Preparation of CRHR2-targeting adeno-associated virus vector AAV-Cr2-RNAi and application of CRHR2-targeting adeno-associated virus vector AAV-Cr2-RNAi in treatment of neuropathic pain
By targeting CRHR2 with the adeno-associated virus vector AAV-Crhr2-RNAi, CRHR2 expression was interfered with, alleviating neuropathic pain, solving the problem of poor efficacy of existing drugs, and providing a safe and effective treatment approach.
Patent Information
- Application Number
- CN202511042322.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-28
- Publication Date
- 2025-10-31
AI Technical Summary
There is a lack of effective drugs for treating neuropathic pain in the current technology, and traditional drugs have limited effects and large side effects.
The adeno-associated virus vector AAV-Crhr2-RNAi, which targets CRHR2, was used. Double-stranded DNA oligo containing interfering sequences was synthesized and ligated into the enzyme-digested RNA-interfering adeno-associated virus vector. The interference effect of this vector on CRHR2 after injection into the dorsal horn of the mouse spinal cord was prepared and verified, thus alleviating neuropathic pain.
It significantly alleviated mechanically induced pain in mouse models without affecting motor function, providing a potential strategy for the clinical treatment of neuropathic pain.
Smart Images

Figure CN120866418A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to the preparation of an adeno-associated virus vector AAV-Crhr2-RNAi targeting CRHR2 and its application in the treatment of neuropathic pain. Background Technology
[0002] Neuropathic pain (NP) is a chronic pain syndrome caused by direct damage or disease to somatosensory pathways, essentially a pathological functional remodeling of the nervous system. The core pathological mechanisms involve abnormally increased excitability after peripheral nerve injury (peripheral sensitization), overactivation of dorsal horn neurons in the spinal cord (central sensitization), dysregulation of ion channel expression and function (such as voltage-gated sodium and calcium channels), imbalance in neurotransmitter / modulatory signaling (such as glutamate, GABA, and neuropeptides), and impairment of descending inhibitory pathways (such as the brainstem-spinal cord pathway). This internal neurological signal processing dysregulation leads to typical symptoms: spontaneous pain (persistent burning sensation, paroxysmal electric shock-like or stabbing pain) and painful responses to normal non-noxious stimuli (such as light touch or a gentle breeze) (touch-evoked pain), or significantly enhanced responses to minor noxious stimuli (such as a pinprick) (hyperalgesia). Based on large-scale epidemiological studies, the global prevalence of NP is 6.9%-10%, with approximately 90 million patients in China suffering from it. The treatment of NP faces significant challenges due to its generally poor response to conventional analgesics, such as nonsteroidal anti-inflammatory drugs (NSAIDs).
[0003] Currently, according to treatment guidelines, first-line drugs mainly include: ligands that modulate the α2δ subunit of calcium channels (such as gabapentin and pregabalin), and antidepressants that enhance descending inhibitory pathways (such as tricyclic antidepressants like amitriptyline and SNRIs like duloxetine / venlafaxine). Topical medications (such as 5% lidocaine patches and 8% capsaicin patches) and neuromodulation techniques (such as spinal cord stimulation and dorsal root ganglion stimulation) have shown value in specific patient populations. However, first-line drugs only achieve a 40% relief rate, and second- and third-line drugs are often accompanied by serious side effects, making these drugs very limited. Therefore, developing a safe and effective drug for treating neuropathic pain is an urgent issue. Summary of the Invention
[0004] The purpose of this invention is to address the lack of drugs for neuropathic pain in the prior art.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] An adeno-associated virus vector AAV-Crhr2-RNAi targeting CRHR2, wherein the AAV-Crhr2-RNAi contains the shRNA sequence: CTGCATCACCACCATCTTCAA.
[0007] This application also provides a method for preparing the adeno-associated virus vector AAV-Crhr2-RNAi targeting CRHR2. The method involves synthesizing a double-stranded DNA oligo containing an interfering sequence, which is then directly ligated into a digested RNA interference adeno-associated virus vector via enzyme restriction sites at both ends. The ligated product is then transferred into prepared competent bacterial cells. The resulting single-clone colonies are first identified by PCR, and positive PCR colonies are then sequenced. The identified positive clones are the successfully constructed target gene RNA interference adeno-associated virus vector.
[0008] Preferably, the structure of the vector is hSyn promoter-EGFP-MIR155(MCS)-SV40PolyA.
[0009] Preferably, the GV680 vector is linearized by the restriction endonuclease BsmB I, and the target RNA sequence is ligated into it to construct an adeno-associated virus vector with the target RNAi sequence.
[0010] This application also provides the application of the aforementioned adeno-associated virus vector AAV-Crhr2-RNAi targeting CRHR2 in the preparation of drugs for treating neuropathic pain.
[0011] Compared with the prior art, this application has the following beneficial effects:
[0012] This application validates pain behavior in animals by injecting the virus into the dorsal horn of the mouse spinal cord for 21 days to establish a spinal cord nucleus induction (SNI) model. Neuropathic pain behavior was detected at 1, 3, 7, 14, and 21 days. The results show that interfering with CRHR2 expression can alleviate mechanical touch-induced pain induced by the SNI model. The roller test results show that the two viruses injected into the dorsal horn of the mouse spinal cord did not affect the motor function of the mice. Real-time RT-PCR of the mouse spinal cord shows that injection of AAV-Crhr2-RNAi into the dorsal horn of the mouse spinal cord can effectively interfere with CRHR2 expression in the spinal cord, laying the foundation for clinical pain treatment and having significant application and promotion value. Attached Figure Description
[0013] Figure 1 The flowchart and diagram of the construction of the RNA interference adeno-associated virus vector are presented in one embodiment of this application.
[0014] Figure 2 In one embodiment of this application, the infection effect of mouse spinal cord dorsal horn injected with AAV-Crhr2-RNAi 10 days after SNI modeling is shown. The scale bar of the top image is 500 μm, and the scale bar of the bottom image is 100 μm. The bottom row of images is an enlarged view of the area within the white box in the top image.
[0015] Figure 3 In one embodiment of this application, the interference effect of AAV-Crhr2-RNAi injected into the dorsal horn of the mouse spinal cord was analyzed by Real-time PCR using Student's T-test. Compared with the control virus group at the corresponding time points, *P<0.05, **P<0.01, ***P<0.001.
[0016] Figure 4 In one embodiment of this application, mice were injected with the virus in the dorsal horn of the spinal cord for 21 days before SNI modeling was established, and mechanical touch-induced pain behavior was detected at 1d, 3d, 7d, 14d, and 21d.
[0017] Figure 5 In one embodiment of this application, two groups of mice were subjected to a roller test to detect changes in the mice's motor ability after viral injection.
[0018] Figure 6 An experimental time flowchart is provided in one embodiment of this application. Detailed Implementation
[0019] The present invention will be further described in detail below with reference to specific embodiments.
[0020] This application provides an adeno-associated virus vector AAV-Crhr2-RNAi that targets CRHR2, wherein the AAV-Crhr2-RNAi contains the shRNA sequence: CTGCATCACCACCATCTTCAA.
[0021] This application also provides a method for preparing the adeno-associated virus vector described above, which includes the following steps: screening for RNA sequences, constructing plasmids, packaging AAV viruses, and purifying the viruses to obtain shRNA sequences in AAV viruses;
[0022] The construction method is as follows: Double-stranded DNA oligo containing the interfering sequence is synthesized, and the RNA interference adeno-associated virus vector GV680 containing enzyme restriction sites is directly ligated into both ends of the oligo. The ligated product is then transformed into prepared bacterial competent cells. The resulting single-clone colonies are first identified by PCR, and positive colonies are then identified by sequencing. The identified positive clones are the successfully constructed RNA interference adeno-associated virus vectors of the target gene.
[0023] The carrier construction information in this application is as follows:
[0024] First, the vector structure is: hSynpromoter-EGFP-MIR155(MCS)-SV40 PolyA
[0025] The sequence of the plasmid Polylinker is as follows:
[0026] ACCGCGAGACGGCCCGGCGCCGCTACAGGGCGCGTCCCATTCGC
[0027] CATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT
[0028] TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATT
[0029] AAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGA
[0030] CGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTA
[0031] CCGGGCCCCCCCTCGACGTCCTCCAGCTTTTGTTCCCTTTAGTGAGGG
[0032] TTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAA
[0033] ATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAA
[0034] AGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTG
[0035] CGTTGCGCTCACTGCCCGCTTTCCACTAGTCGTCTCCTAGA
[0036] The GV680 vector was linearized using the restriction endonuclease BsmBI, and the target RNAi sequence was ligated into it to construct an adeno-associated virus vector carrying the target RNAi sequence. The Lac-Z sequence is located between the two BsmBI sequences, allowing for blue-white screening.
[0037] After blue-white screening, white clones were selected and sent for sequencing.
[0038] In addition, based on the aforementioned adeno-associated virus vector, this application also provides the application of AAV-Crhr2-RNAi in the preparation of drugs for treating neuropathic pain.
[0039] The GV680 sequence mentioned above is shown below:
[0040] PSC97918-1.EGFP-C-F.5517424.G3621G07.B05
[0041] GGGGAGCGGGCTCTCTCGGCATGGACGAGCTGTACAAGGCTAGCTAACTGGAGGCTTGCTGAAGGCTGTATGCTGTTGAAGATGGTGGTGATGCAGGTTTTGGCCACTGACTGACCTGCATCAACCATCTTCAACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAAGCTTTAAACCGGTTATCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGAACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTATGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCGAGCTTTAAATAGCTGAGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTCAGGGGGAGATGGG
[0042] PSC97918a: accgctagctaaCTGGAGGCTTGCTGAAGGCTGTATGCTGT TGAAGATGGTGGTGATGCAGGTTTTGGCCACTGACTGACCTGCATCAACCATCTTCAACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCaagcttggt<
[0045] 1. Viral vectors contain eukaryotic promoters and other elements required for high-level gene expression in mammalian cells when a foreign sequence is cloned into the multiple cloning site (MCS). The vector also contains AAV inverted terminal repeats (ITRs) that guide viral replication and packaging. Appropriate viral vectors should be selected based on different experimental purposes (e.g., promoter activity studies, gene expression studies, RNA interference, etc.). In this paper, GV680, tagged with EGFP, was used for gene silencing studies.
[0046] 2. The pAAV-RC vector contains the rep and cap genes, which encode AAV replication and viral capsid proteins, respectively. Maintaining stable expression levels of the rep and cap genes is a crucial step in obtaining the desired high-titer viral product. pAAV-RC utilizes two different promoters to control the expression of Rep and Cap separately, thereby achieving optimal expression levels and ratios of each gene product.
[0047] 3. The pHelper plasmid contains a set of adenovirus genes VA, E2A, and E4, which are essential for the production of high-titer viruses in AAV-293 cells.
[0048] Based on the aforementioned constructed adeno-associated virus vector AAV-Crhr2-RNAi targeting CRHR2, this application also provides the application of the aforementioned adeno-associated virus vector AAV-Crhr2-RNAi targeting CRHR2 in the preparation of a drug for treating neuropathic pain. The drug relieves neuropathic pain via dorsal horn injection into the spinal cord.
[0049] The above content will be elaborated below with specific verification experiments:
[0050] I. Experimental Materials and Their Sources:
[0051]
[0052]
[0053] II. siRNA Design
[0054] Please see Figure 1 In this application, siRNA was designed using software such as RNAi Designer with the following parameters: GC content of 47.62%; Target Seq region of CTGCATCACCACCATCTTCAA, and RNA interference adeno-associated virus vector was constructed.
[0055] III. Changes in CRHR2 mRNA expression 21 days after AAV-Crhr2-RNAi injection in the dorsal horn of the spinal cord of a mouse model of neuropathic pain
[0056] Real-time quantitative PCR results showed that after SNI modeling, CRHR2 mRNA expression in the mouse spinal cord was significantly increased. Figure 3 ).
[0057] 3.1 Preparation of a mouse model of neuropathic pain
[0058] A model of neuropathic pain induced by sciatic nerve injury with preservation: Mice were anesthetized with isoflurane, and the skin was thoroughly prepared by shaving the legs with an animal razor and disinfecting the prepared area with alcohol. A longitudinal incision was made proximal to the knee with a scalpel, and the muscle layer was bluntly dissected with forceps. After exposing the sciatic nerve through the biceps femoris muscle, the common peroneal nerve and tibial nerve were tightly ligated at the trichiasis with a 7-0 silk thread, and then cut distal to the knot, removing 2-4 mm of the distal nerve terminal. The sural nerve was kept intact during the procedure. Postoperatively, the surrounding muscles were closed and the skin incision was sutured. The wound and surrounding area were disinfected with povidone-iodine. In the sham-operated group, the sciatic nerve was isolated and exposed in the same manner without any lesions. Lesions resulted in significant hypersensitivity in the lateral paw region, innervated by the preserved sural nerve.
[0059] 3.2 Animal tissue sampling, RNA extraction, reverse transcription of cDNA, and Real-time PCR process:
[0060] 3.2.1 Tissue sampling
[0061] (1) Using the anesthesia mask of the Reward anesthesia machine, the mice were kept in a stable breathing state under anesthesia. The chest cavity was cut open, the perfusion needle was inserted into the left apex of the heart, and the heart was perfused with physiological saline.
[0062] (2) The liver turned white and the mesentery became transparent, indicating that the perfusion was complete. The spine was cut open to expose the spinal cord. The removed spinal cord was placed in an EP tube containing 200 μL of Trizol RNAase Free and placed in an ice box.
[0063] 3.2.2 RNA Extraction
[0064] (1) Homogenize the sample once for 30 seconds, for a total of 4 times, until no tissue fragments are visible. Add 800 μL Trizol and let stand for 5 minutes.
[0065] (2) Add 200 μL of chloroform to each EP tube, shake rapidly and vigorously for 1 min, and let stand for 5 min;
[0066] (3) Centrifuge at 4℃, 12000rpm, for 15min;
[0067] (4) Gently aspirate the clear liquid from the top layer into an RNAase-Free EP tube, add an equal volume of isopropanol, gently invert the tube until no visible filaments remain, and let stand for 10 minutes.
[0068] (5) Centrifuge at 4℃, 12000 rpm, for 15 min;
[0069] (6) Discard the supernatant, add 1 mL of anhydrous ethanol and mix gently, then centrifuge at 4℃, 12000 rpm for 15 min.
[0070] (7) Discard the supernatant, invert the EP tube onto the filter paper, and let it air dry at room temperature until a translucent precipitate appears at the bottom of the tube;
[0071] (8) Add 20 μL of RNase-free H2O to each tube, heat at 60°C, and incubate in a water bath for 10 min to promote dissolution. After dissolution, place the tube in an ice box.
[0072] (9) Measure RNA concentration using an OD analyzer.
[0073] 3.2.3 Total RNA was reverse transcribed into cDNA
[0074] (1) Removal of DNA impurities from the sample (10 μl system)
[0075]
[0076] (2) RNA was reverse transcribed into cDNA (20 μl system).
[0077]
[0078] After reverse transcription into cDNA, dilute 8 times with triple-distilled water and store at -20℃ for later use.
[0079] (3) Primer sequence
[0080] For primer design, the mouse CHRH2 mRNA sequence in the NCBI database was used in this application. Primers were designed on the NCBI website and their specificity was verified by BLAST. The size of the amplification product was predicted. The specificity of the primers was verified by melting curve and agarose gel running results. The primer sequences were synthesized by OBiO (Shanghai Heyuan).
[0081] The primer sequences required for the experiment are shown in the table below.
[0082]
[0083]
[0084] 3.2.4 Real-time PCR experiment
[0085] (1) Prepare the Real-time PCR reaction system (10 μL) according to the table below:
[0086]
[0087] (2) PCR reaction using a Life Technology instrument, under the following conditions:
[0088]
[0089] IV. Infection effect 21 days after injection of AAV-Crhr2-RNAi into the dorsal horn of the mouse spinal cord
[0090] Immunofluorescence results showed that AAV-Crhr2-RNAi injected into the dorsal horn of the mouse spinal cord infiltrated neurons, specifically the superficial layer of the dorsal horn. Figure 2 ).
[0091] 4.1 Immunofluorescence sample preparation, staining, and imaging
[0092] Tissue section preparation
[0093] Mice were anesthetized with isoflurane by inhalation, then perfused with physiological saline and 4% paraformaldehyde via the heart and placed on ice. The mice were then gently shaken on a shaker to fix them. The spinal cord was then placed in a 5mL tube containing 4% paraformaldehyde and fixed at 4°C for 6-14 hours. The solution was then replaced with 20% sucrose PBS. After the spinal cord settled to the bottom of the tube, the solution was replaced with 30% sucrose PBS. Once the spinal cord settled again, it was removed and the trimmed spinal cord was placed in a model mold and rapidly frozen on a microtome. After solidification, the embedded blocks were attached to the freezing stage using OTC adhesive for cryosectioning. Spinal cord tissue patches were 30μm thick, mounted on adhesive slides, and air-dried. They can be directly stained with 0.01mol / L PBS for immunofluorescence staining or frozen at -80°C for later use.
[0094] 4.2 Immunofluorescence staining
[0095] (1) Place the slides in a container containing 0.01 mol / L PBS and wash them 3 times for 10 min each time;
[0096] (2) After washing the slides, add immunofluorescence blocking solution and block at room temperature for 2 hours;
[0097] (3) After blocking is complete, add the primary antibody prepared with blocking solution and incubate overnight at 4°C;
[0098] (4) Take it out the next day, let it return to room temperature, and wash it three times with 0.01mol / L PBS for 10 minutes each time;
[0099] (5) Dilute the secondary antibody with 0.01 mol / L PBS and incubate at room temperature in the dark for 2 hours;
[0100] (6) Discard the secondary antibody and wash the slides three times with 0.01 mol / L PBS for 10 min each time;
[0101] (7) Place at room temperature away from light. After the slide is half-dry, drop a sealing agent on the slide, cover it with a coverslip, and let it dry before taking pictures with a fluorescence microscope.
[0102] V. Validation of AAV-Crhr2-RNAi efficiency
[0103] In this application, AAV-Crhr2-RNAi was first injected into the dorsal horn of the mouse spinal cord. Spinal cord samples were collected 21 days later to verify the effect of interfering with CRHR2 expression in the spinal cord. Real-time PCR results showed that CRHR2 expression was inhibited. Figure 3 ).
[0104] VI. Effects of AAV-Crhr2-RNAi on mechanical pain behavior in mice with neuropathic pain
[0105] In this application, a spinal cord nucleation (SNI) model was established in mice 21 days after viral injection into the dorsal horn of the spinal cord. Mechanical touch-induced pain was assessed at 1, 3, 7, 14, and 21 days post-modeling. Then, the efficacy of AAV-Crhr2-RNAi in alleviating SNI-induced pain was evaluated. Behavioral results showed that AAV-Crhr2-RNAi could alleviate SNI-induced mechanical pain behavior, with effects starting 3 days after SNI modeling. Figure 4 The efficacy gradually decreased after 14 days.
[0106] 6.1 Injecting AAV-Crhr2-RNAi into the dorsal horn of the mouse spinal cord
[0107] SNI (Spinal Infection Nodule) model was established 21 days after injection of AAV-Crhr2-RNAi into the dorsal horn of the spinal cord. The SNI model is described in section 2.1. Mice were deeply anesthetized, disinfected with povidone-iodine, and the dorsal skin was incised. Superficial muscles along the spine were separated, and both sides of the spine were fixed. An L1 laminectomy was performed to expose one side of the lumbar spinal cord. AAV virus (100 nL) was injected superficially into the dorsal horn of the spinal cord, with a glass electrode reaching the superficial layer of the spinal cord at a rate of 20 nL / min. After injection, the needle was stopped for 5 minutes and then slowly withdrawn. The fixation device was removed, the wound was disinfected, and the muscle and skin incisions were sutured. After disinfection with povidone-iodine, the animals were placed on a heating blanket to recover, maintaining sterility throughout the procedure. The control group received the same method of control virus injection.
[0108] 6.2 Behavioral testing of mice
[0109] Three days prior to the behavioral test, mice were allowed to acclimatize, with the same experimental personnel and environment maintained, and a double-blind method was used for the test.
[0110] For mechanical pain behavior detection, mice were placed in a transparent nine-square grid on an iron frame and allowed to acclimatize for 60 minutes. Foot acupuncture was then performed using different von Frey fibers (0.02g, 0.04g, 0.07g, 0.16g, 0.4g, 0.6g, 1g, and 2g). The von Frey fibers vertically stimulated the lateral side of the mouse's left foot until it bent at 45°, repeated 5 times. The presence of paw lifting, paw flicking, and paw licking behaviors was observed. If these behaviors occurred 3 times, it was recorded as X; otherwise, it was recorded as O. The initial stimulation was 0.16g. If it was X, the stimulation was increased by one level; if it was O, the stimulation was increased by one level, and so on. Finally, four characters "XXXX", five characters "OOOOO", or six characters such as "OXXXOX" were obtained. These characters were then converted into a paw-withdrawal threshold (g) according to a threshold table. A higher paw-withdrawal threshold indicates weaker pain perception. Figure 4 )
[0111] The Rota-Rod wheel experiment for mice consisted of two parts: acceleration and constant speed. Mice were acclimatized for three days prior to the experiment, and then moved at a constant speed (10 rpm / s) for 5 minutes to ensure they did not fall. During the experiment, the constant speed (10 rpm / s) was maintained for 5 minutes, and the acceleration speed was increased from 10 rpm / s to 80 rpm / s for 5 minutes. The time from the start of acceleration to the fall was recorded as Latency(s).
[0112] ( Figure 5 )
[0113] This experiment used a neuropathic pain model to verify the role of the adeno-associated virus vector AAV-Crhr2-RNAi targeting CRHR2 in pain management. The neuropathic pain model (SNI) induces neuropathic pain by ligating two branches of the sciatic nerve (tibial and common peroneal nerves) while preserving the sural nerve. In this application, AAV-Crhr2-RNAi and the control virus AAV-Syn-MCS-EGFP were injected into the dorsal horn of the mouse spinal cord. Pain behavior analysis showed that interfering with CRHR2 expression alleviated SNI-induced neuropathic pain without affecting motor function, providing a potential therapeutic strategy for drug development. Therefore, dorsal horn injection of AAV-Crhr2-RNAi can alleviate neuropathic pain, and the application of the adeno-associated virus vector AAV-Crhr2-RNAi targeting CRHR2 is an effective approach to treating pain.
[0114] In summary, this application validated pain behavior in animals by inducing SNI (Self-Induced Pain) model in mice 21 days after viral injection into the dorsal horn of the spinal cord. Neuropathic pain behavior was detected at 1, 3, 7, 14, and 21 days. The results showed that interfering with CRHR2 expression could alleviate mechanical touch-induced pain induced by the SNI model. The roller test results showed that the two viruses injected into the dorsal horn of the mouse spinal cord did not affect the motor function of the mice. Real-time RT-PCR of the mouse spinal cord showed that AAV-Crhr2-RNAi injection into the dorsal horn of the mouse spinal cord could effectively interfere with CRHR2 expression in the spinal cord, laying the foundation for clinical pain treatment and having significant application and promotion value.
Claims
1. An adeno-associated virus vector AAV-Crhr2-RNAi targeting CRHR2, characterized in that: The AAV-Crhr2-RNAi contains the shRNA sequence: CTGCATCACCACCATCTT CAA.
2. A method for preparing an adeno-associated virus vector AAV-Crhr2-RNAi targeting CRHR2, used to prepare the adeno-associated virus vector AAV-Crhr2-RNAi for CRHR2 as described in claim 1, characterized in that: A double-stranded DNA oligo containing interfering sequences was synthesized and directly ligated into a digested RNA interference adeno-associated virus vector through enzyme restriction sites at both ends. The ligated product was then transferred into prepared bacterial competent cells. The resulting single-clone colonies were first identified by PCR, and positive colonies were then identified by sequencing. The identified positive clones were the successfully constructed RNA interference adeno-associated virus vector for the target gene.
3. The method for preparing an adeno-associated virus vector AAV-Crhr2-RNAi targeting CRHR2 according to claim 2, characterized in that: The structure of the carrier is hSyn promoter-EG FP-MIR155(MCS)-SV40 PolyA.
4. The method for preparing the adeno-associated virus vector AAV-Crhr2-RNAi targeting CRHR2 according to claim 3, characterized in that: The GV680 vector was linearized using the restriction endonuclease BsmB I, and the target RNA sequence was ligated into it to construct an adeno-associated virus vector carrying the target RNAi sequence.
5. The use of the adeno-associated virus vector AAV-Crhr2-RN Ai targeting CRHR2 as described in claim 1 in the preparation of a drug for treating neuropathic pain.