Inducing cell lethality in cancer

Abstract

The present invention relates to the discovery that depletion of a FANC protein or gene, such as FANCM, FANCD2 or FANCI, causes synthetic lethality of SETD2 deficient cells. Methods and compounds for the treatment of SETD2 deficient cancers are provided.

Description

TECHNICAL FIELD

[0001] The present invention relates to inducing cell lethality of cancer cells. BACKGROUND

[0002] Many conventional anticancer therapies, such as radiotherapy or chemotherapy, target dividing cells and are highly toxic to non-cancerous cells, causing severe side effects.

[0003] Therapeutic strategies based on synthetic lethal interactions, i.e. inducing cell death when two genes are simultaneously, but not individually, disrupted, allow selective targeting of tumor cells with high efficiency, while sparing non-cancerous cells.

[0004] There is a need for new and improved synthetic lethal interaction-based cancer therapies. SUMMARY

[0005] The present inventors have found that depletion of Fanconi anemia complementation group proteins (FANC), e.g. by siRNA, is selectively lethal to SETD2-deficient cancer cells. Thus, FANC antagonists can be used to treat SETD2-deficient cancers.

[0006] A first aspect of the present invention provides a method of treating cancer in an individual in need thereof, comprising: reducing FANC expression or activity in the individual, wherein the cancer is SETD2-deficient.

[0007] A second aspect of the present invention provides a FANC antagonist for use in a method of treating a SETD2-deficient cancer.

[0008] A third aspect of the present invention provides use of a FANC antagonist in the manufacture of a medicament for treating a SETD2-deficient cancer.

[0009] A fourth aspect provides a method of screening for a compound for inducing cell death of a SETD2-deficient cancer cell, the method comprising determining binding of a test compound to FANC, wherein binding to FANC indicates that the compound induces cell death of a SETD2-deficient cell

[0010] A fifth aspect provides a method of screening for a compound for inducing cell death of a SETD2-deficient cancer cell, the method comprising determining the effect of a test compound on expression or activity of FANC, wherein reducing expression or activity of FANC indicates that the compound induces cell death of a SETD2-deficient cancer cell.

[0011] The sixth aspect provides a method of determining the responsiveness of a cancer in an individual to treatment with a FANC antagonist, the method comprising determining the presence of one or more SETD2-deficient cancer cells in a sample obtained from the individual, the presence of one or more SETD2-deficient cancer cells in the sample indicating that the cancer is responsive to treatment with a FANC antagonist.

[0012] The seventh aspect provides a method of selecting an individual having a SETD2-deficient cancer for treatment with a FANC antagonist, the method comprising: identifying cancer cells obtained from the individual as lacking SETD2 relative to normal cells.

[0013] Preferred Fanconi anemia complementation group (FANC) proteins of the first to seventh aspects include FANCM, FANCD2 or FANCI.

[0014] Preferred FANC antagonists of the first to seventh aspects include FANCM antagonists, FANCD2 antagonists and FANCI antagonists.

[0015] Other aspects and embodiments of the application are described in more detail below. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 Cell culture density reduction in SETD2-deficient clear cell carcinoma cells transfected with siRNA to deplete FANCM is shown. Wild type (WT) or CRISPR / Cas9 SETD2-knockout (KO) clear cell renal carcinoma cells (Caki2 cell line) were transfected with control (siCtrl) or FANCM siRNA. (A) shows cell culture density 3 days after FANCM knockdown. (B) shows cell culture density reduction in SETD2-KO Caki cells 6 days after knockdown.

[0017] Figure 2 shows increased cell death in SETD2-deficient clear cell carcinoma cells 3 days after transfection with siRNA to deplete FANCM. WT or SETD2-KO clear cell carcinoma cells (786-0 cell line) were transfected with control or FANCM siRNA. Viability was assessed by flow cytometry measurement of propidium iodide staining levels in SETD2-KO 786-0 cells after 3 days of culture (A), and (B) shows the percentage of PI+ cells in WT or SETD2-KO clear cell carcinoma cells (786-0 cell line) transfected with siCtrl or siFANM. P values were calculated using a two-tailed Student’s t-test. P < 0.05, P < 0.005, P < 0.001.

[0018] Figure 3 shows increased cell death in SETD2-deficient clear cell carcinoma cells 6 days after transfection with siRNA to deplete FANCM. WT or SETD2-KO clear cell carcinoma cells (786-O cell line) were transfected with control or FANCM siRNA. After 6 days of culture (A), viability was assessed by flow cytometry to determine the level of propidium iodide staining in SETD2-KO 786-O cells, (B) shows the percentage of PI+ cells in WT or SETD2-KO clear cell carcinoma cells (786-O cell line) transfected with siCtrl or siFANCM. P values were calculated using a two-tailed Student's t-test. P < 0.05, P < 0.005, P < 0.001.

[0019] Figure 4 shows increased cell death in SETD2-deficient cells transfected with siRNA to deplete FANCD2. WT (ACHN and Caki-1) or SETD2-KO cells (RCC-AB, RCC-ER, RCC-MF) were transfected with control or FANCM siRNA. (A) and (B) show the percentage of PI+ cells in WT or SETD2-KO cells 3 days after transfection with siCtrl or siFANCD3. P values were calculated using a two-tailed Student's t-test. P < 0.05, P < 0.005, P < 0.001. DETAILED DESCRIPTION

[0020] The present application relates to the discovery that a reduction or elimination of the expression or activity of FANC proteins in SETD2-deficient cancer cells induces cell death. This discovery can be used to treat cancer conditions, e.g., cancer conditions characterized by SETD2 deficiency.

[0021] Su(var), zeste enhancer, Trithorax (SET) domain-containing protein 2 (SETD2; EC: 2.1.1.359; Gene ID: 29072) is a histone methyltransferase responsible for the trimethylation of lysine residue 36 of histone H3 (i.e., H3K36me3). SETD2-mediated H3K36me3 is deposited during transcriptional elongation and is important in maintaining nucleosome occupancy, DNA double-strand break repair, RNA splicing, and transcriptional termination (Li J, et al . Oncotarget. 2016;7(31):50719-50734.; de Almeida SF, Carmo-Fonseca M. Trends Biochem Sci. 2012;37(6):248-253.; Carvalho S,et al . Nucleic Acids Res. 2013;41(5):2881-2893.; CarvalhoS, et al . Elife. 2014;3:e02482.; Grosso AR, et al . Elife. 2015;4:e09214 )). Thus, loss of SETD2 causes genomic instability, and SETD2 is mutated in a range of human cancers (Fahey CC, et al. Cold Spring Harb Perspect Med. 2017;7(5):a026468).

[0022] The human gene encoding SETD2 has 25 exons and is located at 3p21.31. The reference coding sequence for human SETD2 is set forth in SEQ ID NO: 9. Other reference human SETD2 coding sequences have database accession numbers NM_001349370.3 and NM_014159.7. A SETD2 coding sequence as described herein can comprise a reference nucleotide sequence, such as SEQ ID NO: 9, or a variant thereof.

[0023] A SETD2-deficient cancer can include or consist of one or more cancer cells having reduced or eliminated SETD2 expression and / or activity. Expression and / or activity of SETD2 in a cancer cell can be reduced or eliminated by one or more mutations, such as one or more mutations, translocations, or deletions, in one or both alleles of the SETD2 gene, or by epigenetic modifications, such as alterations in DNA or histone methylation, that impair SETD2 expression or activity, or by mutations in genes encoding regulatory factors, such as HOX antisense RNAs.

[0024] Mutations can include non-synonymous mutations, including frameshift mutations, missense mutations, nonsense mutations, splice site mutations, non-terminal mutations, and translation initiation site mutations; truncating mutations, including nonsense mutations, non-terminal mutations, frameshift deletion mutations, frameshift insertions, and splice site mutations; and in-frame mutations, including in-frame deletions and in-frame insertions. Mutations in the gene encoding SETD2 can result in the production of a variant polypeptide having altered activity, such as reduced or eliminated activity. Genomic translocations or chromosomal rearrangements, such as inversions, involving the SETD2 gene and / or partial or complete deletion of the SET2D gene can also result in loss of functional SETD2 protein. Epigenetic changes, such as DNA methylation or histone (de)acetylation and (de)methylation, can also result in reduced or eliminated SETD2 activity.

[0025] The presence of one or more mutations in one or both alleles of the SETD2 gene can be determined by detecting the presence of nucleic acid sequences from the SETD2 gene comprising the mutation(s) in one or more cells of a test sample obtained from the individual, or detecting the variant polypeptide encoded by the gene.

[0026] The expression and / or activity of SETD2 in a sample obtained from an individual can be determined using different methods.

[0027] Genetic testing (e.g., DNA sequencing, exon sequencing, comparative genomic hybridization, in situ hybridization (e.g., in situ fluorescent hybridization (FISH)), PCR, RT-PCR, karyotyping, classical cytogenetics, and molecular cytogenetics), or molecular testing (e.g., enzyme activity assays, complementation assays, SETD2 or H3K36me3 western blots or immunofluorescence, bisulfite sequencing) can reveal the presence of one or more mutations (including mutations of one or more nucleotides, deletions, translocations, inversions, chromosomal rearrangements, or epigenetic alterations) in the SETD2 gene or defective SETD2 protein production or activity.

[0028] Nucleic acids (which can be genomic DNA, RNA, or cDNA, or amplified regions thereof) can be sequenced to identify or determine the presence of one or more mutations therein. Mutations can be identified by comparing the obtained sequence to database sequences for the component (as described above). In particular, the presence of one or more mutations that cause loss of function or loss of SETD2 can be determined. The presence of one or more types of mutations described above indicates reduced or eliminated activity.

[0029] Sequencing can be performed using any of a number of standard techniques. Sequencing of amplified products can, for example, involve precipitation with isopropanol, resuspension, and sequencing using a TaqFS+ dye terminator sequencing kit. Extension products can be electrophoresed on an ABI 377 DNA sequencer and data analyzed using Sequence Navigator software.

[0030] Specific amplification reactions (e.g., polymerase chain reaction (PCR)) using one or more pairs of primers can be conveniently used to amplify regions of interest within a nucleic acid sequence, e.g., portions of the sequence suspected of containing mutations or polymorphisms. The amplified nucleic acids can then be sequenced as described above, and / or tested in any other way to determine the presence or absence of mutations or polymorphisms that reduce or eliminate expression and / or activity of SETD2.

[0031] Furthermore, where nucleic acids from an individual or sample are sequenced, sequence information can be retained and subsequently retrieved without recourse to the original nucleic acids themselves. Thus, for example, scanning a database of sequence information using sequence analysis software can identify sequence alterations or mutations.

[0032] In some embodiments, a cancer can be identified as SETD2 deficient by assessing the level of expression or activity of SET2D. The level of expression can be determined by, e.g., Western blot, ELISA, RT-PCR, nucleic acid hybridization, or karyotype analysis.

[0033] Mutations and polymorphisms associated with SETD2 deficient cancers can also be detected at the protein level by detecting the presence of variant polypeptides, e.g., by immunohistochemistry.

[0034] Further, SETD2 is the only enzyme responsible for H3K36me3 (Edmunds et al., (2008) (The EMBO journal 27(2):406-420)), and thus determining the level of H3K36me3 in a sample obtained from an individual can be used to identify a cancer as SETD2 deficient. The level of H3K36me3 can be determined using immunofluorescence or Western blot. A decrease in the level of the trimethylated mark H3K36me3 is indicative of a decrease or elimination of SETD2 activity and / or expression.

[0035] The sample can be a sample of cancer cells and can be obtained from an individual using routine techniques.

[0036] As described herein, SETD2 deficient cancers can be treated by decreasing or eliminating the expression or activity of Fanconi anemia complementation group (FANC) proteins. FANC proteins are components of the FANC / BRCA pathway involved in DNA replication and DNA damage response. FANC proteins can include FANCA, FANCC, FANCG (XRCC9), FANCJ, FANCE, FANCF, FANCP (SLX4), FANCD1 (BRCA2), FANCI, FANCL, FANCM, FANCN (PALB2), FANCO (RAD51C), FANCQ (ERCC4), FANCS (BRCA1), FANCT (UBE2T), FANCU (XRCC2), FANCV (REV7), FANCW (RFWD3), FANCB, FANCR, and (RAD51).

[0037] Preferred FANC proteins can include components of the FA core ubiquitin ligase complex, such as FANCA, FANCB, FANCC, FANCE, FANCF, FANCG, and FANCL. Other preferred FANC proteins can include components of the heterodimeric complex of the FA core complex monoubiquitination (ID complex), e.g., FANCD2 and FANCI.

[0038] In some preferred embodiments, the FANC protein is FANCM.

[0039] In other preferred embodiments, the FANC protein is FANCD2 or FANCI.

[0040] Fanconi anemia M histone (FANCM) is an ATP-dependent DNA helicase / transloase (EC3.6.4.13) involved in homologous recombination, meiosis, and DNA repair. FANCM can be human FANCM. The human gene encoding the FANCM polypeptide (gene ID: 57697) has 25 exons and is located at 14q21.2. The reference human FANCM amino acid sequence is shown in SEQ ID NO: 1. Other reference human FANCM amino acid sequences are available in database accessions NP_001295062.1, NP_1295063.1, and NP_065988.1. The FANCM polypeptide or protein described herein may contain the reference amino acid sequence, such as SEQ ID NO: 1 or a variant thereof.

[0041] Fanconi anemia D2 histone (FANCD2) is a member of the heterodimer ID (or FANCD2 / FANCI) complex, which is loaded onto chromatin via monoubiquitination of the FA core complex and in response to DNA damage. FANCD2 can be human FANCD2. The human gene encoding the FANCD2 polypeptide (gene ID: 2177) has 45 exons and is located at 3p25.3. The reference human FANCD2 amino acid sequence is shown in SEQ ID NO: 5. Other reference human FANCD2 amino acid sequences are available in database accessions NP_001018125.1, NP_001306913.1, NP_001351182.1, NP_001361183.1, NP_001361184.1, and NP_149075.2. The FANCD2 polypeptide or protein described herein may contain the reference amino acid sequence, such as SEQ ID NO: 5 or a variant thereof.

[0042] Fanconi anemia histone I (FANCI) is a member of the heterodimer ID (or FANCD2 / FANCI) complex, which is loaded onto chromatin via monoubiquitination of the FA core complex and in response to DNA damage (e.g., interstrand crosslinking). FANCI can be human FANCI. The human gene encoding the FANCI polypeptide (gene ID: 55215) has 41 exons and is located at 15q26.1. The reference human FANCI amino acid sequence is shown in SEQ ID NO: 7. Other reference human FANCI amino acid sequences are available in database accessions NP_001363839.1, NP_001363840.1, and NP_060663.2. The FANCI polypeptide or protein described herein may contain the reference amino acid sequence, such as SEQ ID NO: 7 or a variant thereof.

[0043] The variants used in this article are amino acid sequences that have at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with reference amino acid sequences (e.g., SEQ ID NO: 1, SEQ ID NO: 5, or SEQ ID NO: 7).

[0044] The reference human FANCM coding nucleotide sequence is shown in SEQ ID NO: 2. Other reference human FANCM coding sequences are available in database accessions NM_001308133.1, NM_001308134.1, and NM_020937.4. The FANCM nucleotide sequences described herein may comprise nucleotide sequences of the reference human FANCM coding sequence, such as SEQ ID NO: 2 or variations thereof.

[0045] The reference human FANCD2 coding nucleotide sequence is shown in SEQ ID NO: 6. Other reference human FANCD2 coding sequences are available in database accessions NM_001319984.2, NM_001374253.1, NM_001374254.1, NM_001374255.1, and NM_0033084.6. The FANCD2 nucleotide sequences described herein may comprise nucleotide sequences of the reference human FANCD2 coding sequence, such as SEQ ID NO: 6 or variants thereof.

[0046] The reference human FANCI coding nucleotide sequence is shown in SEQ ID NO: 8. Other reference human FANCI coding sequences are available in database accessions NM_001376910.1, NM_001376911.1, and NM_018193.3. The FANCI nucleotide sequences described herein may comprise nucleotide sequences of the reference human FANCI coding sequence, such as SEQ ID NO: 8 or variations thereof.

[0047] Reference amino acids and coding sequences for other FANC proteins are available in public databases.

[0048] Sequence identity is typically defined using the GAP algorithm (Wisconsin GCG package, Accelerys Inc, San Diego USA). GAP uses the Needleman and Wunsch algorithms to compare two complete sequences, maximizing the number of matches and minimizing the number of gaps. Typically, default parameters are used, where the gap creation penalty is 12 and the gap extension penalty is 4. While GAP is preferred, other algorithms, such as BLAST (which uses Altschul), can also be used. et al. (1990) J. Mol. Biol 215: 405-410, FASTA (which uses Pearson and Lipman (1988)). PNAS USA 85: Methods 2444-2448), SSEARCH (Smith and Waterman (1981) J. Mol Biol. 147 : 195-197; Pearson Genomics. 1991 Nov; 11(3):635-50), HMMER3 (Johnson LS et al BMC Bioinformatics. 2010 Aug 18; 11():431) or the TBLASTN procedure of Altschul et al. (1990) as described above, typically using default parameters (see, for example, Pearson CurrProt Bioinformatics (2013) Chapt 3 Uniy 3.1 doi:10.1002 / 0471250953.bi0301s42). In particular, the psi-Blast algorithm (Altschul) can be used. et al. Nucl. Acids Res. (1997) 25 3389-3402). Sequence identity and similarity can also be determined using Genomequest. TMSoftware (Gene-it, Worcester Ma USA). Preferably, sequence comparisons are performed based on the full length of the relevant sequences described herein.

[0049] In other implementations, for example, when the individual to be treated is a non-human mammal, the FANC can be a non-human mammalian FANC. Reference amino acid and coding sequences for non-human FANCs are available in public databases.

[0050] This article shows that reduced FANC expression or activity, such as reduced FANCM, FANCD2, and / or FANCI expression or activity, decreases the viability of SETD2-deficient cancer cells. As described in this article, reducing or eliminating the expression or activity of FANC proteins can reduce or inhibit the activity of the FANC / BRCA pathway for repairing interstranded DNA crosslinks (ICL) (see, for example, Renaudin et al. Genes 2020 11(5) 585).

[0051] FANC activity in an individual can be reduced by administering FANC antagonists that decrease the expression or activity of the FANC protein. FANC antagonists can inhibit the activity of the FANC protein (e.g., FANC inhibitors), or reduce the activity of the FANC protein by degrading it (e.g., FANC degrading agents such as PROTAC or molecular glue), or reduce or inhibit the expression of the FANC protein (e.g., inhibitory nucleic acids or targeting nucleases).

[0052] In some implementations, the FANC antagonist may be a FANCM antagonist that reduces the expression or activity of the FANCM protein.

[0053] In other embodiments, the FANC antagonist may be a FANCD2 antagonist that reduces the expression or activity of the FANCD2 protein.

[0054] In other embodiments, the FANC antagonist may be a FANCI antagonist that reduces the expression or activity of the FANCDI protein.

[0055] FANC inhibitors can include, for example, small chemical molecules, such as non-polymeric organic compounds with a molecular weight of 900 Daltons or less. For example, suitable small-molecule FANCM inhibitors can inhibit the binding of ATP to the ATPase domain of FANCM; the binding of DNA to the translocase domain of FANCM; and / or the binding of FANCM to a binding partner, such as MHF, FAAP24, BLM, RMI, or Topo IIIa. Suitable small-molecule FANCD2 or FANCI inhibitors can inhibit the monoubiquitination of FANCD2 or FANCI; the binding of FANCI to FANCD2; or the phosphorylation of FANCI or FANCD2 by ATR / ATM. Appropriate techniques for the rational design of small-molecule inhibitors based on structural analysis of FANC proteins (such as FANCM, FANCD2, and FANCI) are well known in the art.

[0056] FANC inhibitors may include, for example, biomolecules that specifically bind to the FANC protein. FANCM inhibitors may include, for example, biomolecules that specifically bind to FANCM. In some embodiments, the biomolecule may specifically bind to the DEAH helicase-like domain corresponding to residues 83 to 591 of SEQ ID NO: 1.

[0057] Biomolecules may include peptides. Peptides may contain 5 to 40 amino acids, or be composed of 5 to 40 amino acids, such as 6 to 10 amino acids, and may be derived from FANC proteins, such as FANCM, FANCD2, or FANCI, or their binding partners as described above. Biomolecules may also include antibodies, antibody fragments and antibody derivatives, as well as non-immunoglobulin-binding molecules, such as aptamers, trinectin, anticalin, kunitz domains, transferrin, nurse shark antigen receptors, and lamprey leucine-rich repeat proteins. Suitable techniques for generating biomolecules that specifically bind to FANC proteins are well known in the art.

[0058] FANC degraders comprise small molecule ligands that control protein interactions within the ubiquitin-proteasome system. FANC degraders may include proteolytic targeting chimeras (PROTACs). PROTACs are heterobifunctional molecules containing a ligand that links to a target protein (POI) recruited by an E3 ubiquitin ligase (E3) via a linker. Degradation begins when PROTAC promotes the formation of a ternary complex between the POI and E3, followed by POI ubiquitination and degradation via the ubiquitin-proteasome system. PROTACs are then recycled to target another POI. Thus, this catalytic process leads to a reduction in the level of the target (Sun, X., et al. Sig TransductTarget Ther 4, 64 (2019); Schneider, M., et al Nat Rev Drug Discov 20, 789-797 (2021)). Therefore, FANC degraders include PROTACs containing ligands of FANC proteins (such as FANCM, FANCD2, or FANCI) that are linked to E3 ubiquitin ligase (E3) recruitment ligands. Methods for designing PROTACs are well known in the art (see, for example, Paiva SL, Curr Opin Chem Biol. 2019;50:111-119).

[0059] FANC degraders can include molecular glues. Molecular glues are ligase- and target-protein ligase-induced access scaffolds. Molecular glues intercalate at the naturally occurring protein-protein interaction (PPI) interface on the POI and induce an interaction between the E3 ubiquitin ligase and the target protein, leading to the degradation of the target protein (Kozicka Z, et al., Cell Chem Biol. 2021;28(7):1032-1047; Zhao L, et al., Signal Transduct Target Ther. 2022;7(1):113; Simonetta KR, et al. Nat Commun. 2019;10(1):1402.). Therefore, FANC degraders include molecular glues that induce an interaction between FANCM and the E3 ubiquitin ligase. The methods for designing molecular glues are well known in the art (see, for example, Kozicka Z, et al., Cell Chem Biol. 2021;28(7):1032-1047).

[0060] Suitable E3 ligase ligands and methods for E3 ligase ligand discovery are known in the art (see, for example, Ishida T, Ciulli A. SLAS Discov. 2021;26(4):484-502).

[0061] As used herein, the terms “FANC antagonist” and “FANC inhibitor” refer to compounds that antagonize or inhibit components of the FANC / BRCA pathway (FANC proteins) and may include “FANCM antagonist”, “FANCM inhibitor”, “FANCD2 antagonist”, “FANCD2 inhibitor”, “FANCI antagonist”, and “FANCI inhibitor”.

[0062] As used herein, the terms “FANC antagonist” and “FANC inhibitor” include FANCM antagonists and cover pharmaceutically acceptable salts and solvates of these compounds.

[0063] Suitable antagonists for reducing or inhibiting the expression of FANC proteins (such as FANCM, FANCD2, or FANCI) include repressive nucleic acids, targetable nucleases, and nucleic acids encoding such agents. Nucleic acids encoding repressive nucleic acids or targetable nucleases can be contained in a vector.

[0064] Suitable expression vectors are well known in the art and include viral vectors such as retroviruses, adenoviruses, adeno-associated viruses, lentiviruses, vaccinia virus or herpesvirus vectors.

[0065] Compared to control cells, the expression of active FANC protein can be reduced by an inhibitory nucleic acid or a targetable nuclease, or the active FANC protein can be absent, meaning that transcription of the FANC gene and / or translation of FANC mRNA can be reduced or absent. Thus, cells treated with an inhibitory nucleic acid or a targetable nuclease lack or have reduced amounts of active FANC protein compared to control cells. Reducing the amount of active FANC protein to 20% or less of that in control cells has been shown to be sufficient to induce cell death. For example, cells can express up to 5%, up to 10%, up to 15%, or up to 20% of the active FANC peptide expressed by control cells.

[0066] In some implementations, nucleic acid inhibition can be used to reduce the expression of active FANC peptides. The use of nucleic acid inhibition techniques (e.g., antisense and RNAi inhibition) to downregulate target gene expression is well known in the art.

[0067] Cells can be transfected using repressive nucleic acids (i.e., nucleic acid molecules that inhibit FANC protein expression, such as siRNA or shRNA) or heterologous nucleic acids encoding repressive nucleic acids. Repressive nucleic acids reduce the expression of active FANC peptides in cells by interfering with transcription and / or translation.

[0068] RNAi involves the expression or introduction of RNA molecules into cells that contain sequences identical or highly similar to the FANCM coding sequence. The RNA molecule interacts with the mRNA transcribed from the FANCM gene, leading to sequence-specific degradation or specific post-transcriptional gene silencing (PTGS) of the mRNA. This reduces or inhibits the expression of the active FANCM peptide (Angell & Baulcombe (1997) The EMBO Journal 16, 12:3675-3684; Voinnet & Baulcombe (1997) Nature 389: pg 553).

[0069] The preferred RNA molecule is double-stranded RNA (dsRNA) (Fire A. et al Nature 391, (1998)). Synthetic siRNA duplexes have been shown to specifically inhibit the expression of endogenous and heterologous genes in a variety of mammalian cell lines (Elbashir SM. et al. Nature, 411, 494-498, (2001)).

[0070] Suitable RNA molecules for RNAi repression include short interfering RNA (siRNA). siRNA is a double-stranded RNA molecule of 15 to 40 nucleotides in length, preferably 15 to 28 nucleotides, or 19 to 25 nucleotides, for example, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. For example, two unmodified 21-mer oligonucleotides can be annealed together to form siRNA. siRNA molecules may contain 3' and / or 5' overhangs of about 0, 1, 2, 3, 4, or 5 nucleotides in length on each strand. The length of the overhangs on each strand is independent, meaning that the length of the overhang on one strand does not depend on the length of the overhang on the second strand.

[0071] Other suitable RNA molecules for RNAi include short hairpin RNA (shRNA). shRNA is a single-stranded RNA molecule containing a short (e.g., 19 to 25 nucleotides) antisense nucleotide sequence, followed by a 5 to 9 nucleotide loop, and a complementary sense nucleotide, or a sequence consisting of the above nucleotides. Alternatively, the sense sequence may precede the nucleotide loop structure, while the antisense sequence may follow it. The nucleotide loop forms a hairpin bend, which allows base pairing between the complementary sense and antisense sequences to form shRNA.

[0072] Repressive nucleic acids, such as siRNA or shRNA, may contain all or part (e.g., 15 to 40 nucleotides) identical or substantially identical (i.e., at least 90%, at least 95%, or at least 98% identical) to, or consist of, a reference FANC nucleotide coding sequence (e.g., SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 8 or its complementary sequence). Suitable reference sequences encoding FANCM for designing repressive nucleic acids are publicly available and include SEQ ID NO: 2. Suitable reference sequences encoding FANCD2 for designing repressive nucleic acids are publicly available and include SEQ ID NO: 6. Suitable reference sequences encoding FANCI for designing repressive nucleic acids are publicly available and include SEQ ID NO: 8.

[0073] The activity of FANC proteins in cancer cells can be inhibited by downregulating the production of active CANCM peptides with inhibitory nucleic acids. For example, siRNA that inhibits human FANCM expression may contain 18 to 22 consecutive nucleotides from SEQ ID NO: 2; siRNA that inhibits human FANCD2 expression may contain 18 to 22 consecutive nucleotides from SEQ ID NO: 6; and siRNA that inhibits human FANCI expression may contain 18 to 22 consecutive nucleotides from SEQ ID NO: 8.

[0074] Examples of preferred siRNA molecules for inhibiting human FANCM include SEQ ID NO: 3 (siFa) and SEQ ID NO: 4 (siFb). Suitable siRNA molecules are also described in Silva B, ef al. Nat Commun. 2019;10(1):2253. siRNA molecules for inhibiting human FANCM are also commercially available (siRNA IDs s33621 and s33619, ThermoFisher) and have been described in Lu R, ef al. Nat Commun. 2019;10(1):2252. [Published correction appears in Nat Commun. 2019 Nov 20;10(1):5345].

[0075] Repressive nucleic acids, such as siRNA and shRNA, used to reduce FANC protein expression can be readily designed using reference FANC coding sequences and software tools widely available in the art, and can be produced using conventional techniques. For example, repressive nucleic acids can be chemically synthesized; recombinantly produced in vitro or in cells (Elbashir, SM et al., Nature 411:494-498 (2001); Elbashir, SM, et al., Genes & Development 15:188-200 (2001)) or obtained from commercial sources (e.g., Cruachem (Glasgow, UK), Dharmacon Research (Lafayette, Colo., USA)).

[0076] In some implementations, two or more repressive nucleic acids can be used to suppress the expression of the FANC protein. For example, an siRNA library can be used. Suitable siRNAs and siRNA libraries can be generated using standard techniques.

[0077] Antisense techniques can also be used for nucleic acid inhibition. Antisense oligonucleotides can be engineered to hybridize with complementary sequences of nucleic acids, pre-mRNA, or mature mRNA, interfering with the production of base excision repair pathway components, thereby reducing their expression or completely or substantially completely preventing their expression. In addition to targeting coding sequences, antisense techniques can be used to target the control sequences of genes (e.g., 5' flanking sequences), whereby antisense oligonucleotides can interfere with the expression of the control sequences. The construction of antisense sequences and their uses are well known in the art (Peyman and Ulman, Chemical Reviews, 90:543-584, (1990); Crooke, Ann. Rev. Pharmacol. Toxicol. 32:329-376, (1992)).

[0078] Antisense oligonucleotides can be produced in vitro or ex vivo for administration, or antisense RNA can be produced in cancer cells where FANC protein downregulation is required. Therefore, double-stranded DNA can be placed under “reverse” promoter control, causing transcription of the antisense strand of DNA to produce RNA complementary to normal mRNA transcribed from the sense strand of the target gene. The complementary antisense RNA sequence is then thought to bind to the mRNA to form a double strand, inhibiting the translation of endogenous mRNA from the target gene into protein.

[0079] The complete sequence corresponding to the inverse FANC coding sequence is not required. For example, a fragment of sufficient length can be used. Screening for fragments of various sizes and for fragments from various parts of the coding sequence or flanking sequences of a gene to optimize the level of antisense repression is routine for those skilled in the art. It may be advantageous to include the start methionine ATG codon and, if possible, one or more nucleotides upstream of the start codon. Suitable fragments may have about 14 to 23 nucleotides, such as about 15, 16, or 17 nucleotides.

[0080] In other embodiments, targeted mutagenesis can be used to reduce the expression of active FANC peptides. The use of targeted mutagenesis techniques (e.g., gene editing) to knock out or eliminate the expression of target genes is widely used in the art (see, for example, Gajet al (2013) Trends Biotechnol. 31(7) 397-405).

[0081] One or more mutations, such as insertions, substitutions, or deletions, can be introduced into the FANC gene of cancer cells. Suitable mutations include deletions of all or part of the FANC gene (e.g., two or more exons), frameshift mutations, or nonsense mutations that introduce an early stop codon. In some preferred embodiments, one or more early stop codons can be introduced into the FANC coding sequence, preferably into the first 400 codons of the coding sequence. For example, a mutation (e.g., an early stop codon) can be introduced into the first 400 codons of the coding sequence of FANCM to eliminate the ATPase domain. Mutations can prevent the expression of active FANC peptides, for example, by weakening the transcription or translation of the FANC gene or by inducing the expression of inactive peptides.

[0082] Targeted mutagenesis, introducing one or more mutations, can be performed using any convenient method. For example, cancer cells can be transfected with a heterologous nucleic acid encoding a targetable nuclease. Targetable nucleases, for example, can be inactivated by introducing one or more mutations that prevent the expression of the active FANC peptide, thereby inactivating the FANC gene encoding the FANC protein in one or more cells of an individual.

[0083] Targetable nucleases can selectively inactivate the FANC gene encoding FANC proteins (such as FANCM, FANCD2, or FANCI) in cancer cells of an individual. Targetable nucleases can be specifically targeted to cancer cells using conventional techniques, including cell-targeted delivery mediators such as viral vectors expressing ligands specific to particular cell types; direct administration of the targetable nuclease to the tumor, for example by injection; or selective expression of the targetable nuclease derived from a heterologous nucleic acid within cancer cells, for example using a tissue-specific promoter.

[0084] Targetable nucleases can be site-specific (e.g., ZFN or TALEN) or can be expressed using one or more targeting sequences that target the FANCM gene (e.g., CRISPR / Cas).

[0085] Heteronucleotides encoding targetable nucleases may include inducible promoters that promote the expression of the targetable nuclease and optional target sequences in specific cell types (e.g., tumor cells). For example, an inducible promoter may be a promoter-enhancer cassette that selectively facilitates the expression of the targetable nuclease and optional target sequences in tumor cells compared to other host cell types.

[0086] Suitable targeted nucleases include, for example, site-specific nucleases such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and homing enzymes, or RNA-guided nucleases such as regularly spaced clustered short palindromic repeats (CRISPR) nucleases.

[0087] Zinc finger nucleases (ZFNs) contain one or more Cys2-His2 zinc finger DNA-binding and cleavage domains (i.e., nucleases). The DNA-binding domain can be engineered using conventional techniques to recognize and bind to any nucleic acid sequence (see, for example, Qu et al. (2013) Nucl Ac Res 41(16):7771-7782). The use of ZFNs to introduce mutations into target genes is well known in the art (see, for example, Beerli et al Nat. Biotechnol.2002; 20:135-141; Maeder et al Mol. Cell. 2008; 31:294-301; Gupta et al Nat. Methods. 2012; 9:588-590), and engineered ZFNs are commercially available (Sigma-Aldrich (St. Louis, MO).

[0088] Transcription activator-like effector nucleases (TALENs) comprise nonspecific DNA-cutting nucleases fused to a DNA-binding domain containing a series of modular TALE repeat units linked together to recognize consecutive nucleotide sequences. The use of TALEN-targeted nucleases is well-known in the art (e.g., Joung & Sander (2013) NatRev Mol Cell Bio 14:49-55; Kim et al Nat Biotechnol. (2013); 31:251-258. Miller JC, et al. Nat. Biotechnol. (2011) 29:143-148. Reyon D, et al. Nat. Biotechnol. (2012); 30:460-465).

[0089] Homing nucleases are deoxyribonucleases characterized by large recognition sites (double-stranded DNA sequences of 12 to 40 base pairs); therefore, these sites typically appear only once in any given genome (see, for example, Silva et al. (2011) Curr Gene Ther 11(1):11-27).

[0090] CRISPR-targeted nucleases (e.g., Cas9) combine with guide RNA (gRNA) to cut genomic DNA in a sequence-specific manner. The crRNA and tracrRNA of the guide RNA can be used alone or combined into a single RNA to enable site-specific mammalian genome cutting within the FANCM gene or its regulatory elements. Using the CRISPR / Cas9 system to introduce insertions or deletions into genes as a way to reduce transcription is well known in the field (see, for example, Cader et al. Nat Immunol 2016 17 (9) 1046-1056, Hwang et al. (2013) Nat. Biotechnol 31:227-229; Xiao et al., (2013) Nucl Acids Res 1-11; Horvath et al., Science (2010) 327:167-170; Jinek Met al. Science (2012) 337:816-821; Cong Let al. Science (2013) 339:819-823; Jinek M et al. (2013) elife 2:e00471; Mali Petal. (2013) Science 339:823-826; Qi LS et al. al. (2013) Cell 152:1173-1183; Gilbert LA et al. (2013) Cell 154:442-451; Yang H et al. (2013) Cell 154:1370-1379; and Wang H et al. (2013) Cell 153:910-918).

[0091] In some implementations, the targetable nuclease is a Cas endonuclease expressed in cancer cells, preferably Cas9, which is combined with a guide RNA targeting sequence that targets the Cas endonuclease to cleave the genomic DNA within the FANC gene and produce an insertion or deletion that prevents the expression of the active FANC polypeptide.

[0092] Nucleic acid sequences encoding repressive nucleic acids or targetable nucleases and optionally guide RNAs can be contained within expression vectors. Suitable vectors can be selected or constructed containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylated sequences, enhancer sequences, biomarker genes, and other suitable sequences. Preferably, the vector contains appropriate regulatory sequences to drive the expression of the encoded nucleic acid in host cells. Suitable regulatory sequences for driving the expression of heterologous nucleic acid-coding sequences in a range of expression systems are well known in the art, including constitutive promoters, such as viral promoters like CMV or SV40. In some preferred embodiments, tissue-specific or inducible promoters (such as photoinducible promoters) can be used to selectively express repressive nucleic acids or targetable nucleases and optionally guide RNAs in cancer cells. The vector may also contain sequences such as origin of replication and selection markers, which allow selection, replication, and expression in bacterial hosts (e.g., *E. coli*) and / or eukaryotic cells (e.g., yeast, insect, or mammalian cells). Vectors suitable for expressing repressive nucleic acids or targetable nucleases in mammalian cells include plasmids and viral vectors, such as retroviruses, lentiviruses, adenoviruses, and adeno-associated viruses. Suitable techniques for expressing repressive nucleic acids or targetable nucleases in mammalian cells are well known in the art (see, for example; Molecular Cloning: a LaboratoryManual: 3rd edition, Russell et al., 2001, Cold Spring Harbor Laboratory Press or Protocols in MolecularBiology, Second Edition, Ausubel et al. eds. John Wiley & Sons,1992; Recombinant Gene Expression Protocols Ed RS Tuan (Mar 1997) HumanaPress Inc).

[0093] Other aspects of the invention relate to using FANC proteins, such as FANCM, FANCD2, or FANCI, to screen for compounds that increase cell death or reduce the viability of SETD2-deficient cells, and potentially for the treatment of SETD2-deficient cancers.

[0094] Screening methods can be used to identify test compounds that bind to isolated FANC proteins. Methods for screening compounds for reduced viability or increased cell death in SETD2-deficient cells may include determining the binding of the test compound to a FANC protein (such as FANCM, FANCD2, or FANCI). For example, the test compound may be contacted with a FANC protein, and the binding of the test compound to the FANC protein may be determined. The binding between the test compound and the FANC protein may indicate that the test compound reduces the viability of SETD2-deficient cells or increases their cell death.

[0095] The binding of the test compound to the FANC protein can be determined using standard techniques, such as surface plasmon resonance (SPR).

[0096] In some implementations, the ability of a test compound to inhibit the interaction between FANC proteins (such as FANCM, FANCD2, or FANCI) and their binding partners can be determined. Methods for screening compounds for reduced viability or increased cell death in SETD2-deficient cells may include determining the effect of a compound on the binding of FANC proteins to their binding partners. For example, FANC proteins may be contacted with their binding partners in the presence and absence of a test compound. A reduction in the binding between FANC proteins and their binding partners in the presence of the test compound, relative to the absence of the test compound, may indicate that the test compound reduces the viability of SETD2 cells or increases their cell death.

[0097] Binding mates are proteins that naturally bind to intracellular FANC proteins, for example, during homologous recombination, meiosis, and DNA repair. FANCM binding mates can include MHF, FAAP24, HCLK2, the BTR complex, and individual members of the BTR complex such as BLM, RMI1, RMI2, and Topo IIIα. FANCD2 binding mates can include DNA, BRCA2, USP1, and FANCI. FANCI binding mates can include both DNA and FANCD2.

[0098] Screening methods can be used to identify test compounds that inhibit FANC protein activity. Methods for screening compounds for reduced SETD2 cell viability or increased cell death may include determining the effect of the test compound on FANC protein activity. For example, the activity of FANC proteins (such as FANCM, FANCD2, or FANCI) can be determined in the presence or absence of the test compound. A decrease in FANC protein activity in the presence of the test compound, relative to its absence, indicates that the compound reduces the viability of SETD2-deficient cells or increases their cell death.

[0099] In some embodiments, the ATP-dependent DNA helicase / transloase activity of FANCM can be determined in the presence of a test compound, relative to the absence of a test compound. A reduction or decrease in ATP-dependent DNA helicase / transloase activity in the presence of a test compound can indicate that the test compound inhibits the activity of the FANCM protein. For example, the test compound can be a FANCM inhibitor. Suitable methods for determining activity, including ATPase and transloase assays, are well known in the art. For example, ATP hydrolysis can be measured in the presence of forked DNA structures, as described in Coulthard R, et al. Structure. 2013;21(9):1648-1658. A reduction in ATP hydrolysis can indicate that the test compound reduces or decreases the FANCM DNA helicase / transloase activity. Transloase activity can be determined using a D-ring dissociation assay, which is performed by the dissociation of the D-ring catalyzed by FANCM, and is described in Gari K, Decaillet C, Delannoy M, Wu L, Constantinou A.. Proc Natl Acad Sci US A. 2008;105(42):16107-16112. Reduced or eliminated D-ring dissociation in the presence of the test compound indicates that the test compound can decrease or inhibit the transloase activity of FANCM.

[0100] Those skilled in the art can modify the specific implementation of any screening or assay method of the present invention using conventional techniques and knowledge. It will be apparent to those skilled in the art that appropriate control experiments are necessary. The FANC protein used in the screening method can be an isolated polypeptide containing the full-length FANC sequence, such as a FANCM reference sequence, as listed herein as SEQ ID NO: 1; a FANCD2 reference sequence, as listed herein as SEQ ID NO: 5; a FANCI reference sequence, as listed herein as SEQ ID NO: 7; or any variant or fragment of these sequences. Suitable fragments may include at least 50, at least 100, or at least 150 consecutive amino acids from a FANC reference sequence. In some embodiments, a FANCM fragment containing ATPase or translocase activity may be used, such as a fragment containing an N-terminal DEAH helicase-like domain corresponding to residues 83 to 591 of SEQ ID NO: 1, or a fragment composed thereof. The isolated FANC polypeptide can be generated using standard recombinant techniques.

[0101] The test compound can be an isolated molecule or can be contained in a sample, mixture, or extract, such as a biological sample. Compounds that can be screened using the methods described herein can be natural or synthetic chemical compounds used in drug screening protocols, and may include, for example, small organic molecules, peptides, and nucleic acids (such as aptamers). Extracts from plants, microorganisms, or other organisms containing several characterized or uncharacterized components may also be used.

[0102] Suitable test compounds for screening include those that inhibit activities similar to the ATP-dependent DNA helicase / transloase activity of FANCM. For example, suitable test compounds could be ATP analogs. Appropriate test compounds can be prepared using rational drug design to provide test candidate compounds with specific molecular shape, size, and charge properties suitable for modulating FANCM activity.

[0103] Combinatorial library technology provides an efficient method for testing the potential ability of a large number of different compounds to modulate the activity of FANC proteins. Such libraries targeting various natural products, small molecules, and peptides, and their uses, are known in the art. The use of peptide libraries may be preferred in certain situations. In some embodiments, biomolecular libraries, such as aptamers or antibody molecules, may be preferred.

[0104] The amount of test compound that can be added in the assay of this invention is typically determined through repeated trials based on the type of compound used. Generally, a putative inhibitory compound at concentrations of about 0.001 nM to 1 mM or higher, such as 0.01 nM to 100 pM, or 0.1 pM to 50 pM, or about 10 pM, can be used. Even compounds with weaker effects can be useful lead compounds for further research and development.

[0105] Test compounds may include peptides derived from the FANC protein or its binding partner as described above. The ability of membrane-permeable peptide fragments of 5 to 40 amino acids (e.g., 6 to 10 amino acids) to bind to or inhibit the activity of the FANC protein can be tested. Such regulatory peptide properties can be enhanced by adding one of the following groups to the C-terminus: chloromethyl ketone, aldehyde, and boric acid. These groups are transition state analogs of serine, cysteine, and threonine proteases. The N-terminus of the peptide fragment can be blocked with a carbobenzyl group to inhibit aminopeptidase and improve stability (Proteolytic Enzymes 2nd Ed, Edited by R. Beynon and J. Bond, Oxford University Press, 2001).

[0106] Test compounds may include antibodies, antibody fragments and antibody derivatives, as well as non-immunoglobulin-binding molecules such as aptamers, trinectin, anticalin, kunitz domains, transferrin, nurse shark antigen receptors, and leucine-rich repeat proteins from sea lampreys.

[0107] In some implementations, a suitable molecule may be directed to the DEAH helicase-like domain corresponding to residues 83 to 591 of SEQ ID NO: 1 or to another part of the FANCM protein.

[0108] Candidate regulatory antibody molecules can be characterized, and their binding regions are identified as single-chain antibodies and fragments thereof responsible for inhibiting activity or blocking interactions with binding partners. Suitable antibodies can be obtained using techniques standard in the art, including, for example, immunizing mammals with suitable peptides (e.g., fragments of pro-inflammatory peptides), or isolating specific antibodies from recombinantly generated libraries expressing variable immunoglobulin domains, for example using λ phages or filamentous phages with functional immunoglobulin binding domains on their surface; see, for example, WO92 / 01047.

[0109] Aptamers targeting FANC proteins also serve as probabilistic reagents for regulating FANC activity. Aptamers are nucleic acids that specifically bind to target molecules. Typically, aptamers are small nucleic acid molecules ranging from 15 to 50 bases in length, folded into well-defined secondary and tertiary structures, such as stem-loop structures or G-quartets. Aptamers can be folded into structures with lengths of less than 10... -12 M of k d They bind very tightly to the target molecule. Aptamers can bind to FANC proteins, such as FANCM, FANCI, or FANCD2, with very high specificity. For example, isolated aptamers can show binding affinities greater than 10,000-fold different between the target molecule and another molecule that differs from the target molecule by only one position. (The last sentence appears to be incomplete and possibly refers to a different aptamer.) d In comparison, aptamers and FANC proteins (e.g., FANCM) can have kJ values ​​that are at least 10, 100, 1000, 10,000, or 100,000 lower. d The production and use of aptamers are well known in the art (see, for example, Bunka et al Curr Opin Pharmacol 2010 10 (5) 557-562).

[0110] Test compounds identified as inhibiting the activity of FANC proteins (such as FANCM, FANCI, or FANCD2) can be further investigated using one or more secondary screenings. Secondary screening can involve testing biological function or activity in vitro and / or in vivo (e.g., in animal models). For example, the ability of a test compound to reduce the viability of SETD2 cells or increase their cell death can be determined. In some embodiments, secondary screening can involve determining the selectivity of a compound for a FANC protein (e.g., FANCM) by screening against a group of isolated enzymes or other protein factors.

[0111] The effects of test compounds identified as FANC inhibitors on mammalian cells can be determined in vitro. For example, the effects of test compounds on SETD2-deficient cell lines can be determined. Increased cell death in the presence of a compound, relative to its absence, can indicate that the compound exhibits activity suitable for treating SETD2-deficient cancers.

[0112] After identifying a FANC inhibitor with potential for treating SETD2-deficient cancers as described herein, the method may further include modifying the compound to optimize its pharmaceutical properties. Suitable optimization methods (e.g., through structural modeling) are well known in the art. Further optimization or modification can then be performed to obtain one or more final compounds for in vivo or clinical testing.

[0113] Test compounds identified as FANC inhibitors can be isolated and / or purified, or synthesized using conventional techniques such as recombinant expression or chemical synthesis. Furthermore, test compounds can be manufactured and used to prepare (i.e., manufacture or formulate) compositions (such as pharmaceuticals, pharmaceutical compositions, or drugs). Therefore, the methods described herein may include formulating the test compound with a pharmaceutically acceptable excipient, mediator, or carrier for therapeutic applications into a pharmaceutical composition.

[0114] While FANC antagonists, such as FANC inhibitors, degraders, inhibitory nucleic acids, targetable nucleases, nucleic acids encoding inhibitory nucleic acids, or targetable nucleases, can be administered alone, they are typically administered as pharmaceutical compositions comprising at least one component other than an active agent. FANC antagonists can be mixed with other reagents, such as buffers, carriers, diluents, preservatives, and / or pharmaceutically acceptable excipients, to produce pharmaceutical compositions for cancer immunotherapy. Suitable reagents are described in more detail below.

[0115] Aspects of the present invention provide (i) a pharmaceutical composition comprising a FANC antagonist selected from the group consisting of: (a) a FANC inhibitor, (b) a FANC degrader, (c) a FANC-inhibiting nucleic acid, (d) a FANC-targeting nuclease, (e) a nucleic acid encoding a FANC-inhibiting nucleic acid or a targeting nuclease, and (ii) a method of producing a pharmaceutical composition for cancer immunotherapy (e.g., for treating SETD2-deficient cancers), comprising mixing the FANC antagonist as described above with a pharmaceutically acceptable excipient.

[0116] In some implementations, the FANC antagonist may be: a FANCM antagonist selected from (a) a FANCM inhibitor, (b) a FANCM degrader, (c) a FANCM-inhibiting nucleic acid, (d) a FANCM-targeting nuclease, and (e) a nucleic acid encoding a FANCM-inhibiting nucleic acid or a nuclease-targeting nuclease; a FANCD2 antagonist selected from (a) a FANCD2 inhibitor, (b) a FANCD2 degrader, (c) a FANCD2-inhibiting nucleic acid, (d) a FANCD2-targeting nuclease, and (e) a nucleic acid encoding a FANCD2-inhibiting nucleic acid or a nuclease-targeting nuclease; or a FANCI antagonist selected from (a) a FANCI inhibitor, (b) a FANCI degrader, (c) a FANCI-inhibiting nucleic acid, (d) a FANCI-targeting nuclease, and (e) a nucleic acid encoding a FANCI-inhibiting nucleic acid or a nuclease-targeting nuclease.

[0117] As used herein, the term "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that, to a reasonable extent of medical judgment, are suitable for contact with the tissues of a subject (e.g., a human) without excessive toxicity, irritation, allergic reactions, or other problems or complications, and that meet a reasonable benefit / risk ratio. Each carrier, excipient, etc., must also be "acceptable" in the sense of compatibility with other components of the formulation.

[0118] Pharmaceutical compositions suitable for administration (e.g., by infusion) include aqueous and non-aqueous isotonic, pyrogen-free sterile injectable solutions that may contain antioxidants, buffers, preservatives, stabilizers, antibacterial agents, and solutes that make the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions comprising suspending agents and thickeners. Examples of suitable isotonic media for such formulations include sodium chloride injection, Ringer solution, or lactated Ringer injection. Suitable carriers can be found in standard pharmaceutical textbooks, for example, Remington's Pharmaceutical Sciences, 18th edition, Mack Publishing Company, Easton, Pa., 1990.

[0119] FANC antagonists or pharmaceutical compositions comprising FANC antagonists as described herein may be administered to the subject via any convenient route of administration, whether systemic / peripheral or at the desired site of action, including but not limited to: parenteral administration, such as by infusion, including intravenous infusion, particularly intravenous bolus infusion. Suitable infusion techniques are known in the art and are routinely used in treatment (see, for example, Rosenberg et al., New Eng. J.of Med., 319:1676, 1988).

[0120] Reducing the activity or expression of FANC in SETD2-expressing cells has no effect on cell death. Therefore, systemic administration (e.g., via oral administration or injection) of the FANC antagonists described herein can induce selective cell death in SETD2-deficient cancer cells in an individual, relative to other non-SETD2-deficient cells in that individual.

[0121] It should be understood that the appropriate dosage of FANC antagonists and compositions containing FANC antagonists can be varied depending on the patient. Determining the optimal dosage generally involves balancing the level of therapeutic benefit of the invention with any risks or adverse side effects of treatment. The selected dosage level will depend on a variety of factors, including but not limited to the activity of specific cells, route of administration, time of administration, rate of cell loss or inactivation, duration of treatment, other drugs, compounds and / or materials used in the combination, and the patient's age, sex, weight, condition, general health and prior medical history. The amount of cells and route of administration will ultimately be determined by the physician, although the dosage will generally achieve a local concentration at the site of action that achieves the desired effect without causing significant harm or adverse side effects.

[0122] The typical oral dose range for small molecule inhibitors is from about 0.05 mg to about 1000 mg, preferably from about 0.1 mg to about 500 mg, more preferably from about 1.0 mg to about 200 mg, administered in one or more doses (e.g., 1 to 3 doses). The exact dose will depend on the frequency and route of administration, the sex, age, weight and general condition of the patient being treated, the nature and severity of the condition being treated, any comorbidities to be treated, and other factors that are obvious to those skilled in the art. For parenteral routes, such as intravenous, intrathecal, intramuscular and similar administration, the typical dose is about half that used for oral administration.

[0123] FANC antagonists as described herein, such as (a) FANC inhibitors, (b) FANC degraders, (c) FANC-inhibiting nucleic acids, (d) FANC-targeting nucleases, or (e) nucleic acids encoding FANC-inhibiting nucleic acids or targeting nucleases, may be used for treatment. For example, FANC antagonists that reduce FANC protein activity may be administered to individuals to treat SETD2-deficient cancers.

[0124] Methods according to some aspects of the present invention may include determining the binding of an oligonucleotide probe to a nucleic acid (e.g., genomic DNA, RNA, or cDNA) obtained from a sample. The probe may contain a nucleotide sequence that specifically binds to a nucleic acid sequence containing one or more mutations or polymorphisms, and may not specifically bind to nucleic acid sequences that do not contain one or more mutations or polymorphisms, or vice versa.

[0125] Oligonucleotide probes can contain labels, and probe binding can be determined by detecting the presence of the labels.

[0126] Methods may include hybridization of one or more (e.g., two) oligonucleotide probes or primers with a target nucleic acid. When the nucleic acid is double-stranded DNA, it is typically denatured to produce single-stranded DNA prior to hybridization. Hybridization may be part of a PCR procedure or as part of a probe procedure that does not involve PCR. An exemplary procedure is a combination of PCR and low-tightness hybridization.

[0127] The binding of a probe to a target nucleic acid (e.g., DNA) can be measured using any of a variety of techniques known to those skilled in the art. For example, the probe can be labeled with radioactivity, fluorescence, or enzymes. Other methods that do not use probe labeling include restriction fragment length polymorphism (RFLP) detection, PCR amplification, RNase digestion, and allele-specific oligonucleotide detection. Detection can be performed using standard Southern blotting techniques. For example, DNA can be extracted from cells and digested with different restriction endonucleases. Restriction fragments are then separated by agarose gel electrophoresis, subsequently denatured, and transferred to a nitrocellulose filter membrane. The labeled probe can hybridize with the DNA fragment on the filter membrane, and binding can be measured.

[0128] Taking into account factors such as oligonucleotide length and base composition, temperature, those skilled in the art can readily employ appropriate conditions with the stringency required for selective hybridization.

[0129] Suitable selective hybridization conditions for oligonucleotides of 17 to 30 bases include overnight hybridization in 6X SSC at 42°C, followed by washing in 6X SSC at progressively increasing temperatures from 42°C to 65°C.

[0130] Other suitable conditions and protocols are described in Molecular Cloning: a Laboratory Manual: 3rd edition, Sambrook & Russell (2001), Cold Spring Harbor Laboratory Press, NY, and Current Protocols in Molecular Biology, Ausubel et al. eds., John Wiley & Sons (1992).

[0131] Cancer is characterized by the abnormal proliferation of malignant cancer cells relative to normal cells and can include leukemia (e.g., AML, CML, ALL, and CLL), lymphoma (e.g., Hodgkin's lymphoma, non-Hodgkin's lymphoma, and multiple myeloma), and solid cancers such as sarcoma; skin cancer; melanoma; bladder cancer; brain cancer, such as glioblastoma, including pediatric glioblastoma; breast cancer; uterine cancer; oral cancer; ovarian cancer; prostate cancer; lung cancer, such as lung adenocarcinoma and squamous cell carcinoma; colorectal cancer; cervical cancer; liver cancer; head and neck cancer; esophageal cancer; pancreatic cancer; kidney cancer, such as clear cell renal cell carcinoma; gastric cancer; testicular cancer; gallbladder and bile duct cancer; thyroid cancer; thymic cancer; bone cancer; and brain cancer. Cancer can be familial or incidental. SET2D-deficient cancers suitable for the treatments described herein can be any of these types of cancer lacking SET2D expression or activity.

[0132] Other aspects of the invention relate to identifying individuals with cancer suitable for treatment with FANC antagonists, such as (a) FANC inhibitors, (b) FANC degraders, (c) FANC-inhibiting nucleic acids, (d) FANC-targeting nucleases, or (e) nucleic acids encoding FANC-inhibiting or targetable nucleases. For example, the methods described herein can be used to assess individuals with cancer to determine whether treatment with a FANC antagonist would likely be beneficial to the individual, i.e., whether the individual is suitable for treatment by the methods of the first aspect of the invention. Methods for predicting, measuring, or assessing the response of cancer in an individual to a FANC antagonist that reduces FANC protein expression or activity may include measuring the presence of one or more SET2D-deficient cancer cells in a cancer cell sample from the individual, the presence of one or more SET2D cancer cells in the sample indicating that the cancer has responded to the FANC antagonist.

[0133] Individuals with cancers identified as responsive to FANC antagonists can be treated as described herein, for example using the method of the first aspect of the invention.

[0134] Individuals suitable for treatment with FANC antagonists (such as (a) FANC inhibitors, (b) FANC degraders, (c) FANC-inhibiting nucleic acids, (d) FANC-targeting nucleases, or (e) nucleic acids encoding FANC-inhibiting nucleic acids or target nucleases as described herein) may be mammals, such as rodents (e.g., guinea pigs, hamsters, rats, mice), murines (e.g., mice), canines (e.g., dogs), felines (e.g., cats), equines (e.g., horses), primates, apes (e.g., monkeys or apes), monkeys (e.g., marmosets, baboons), apes (e.g., gorillas, chimpanzees, orangutans, gibbons), or humans.

[0135] In some preferred embodiments, the individual is a human. In other preferred embodiments, non-human mammals may be used, particularly mammals commonly used as models to validate the efficacy of treatments in humans (e.g., mice, primates, pigs, dogs, or rabbits).

[0136] In some implementations, individuals may have minimal residual disease (MRD) after initial cancer treatment.

[0137] The term “treatment” as used in this article, in the context of treating a disease, generally refers to treatments and therapies that achieve some desired therapeutic effect, such as inhibiting the progression of the disease, including reducing the rate of progression, stopping the rate of progression, improving the condition, and curing the disease.

[0138] Treatment can be any treatment and therapy that achieves some desired therapeutic effect in humans or animals (e.g., veterinary applications), such as inhibiting or delaying the progression of a disease, including reducing the rate of progression, stopping the rate of progression, improving the condition, curing or alleviating the condition (partially or completely), preventing, delaying, alleviating or stopping one or more symptoms and / or signs of the disease, or prolonging the life of a subject or patient beyond the life expected in the absence of treatment.

[0139] This also includes treatments as a preventative measure (i.e., prevention). For example, individuals susceptible to cancer development or recurrence, or at risk of developing or recurring cancer, can be treated as described herein. Such treatments can prevent or delay the development or recurrence of cancer in an individual.

[0140] Specifically, treatment may include inhibiting cancer growth and / or inhibiting cancer metastasis, wherein inhibiting cancer growth includes complete cancer remission. Cancer growth generally refers to any of a variety of indicators that indicate a change within cancer towards a more malignant form. Therefore, indicators used to measure inhibiting cancer growth include reduced cancer cell survival, reduction in tumor volume or morphology (e.g., determined using computed tomography (CT), ultrasound, or other imaging methods), delayed tumor growth, disruption of the tumor vascular system, improved performance in delayed-onset allergic skin tests, increased activity of cytolytic cancer cells, and reduced levels of tumor-specific antigens.

[0141] The reduced expression or activity of FANC proteins shown in this article has a strong and specific effect on SETD2-deficient cancer cells. Therefore, in some preferred embodiments, FANC antagonists as described herein (such as (a) FANC inhibitors, (b) FANC degraders, (c) FANC-inhibiting nucleic acids, (d) FANC-targeting nucleases, or (e) nucleic acids encoding FANC-inhibiting nucleic acids or targeting nucleases) can be administered to an individual without other concomitant cancer therapies (e.g., cytotoxic chemotherapy or radiotherapy), i.e., FANC antagonists can be administered alone.

[0142] In other embodiments, FANC antagonists as described herein (such as (a) FANC inhibitors, (b) FANC degraders, (c) FANC-inhibiting nucleic acids, (d) FANC-targeting nucleases, or (e) nucleic acids encoding FANC-inhibiting nucleic acids or targeting nucleases) may be administered in combination with one or more other therapies (e.g., cytotoxic chemotherapy or radiotherapy). This may be useful, for example, in treating cancers that include both SETD2-deficient and SETD2-positive cancer cells or cancers with an uncertain SETD2 status.

[0143] When a FANC antagonist is used in combination with another therapeutic agent, the compound may be administered sequentially or simultaneously via any convenient route. When a FANC antagonist is used in combination with other active therapeutic agents targeting the same disease, the dosage of each agent in the combination may differ from the dosage when the FANC antagonist is used alone. Appropriate dosages will be readily understood by those skilled in the art.

[0144] Administration of FANC antagonists as described herein (e.g., (a) FANC inhibitors, (b) FANC degraders, (c) FANC-inhibiting nucleic acids, (d) FANC-targeting nucleases, or (e) nucleic acids encoding FANC-inhibiting or targetable nucleases) can be achieved continuously or intermittently (e.g., at appropriate intervals) with a single dose throughout the treatment process. Methods for determining the most effective administration method and dosage are well known to those skilled in the art and will vary depending on the formulation used for treatment, the purpose of treatment, the target cells of treatment, and the patient being treated. Single or multiple administrations can be performed at dose levels and in a manner chosen by the treating physician.

[0145] Other aspects and embodiments of the invention provide for aspects and embodiments in which the term “comprising” is replaced with the term “consisting of”, and aspects and embodiments in which the term “comprising” is replaced with the term “substantially constitutes”.

[0146] It should be understood that, unless the context otherwise requires, this application discloses all combinations of any of the foregoing aspects and embodiments. Similarly, unless the context otherwise requires, this application discloses all combinations of preferred and / or optional features, or features that may be implemented alone or in conjunction with any other aspect.

[0147] Upon reading this disclosure, modifications to the above embodiments, further embodiments, and modifications thereof will be apparent to those skilled in the art, and therefore, these are all within the scope of this invention.

[0148] All documents and sequence database entries mentioned in this specification are incorporated herein by reference in their entirety for all purposes.

[0149] When used herein, “and / or” should be considered as a specific disclosure of each of the two specified features or components, either together or apart from the other. For example, “A and / or B” should be considered as a specific disclosure of each of (i) A, (ii) B, and (iii) A and B, as if each were stated separately herein.

[0150] Other aspects and embodiments of the invention provide for aspects and embodiments in which the term “comprising” as described above is replaced with the term “consisting of”, and aspects and embodiments in which the term “comprising” as described above is replaced with “substantially constitutes”.

[0151] As used in this article, the term "downstream" refers to the 5' to 3' direction of the nucleic acid described herein, and the term "upstream" refers to the 3' to 5' direction of the nucleic acid described herein.

[0152] Unless the context otherwise requires, the nucleotide sequences listed herein include DNA molecules having the specified sequences and RNA molecules having the specified sequences, wherein U is replaced with T.

[0153] It should be understood that, unless the context otherwise requires, this application discloses all combinations of any aspects and embodiments described above. Similarly, this application discloses all combinations of preferred and / or optional features, or features that may be implemented alone or in conjunction with any other aspect.

[0154] Upon reading this disclosure, modifications to the above embodiments, further embodiments, and modifications thereof will be apparent to those skilled in the art, and therefore, these are all within the scope of this invention.

[0155] All documents and sequence database entries mentioned in this specification are incorporated herein by reference in their entirety for all purposes.

[0156] When used herein, “and / or” should be considered as a specific disclosure of each of the two specified features or components, either together or apart from the other. For example, “A and / or B” should be considered as a specific disclosure of each of (i) A, (ii) B, and (iii) A and B, as if each were stated separately herein.

[0157] experiment

[0158] Simultaneous loss of FANCM and SET2D causes cancer cell death

[0159] SET domain-containing protein 2 (SETD2) is a histone methyltransferase that is frequently mutated in several types of cancer. The inventors propose testing the effect of gene excision FANCM on the survival of SETD2-deficient cancer cells.

[0160] Wild-type (WT) and CRISPR / Cas9 SETD2-knockout (KO) clear cell renal cell carcinoma (Caki2 cell line) were transfected with control (Ctrl) or FANCM siRNA. After 6 days of culture, transfection of SETD2-KOCaki2 cells with exhausted FANCM using siRNA showed a significant decrease in cell culture density, indicating increased cell death in these cells. Figure 1 ).

[0161] To test whether the simultaneous loss of FANCM and SET2D led to increased cell death, WT and CRISPR / Cas9 SETD2-(KO) clear cell renal cell carcinoma (786-O cell line) were transfected with either control (Ctrl) or FANCM siRNA. As early as 3 days post-knockout, SETD2-KO 786-O cells transfected with siRNA to specifically deplete FANCM showed a significant loss of viability, as revealed by increased PI staining levels detected by flow cytometry (Figure 2). At 6 days post-knockout, a further increase in cell-specific death was observed in SETD2-KO 786-O cells transfected with siRNA to specifically deplete FANCM (Figure 3).

[0162] Simultaneous loss of FANCD2 and SET2D causes cancer cell death

[0163] To test whether the simultaneous loss of FANCD2 and SET2D led to increased cell death, WT (ACHN and Caki-1 cell lines) and SETD2-deficient cells (RCC-AB, RCC-ER, and RCC-MF cell lines) were transfected with either control (Ctrl) or FANCD2 siRNA. As early as 3 days after knockout, SETD2-mutant RCC-AB, RCC-ER, and RCC-MF cell lines specifically depleted of FANCD2 showed significant loss of viability when transfected with siRNA, as indicated by increased PI staining levels detected by flow cytometry. Figure 4A Six days after knockout, a further increase in cell-specific death was observed in SETD2-mutant RCC-AB, RCC-ER, and RCC-MF cell lines transfected with siRNA to specifically deplete FANCD2. Figure 4B ).

[0164] These results indicate that the simultaneous loss of (i) FANCM or FANCD2 and (ii) SETD2 produces a synthetic lethal phenotype that drives cancer cell death. This synthetic lethal phenotype could be used as a monotherapy for cancers with somatic loss of SETD2, or administered in addition to chemotherapy and radiotherapy for the treatment of aggressive or recurrent cancers. A promising approach for treating metastatic cancers for which there are few treatment strategies is also proposed.

[0165] sequence

[0166] SEQ ID NO: 1

[0167] SEQ ID NO: 2

[0168] GGATGTTTAGGAGAACAAAGAGCTA

[0169] SEQ ID NO: 3 (siFa)

[0170] CCCATCAAATGAAGATATGCAGAAT

[0171] SEQ ID NO: 4 (siFb)

[0172] SEQ ID NO:5

[0173] SEQ ID NO:6

[0174] SEQ ID NO: 7

[0175] SEQ ID NO:8

[0176] SEQ ID NO:9

Claims

1. Methods for treating cancer in individuals in need, including: Reduce the expression or activity of Fanconi anemia complement (FANC) protein in the individuals, wherein the cancer is a SETD2-deficient cancer.

2. The method according to claim 1, wherein the FANC protein is FANCM, FANCD2, or FANCI protein.

3. The method of claim 1 or 2, wherein FANC expression or activity is reduced by administering a FANC antagonist to the individual.

4. The method of claim 3, wherein the FANC antagonist is a FANCM antagonist.

5. The method of claim 4, wherein the FANCM antagonist reduces FANCM expression.

6. The method of claim 5, wherein the FANCM antagonist is an inhibitory nucleic acid.

7. The method according to claim 6, wherein the inhibitory nucleic acid is siRNA or shRNA.

8. The method according to claim 6, wherein the inhibitory nucleic acid is an antisense oligonucleotide.

9. The method of claim 4, wherein the FANCM antagonist is a target nuclease that reduces FANCM expression.

10. The method of claim 9, wherein the targeting nuclease is a CRISPR-associated nuclease, and the CRISPR-associated nuclease is administered in conjunction with a guide RNA that recognizes a target sequence within the FANCM gene.

11. The method of claim 4, wherein the FANCM antagonist reduces the activity of FANCM.

12. The method of claim 11, wherein the FANCM antagonist is a FANCM inhibitor.

13. The method of claim 12, wherein the FANCM inhibitor is a small chemical molecule, optionally wherein the small chemical molecule is a non-polymeric organic compound.

14. The method according to claim 11 or 12, wherein the FANCM antagonist is an antibody, antibody fragment, antibody derivative, or non-immunoglobulin-binding molecule that specifically binds to FANCM.

15. The method according to any one of claims 12 to 14, wherein the antagonist reduces the ATP-dependent DNA helicase / transloase activity of FANCM, optionally wherein the antagonist binds to the DEAH helicase domain.

16. The method of claim 3, wherein the FANC antagonist is a FANCD2 antagonist.

17. The method of claim 16, wherein the FANCD2 antagonist reduces the expression of FANCD2.

18. The method of claim 17, wherein the FANCD2 antagonist is an inhibitory nucleic acid.

19. The method of claim 18, wherein the inhibitory nucleic acid is siRNA or shRNA.

20. The method of claim 18, wherein the inhibitory nucleic acid is an antisense oligonucleotide.

21. The method of claim 16, wherein the FANCD2 antagonist is a target nuclease that reduces FANCM expression.

22. The method of claim 21, wherein the targeting nuclease is a CRISPR-associated nuclease, and the CRISPR-associated nuclease is administered in conjunction with a guide RNA that recognizes a target sequence within the FANCD2 gene.

23. The method of claim 16, wherein the FANCD2 antagonist reduces the activity of FANCD2.

24. The method of claim 23, wherein the FANCD2 antagonist is a FANCD2 inhibitor.

25. The method of claim 24, wherein the FANCD2 inhibitor is a small chemical molecule, optionally wherein the small chemical molecule is a non-polymeric organic compound.

26. The method of claim 23 or 24, wherein the FANCD2 antagonist is an antibody, antibody fragment, antibody derivative, or non-immunoglobulin-binding molecule that specifically binds to FANCD2.

27. The method of claim 3, wherein the FANC antagonist is a FANCI antagonist.

28. The method of claim 27, wherein the FANCI antagonist reduces FANCI expression.

29. The method of claim 28, wherein the FANCI antagonist is an inhibitory nucleic acid.

30. The method of claim 29, wherein the inhibitory nucleic acid is siRNA or shRNA.

31. The method of claim 29, wherein the inhibitory nucleic acid is an antisense oligonucleotide.

32. The method of claim 27, wherein the FANCI antagonist is a target nuclease that reduces FANCI expression.

33. The method of claim 32, wherein the targeting nuclease is a CRISPR-associated nuclease, and the CRISPR-associated nuclease is administered in conjunction with a guide RNA that recognizes a target sequence within the FANCI gene.

34. The method of claim 33, wherein the FANCI antagonist reduces the activity of FANCI.

35. The method of claim 34, wherein the FANCI antagonist is a FANCI inhibitor.

36. The method of claim 35, wherein the FANCI inhibitor is a small chemical molecule, optionally wherein the small chemical molecule is a non-polymeric organic compound.

37. The method of claim 34 or 35, wherein the FANCI antagonist is an antibody, antibody fragment, antibody derivative, or non-immunoglobulin-binding molecule that specifically binds to FANCI.

38. The method according to any one of the preceding claims, wherein the SETD2-deficient cancer is selected from: leukemias such as AML, CML, ALL, and CLL; lymphomas such as Hodgkin lymphoma, non-Hodgkin lymphoma, and multiple myeloma; and solid cancers such as sarcoma; skin cancer; melanoma, bladder cancer; brain Cancers such as glioblastoma multiforme, including pediatric glioblastoma multiforme; breast cancer; uterine cancer; oral cancer; ovarian cancer; prostate cancer; Lung cancer, such as lung adenocarcinoma and squamous cell carcinoma; colorectal cancer; cervical cancer; liver cancer; head and neck cancer; esophageal cancer; pancreatic cancer; kidney cancer, such as clear cell renal cell carcinoma; stomach cancer; testicular cancer; gallbladder and bile duct cancer; thyroid cancer; thymic cancer; bone cancer; and brain cancer.

39. The method according to any one of the preceding claims, wherein the SETD2-deficient cancer comprises one or more cancer cells with SETD2 mutation or loss of SETD2.

40. The method according to any one of the preceding claims, the method further comprising the step of identifying an individual suffering from SETD2-deficient cancer.

41. The method according to any one of the preceding claims, the method further comprising administering a chemotherapeutic agent to the individual.

42. FANC antagonists used in methods for treating SETD2-deficient cancers.

43. The FANC antagonist of claim 42, wherein the FANC antagonist is a FANCM antagonist, a FANCD2 antagonist, or a FANCI antagonist.

44. The FANC antagonist applied according to claim 42 or 43, wherein the method is a treatment method according to any one of claims 1 to 41.

45. Use of FANC antagonists in the preparation of medicaments for the treatment of SETD2-deficient cancers.

46. ​​The use according to claim 45, wherein the FANC antagonist is a FANCM antagonist, a FANCD2 antagonist, or a FANCI antagonist.

47. The use according to claim 46, wherein the treatment is a treatment method according to any one of claims 1 to 41.

48. A method for screening compounds that induce cell death in SETD2-deficient cancer cells, comprising determining the binding of a test compound to the FANC protein, wherein binding to the FANC protein indicates that the compound induces cell death in SETD2-deficient cells.

49. A method for screening compounds that induce cell death in SETD2-deficient cancer cells, comprising determining the effect of a test compound on the expression or activity of the FANC protein, wherein a decrease in the expression or activity of the FANC protein indicates that the compound induces cell death in SETD2-deficient cancer cells.

50. The method according to claim 48 or 49, wherein the FANC protein is a FANCM protein, a FANCD2 protein, or a FANCI protein.

51. The method according to any one of claims 48 to 50, comprising identifying the test compound as a compound that reduces the expression or activity of the FANC protein.

52. The method of claim 51, further comprising separating or purifying the identified compound.

53. A method for determining the response of cancer in an individual to treatment with a FANC antagonist, comprising determining the presence of one or more SETD2-deficient cells in a sample obtained from the individual, the presence of one or more SETD2-deficient cancer cells in the sample indicating that the cancer is responsive to treatment with the FANC antagonist.

54. A method for selecting an individual with SETD2-deficient cancer to be treated with a FANC antagonist, the method comprising: Cancer cells obtained from individuals were identified as lacking SETD2 relative to normal cells.

55. The method according to claim 53 or 54, wherein the FANC antagonist is a FANCM antagonist, a FANCD2 antagonist, or a FANCI antagonist.

56. The method according to any one of claims 53 to 55, further comprising: Provide FANC inhibitors suitable for administration to the individuals.

Images