the art can identify the PAM sequence to be used with a given Cas effector protein.

[0045] In some cases, examples of target sequences or target polynucleotides include genes or nucleotides related to yield, quality, and stress resistance. In cases where altered expression is associated with genes related to yield, quality, and stress resistance, it can be a gene expressed at an abnormally high level; or it can be a gene expressed at an abnormally low level. The transcribed or translated product can be known or unknown, and can be at normal or abnormal levels. Attached Figure Description

[0046] Figure 1 This is a schematic diagram of the Trex2-VpCas9 carrier structure constructed according to the present invention;

[0047] Figure 2 This is a schematic diagram of the Trex2-SpCas9 control vector of the present invention;

[0048] Figure 3 This is a schematic diagram of the predicted RNAfold structure of the four sgRNAs of this invention;

[0049] Figure 4 Electrophoresis diagram of transgenic positive plants identified in this invention;

[0050] Figure 5 This is a schematic diagram showing the range of the CRISPR / SpCas9 gene editing system knockout fragment at the OsBADH2-T target site in this invention;

[0051] Figure 6 This is a schematic diagram illustrating the knockout fragment range of the efficient CRISPR / VpCas9 gene editing system targeting OsBADH2-T in this invention;

[0052] Figure 7 This is a schematic diagram showing the range of the CRISPR / SpCas9 gene editing system knockout fragment at the Os4-T target site in this invention;

[0053] Figure 8 This is a schematic diagram illustrating the knockout fragment range of the efficient CRISPR / VpCas9 gene editing system targeting the Os4-T site according to the present invention;

[0054] Figure 9 This is a schematic diagram showing the range of the CRISPR / SpCas9 gene editing system knockout fragment at the Os19-T target site in this invention;

[0055] Figure 10 This is a schematic diagram illustrating the knockout range of the efficient CRISPR / VpCas9 gene editing system targeting the Os19-T site according to the present invention;

[0056] Figure 11 This is a schematic diagram of the sequence changes at the Os4-T target site in homozygous mutant plants obtained by the efficient CRISPR / VpCas9 gene editing system of this invention.

[0057] Figure 12 This is a comparison diagram of the lengths of deleted fragments produced by the efficient CRISPR / VpCas9 gene editing system and the CRISPR / SpCas9 gene editing system of this invention.

[0058] Figure 13 This is a predicted structure diagram of the VpCas9 protein and its three key amino acid sites.

[0059] Figure 14 This is a predicted structure diagram of the VpCas9-I439E protein of this invention.

[0060] Figure 15 This is a predicted structure diagram of the VpCas9-E430K protein of this invention.

[0061] Figure 16 This is a predicted structure diagram of the VpCas9-N301D protein of this invention.

[0062] Figure 17The above are predicted protein structures of VpCas9-I439E, VpCas9-E430K, and VpCas9-N301D from this invention. Detailed Implementation

[0063] The following specific embodiments further illustrate the technical solution of the present invention for a high-efficiency sgRNA and its application.

[0064] Example 1

[0065] 1. Construction of gene editing vectors and systems

[0066] This invention utilizes the GenScript online codon optimization system to optimize the rice codons of the VpCas9 sequence used, and then synthesizes the gene at GenScript. The nucleotide sequence encoding the VpCas9 protein is shown in SEQ ID NO:4. A Trex2 exonuclease with 3' to 5' exonuclease activity is fused to the 5' end of VpCas9 to improve editing efficiency, resulting in the vector Trex2-VpCas9, which constitutes a highly efficient CRISPR / VpCas9 gene editing system. A schematic diagram of the Trex2-VpCas9 vector constructed in this invention is shown below. Figure 1 As shown.

[0067] Using the vector Trex2-SpCas9 as a control, a CRISPR / SpCas9 gene editing system was constructed. A schematic diagram of the Trex2-SpCas9 control vector is shown below. Figure 2 As shown. This invention uses the rice OsBADH2 gene as the target gene and employs the CRISPR / VpCas9 system to directionally edit the rice OsBADH2 gene, obtaining gene-edited plants with improved rice aroma. Simultaneously, the rice OsNramp5 gene is edited to create low-cadmium rice. Additionally, two random target sites, Os4 and Os19, in rice are selected to ensure the general applicability of the experiment.

[0068] 2. Optimization of VpCas9's sgRNA

[0069] Using the sgRNA and esgRNA of the currently known SpCas9 technology as reference structures, the nucleotide sequences of sgRNA and esgRNA are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively. The stem-loop structure of sgRNA was predicted by RNA fold analysis. By adjusting the base sequence composition and reducing self-binding, two optimized and highly efficient sgRNAs, Vp-sgRNA-01 and Vp-sgRNA-02, were designed. Vectors were constructed for efficiency testing. Schematic diagrams of the RNA fold prediction structures of the four sgRNAs are shown below. Figure 3As shown. The nucleotide sequences of Vp-sgRNA-01 and Vp-sgRNA-02 are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0070] Vp-sgRNA-01 sequence:

[0071] GTTTCAGAGCTAGAAATAGCAAGTTGAAATAAGGCTTAGTCCGTAAGCAACTATTCTAGTGGCACTGTCTCGGTGC (SEQ ID NO: 1);

[0072] Vp-sgRNA-02 sequence:

[0073] GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTTAGTCCGTAAGCAACTATTCTAGTGGCACTGTCTCGGTGC (SEQ ID NO: 2).

[0074] sgRNA sequence:

[0075] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 5);

[0076] esgRNA sequence:

[0077] GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 6).

[0078] Example 2. Transformation of transgenic plants

[0079] Transformation was performed using the conventional Agrobacterium infection method:

[0080] 1. Collect mature grains from Zhonghua 11 rice plants, remove the inner and outer shells, then soak the shelled grains in 75% alcohol for 1 minute, and then disinfect them with 50% sodium hypochlorite for 15-20 minutes.

[0081] 2. Place the sterilized rice grains on the callus induction medium on a clean bench and culture them in the dark at 30°C. The callus induction medium is composed of N6 macro-particles + MS micro-particles + B5 organic + hydrolyzed casein 300 mg / L + inositol 100 mg / L + proline 500 mg / L + sucrose 30 g / L + 2,4-D 1 mg / L.

[0082] 3. After inducing callus for 20-25 days, the induced callus is pre-cultured for later transformation experiments. The pre-culture medium is (N6 macro + MS micro + B5 organic + hydrolyzed casein 300 mg / L + inositol 100 mg / L + proline 500 mg / L + sucrose 30 g / L + 2,4-D 1 mg / L).

[0083] 4. After pre-culture, add Agrobacterium suspension (OD660 = 0.4-0.6) to the vigorous embryogenic callus tissue and soak for 20 min. After infection, place it on sterilized filter paper and blow dry. Then, inoculate the callus onto co-culture medium and incubate in the dark at 22℃ for 2-4 days. The co-culture medium is (N6 macro + MS micro + B5 organic + hydrolyzed casein 300 mg / L + inositol 100 mg / L + proline 500 mg / L + sucrose 30 g / L + 2,4-D 1 mg / L + AS 100 μmol).

[0084] 5. After co-culture, perform recovery culture for 7-10 days. Recovery medium (N6 macro-level + MS micro-level + B5 organic + hydrolyzed casein 300 mg / L + inositol 100 mg / L + proline 500 mg / L + sucrose 30 g / L + 2,4-D 1 mg / L + cephalosporin 500 mg / L).

[0085] 6. Transfer the recovered callus to selection medium and incubate in the dark for 4 weeks. Selection medium (N6 macro-level + MS micro-level + B5 organic + hydrolyzed casein 300 mg / L + inositol 100 mg / L + proline 500 mg / L + sucrose 30 g / L + 2,4-D 1 mg / L + cephalosporin 500 mg / L + glyphosate 600-1000 mg / L).

[0086] 7. Transfer the selected resistant callus to differentiation medium and culture at 25°C for differentiation. Differentiation medium (MS salt 4.3 g / L + 6-BA 1 mg / L + KT 1 mg / L + NAA 0.25 mg / L).

[0087] 8. Transfer the differentiated seedlings to rooting medium. Rooting medium (MS salt 2.15 g / L, MS vitamins, sucrose 30 g / L + NAA 1 mg / L) is cultured at 25℃ until the plant height reaches about 10 cm, then transferred to a greenhouse for further cultivation.

[0088] Example 3. Identification of transgenic positive plants

[0089] Genomic DNA was extracted from T0 rice seedlings and used as a template for PCR amplification using the primer pair described below. The PCR amplification product was then subjected to agarose gel electrophoresis. Transgenic positive plants contained a 1034 bp DNA fragment. The electrophoresis image for identifying transgenic positive plants is shown below. Figure 4 As shown.

[0090] Primer F:CGCGCGGTGTCATCTATGTTACTA (SEQ ID NO:7);

[0091] Primer R: CAGCTATTTACCCGCAGGACATA (SEQ ID NO:8).

[0092] Example 4. Analysis of Gene Editing Results

[0093] DNA from positive T0 plants was used as a template. For each target site, the corresponding primer pairs in Table 1 were used for target amplification to obtain PCR amplification products. The PCR products of corresponding sizes were then subjected to Sanger sequencing and analysis.

[0094] Table 1 Primers for identifying positive plants and mutants

[0095]

[0096] The knockout fragment range at the OsBADH2-T target site is as follows: 6-27 bp for the CRISPR / SpCas9 gene editing system and 6-146 bp for the high-efficiency CRISPR / VpCas9 gene editing system. The knockout fragment ranges for the CRISPR / SpCas9 and high-efficiency CRISPR / VpCas9 gene editing systems at the OsBADH2-T target site are respectively as follows: Figure 5 and Figure 6 As shown.

[0097] The knockout fragment range at the Os4-T target site is as follows: 2-30 bp for the CRISPR / SpCas9 gene editing system and 1-94 bp for the high-efficiency CRISPR / VpCas9 gene editing system; the knockout fragment ranges at the Os4-T target site for the CRISPR / SpCas9 gene editing system and the high-efficiency CRISPR / VpCas9 gene editing system are respectively as follows: Figure 7 and Figure 8 As shown.

[0098] The knockout fragment range at the Os19-T target site is 4-11 bp for the CRISPR / SpCas9 gene editing system and 4-48 bp for the high-efficiency CRISPR / VpCas9 gene editing system. The knockout fragment ranges for the CRISPR / SpCas9 and high-efficiency CRISPR / VpCas9 gene editing systems at the Os19-T target site are as follows: Figure 9 and Figure 10 As shown.

[0099] Specifically, the efficient CRISPR / VpCas9 gene editing system at the Os4-T target site can generate homozygous mutants with a mutation rate of 10% (the homozygous mutant plants are numbered Line 28, Line 31, Line 33, and Line 56, respectively). A schematic diagram of the sequence changes at the Os4-T target site in the homozygous mutant plants obtained through the efficient CRISPR / VpCas9 gene editing system is shown below. Figure 11 As shown in the figure, no homozygous mutants were detected in samples edited using the CRISPR / SpCas9 gene editing system at the same target site. The difference in editing effect between the efficient CRISPR / VpCas9 gene editing system and the CRISPR / SpCas9 gene editing system in this result is of great significance for rapidly obtaining homozygous plants in biobreeding.

[0100] The results show that both gene editing systems can produce fragment deletions, but the highly efficient CRISPR / VpCas9 gene editing system produces larger fragment deletions, with the length of the deleted fragments ranging from 4 to 7 times that of the CRISPR / SpCas9 gene editing system. A comparison of the lengths of deleted fragments produced by the highly efficient CRISPR / VpCas9 gene editing system and the CRISPR / SpCas9 gene editing system is shown in the figure below. Figure 12 As shown.

[0101] Table 2 Gene editing efficiency of four sgRNAs at different target sites in the CRISPR / VpCas9 gene editing system.

[0102]

[0103] sgRNA and esgRNA are known sgRNA sequences published in the literature for CRISPR / SpCas9 gene editing systems. Vp-sgRNA-01 and Vp-sgRNA-02 are both highly efficient sgRNA sequences of this invention. The gene editing efficiency results of the four sgRNAs in the CRISPR / VpCas9 gene editing system at different target sites are shown in Table 2. The results show that in the highly efficient CRISPR / VpCas9 gene editing system, the highly efficient sgRNA sequences of this invention significantly improve gene editing efficiency, and the editing efficiency is higher than that of the known sgRNA sequences (sgRNA and esgRNA). The above four sgRNAs were simultaneously tested in the CRISPR / SpCas9 gene editing system, and the editing efficiency was slightly lower or similar to that of the highly efficient CRISPR / VpCas9 gene editing system.

[0104] Example 5. Specific mutations at VpCas9 protein-related sites

[0105] The DeepSeek deep learning model was used to predict the structure of the VpCas9 protein with high editing efficiency. Through multiple correction training of the DeepSeek model, several predicted mutation sites with high editing efficiency were obtained. The operation in the above embodiment was repeated to detect the gene editing efficiency in rice Zhonghua 11.

[0106] Table 3. Mutation sites and synergistic mechanisms of VpCas9 protein

[0107]

[0108] The mutation sites and their synergistic mechanisms of the VpCas9 protein are shown in Table 3. The predicted structure of the VpCas9 protein and its three key amino acid sites are shown in Table 3. Figure 13 As shown in the table above, mutations were performed on the VpCas9 protein at the mutation sites, resulting in four VpCas9 protein mutants: VpCas9-I439E, VpCas9-E430K, VpCas9-N301D, and VpCas9-I439E, E430K, N301D. The structures of these four VpCas9 protein mutants were predicted, and their predicted structures are shown in the following figures. Figure 14 , Figure 15 , Figure 16 , Figure 17 As shown.

[0109] In this embodiment, the derived protein is any one of the following:

[0110] 1) The VpCas9 protein and other polypeptides;

[0111] 2) The VpCas9 protein mutant and other peptides;

[0112] Other peptides include nuclear localization signal (NLS) sequences, signal peptides, selection markers, and regulatory factors. Other peptides can be linked to the VpCas9 protein or VpCas9 mutants via chemical coupling, gene fusion, or non-covalent linkage.

[0113] In this embodiment, a VpCas9 protein mutant is linked to a nuclear localization signal (NLS) sequence. One or more NLS sequences are attached to the N-terminus or C-terminus of the VpCas9 protein mutant to endow it with the ability to enter the cell nucleus. The VpCas9 protein mutant is also linked to a signal peptide to enable it to target organelles. Finally, the VpCas9 protein mutant is linked to regulatory factors to allow for efficient transformation and entry into the plant.

[0114] The derived proteins of this embodiment do not affect the expected activity of the VpCas9 protein mutant (e.g., activity with guide RNA, endonuclease activity, and activity of binding to and cleaving the target sequence at a specific site under the guidance of guide RNA). The proteins and fusion proteins of this invention are not limited by their production method; for example, they can be produced by genetic engineering methods (recombinant technology) or by chemical synthesis methods.

[0115] In this embodiment, when the target sequence is DNA, the target sequence is located at the 5' end of the adjacent motif (PAM) of the original spacer sequence, and the PAM has the sequence shown in 5'-NGG, wherein N is selected from A, G, T, and C.

[0116] Table 4. Gene editing efficiency of four VpCas9 protein mutants and VpCas9-WT in a high-efficiency CRISPR / VpCas9 gene editing system.

[0117]

[0118] Table 4 shows the gene editing efficiency of four VpCas9 mutant proteins and VpCas9-WT (i.e., VpCas9 protein, the amino acid sequence of which is shown in SEQ ID NO:3) in the high-efficiency CRISPR / VpCas9 gene editing system (high-efficiency sgRNA). The results indicate that sites 439, 430, and 301 in the amino acid sequence of the VpCas9 protein are functionally critical sites. The combination of I439E + E430K + N301D significantly improves the gene editing efficiency of the VpCas9 protein. The high-efficiency sgRNA provided in this invention, used in conjunction with the three-point mutant of the VpCas9 protein, achieves a gene editing efficiency as high as 85%.

[0119] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A nucleic acid molecule, Vp-sgRNA-01, for improving gene editing efficiency, characterized in that, The nucleotide sequence of the Vp-sgRNA-01 is shown in SEQ ID NO:

1.

2. A nucleic acid molecule, Vp-sgRNA-02, for improving gene editing efficiency, characterized in that, The nucleotide sequence of the Vp-sgRNA-02 is shown in SEQ ID NO:

2.

3. An expression carrier, characterized in that, The expression vector contains the nucleic acid molecule Vp-sgRNA-01 as described in claim 1 or the nucleic acid molecule Vp-sgRNA-02 as described in claim 2.

4. A CRISPR / VpCas9 gene editing system, characterized in that, The CRISPR / VpCas9 gene editing system includes the nucleic acid molecule Vp-sgRNA-01 as described in claim 1 or contains the nucleic acid molecule Vp-sgRNA-02 as described in claim 2.

5. A CRISPR / VpCas9 gene editing system according to claim 4, characterized in that, The CRISPR / VpCas9 gene editing system includes the exonuclease Trex2 and any one of the following: 1) VpCas9 protein or plasmid expressing the VpCas9 protein, wherein the amino acid sequence of the VpCas9 protein is shown in SEQ ID NO:3; 2) VpCas9 protein mutant or plasmid expressing the VpCas9 protein mutant, wherein the VpCas9 protein mutant is a mutant obtained by mutating any one of the amino acid sequences I439E, E430K or N301D in the amino acid sequence shown in SEQ ID NO:3, or by simultaneously mutating all three amino acid sequences I439E, E430K and N301D. 3) VpCas9 protein or a VpCas9 protein mutant-derived protein, wherein the derived protein is VpCas9 protein and other polypeptides; or VpCas9 protein mutants and other polypeptides; wherein the other polypeptides include nuclear localization signal sequences, signal peptides, and selection markers.

6. A composition, characterized in that, The composition comprises the CRISPR / VpCas9 gene editing system of claim 5.

7. A method for large-fragment knockout of a target gene, characterized in that, The specific steps include: transferring the composition of claim 6 into a host cell to achieve large-fragment knockout of the target gene, wherein the target gene is derived from rice.

8. A method for obtaining mutant plants, characterized in that, The specific steps include: introducing the composition of claim 6 into a target plant, performing targeted editing on the target gene in the target plant, and then cultivating a mutant plant, wherein the plant is rice.

9. The application of the CRISPR / VpCas9 gene editing system according to claim 5 in the field of plant gene editing, characterized in that, The application includes any of the following: 1) Obtain mutants with gene loss of function; 2) Expand the scope of editing target genes in plants; 3) Improve the efficiency of plant gene editing; 4) Plant genetic transformation or plant bio-breeding; 5) Rapidly obtain homozygous mutant plants; The plant in question is rice.

Images