A molecular marker for rapidly identifying resistance to powdery mildew in melon, method and application

The InDel marker MM365 was used to rapidly identify powdery mildew resistance in melons, solving the problems of time-consuming, labor-intensive, and environmentally dependent methods in traditional methods. This enabled efficient and accurate breeding screening, promoting the breeding of disease-resistant melon varieties.

CN120905428BActive Publication Date: 2026-06-16SHANDONG AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANDONG AGRICULTURAL UNIVERSITY
Filing Date
2025-08-13
Publication Date
2026-06-16

AI Technical Summary

Technical Problem

Traditional methods for identifying powdery mildew resistance in melons are time-consuming, labor-intensive, costly, highly susceptible to environmental influences, and have poor result stability, making it difficult to efficiently screen for resistant varieties.

Method used

An InDel marker, MM365, located at 22.56 Mb on chromosome 12 of melon was developed. Nucleotide sequence differences in plants were identified by PCR amplification and electrophoresis, enabling rapid identification of powdery mildew resistance in melons.

🎯Benefits of technology

This method enables efficient and accurate disease resistance identification during the seedling stage of melons, yielding stable and reliable results unaffected by the environment. It simplifies the breeding process and shortens the breeding cycle and costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905428B_ABST
    Figure CN120905428B_ABST
Patent Text Reader

Abstract

The application discloses a kind of fast identification of melon powdery mildew resistance molecular marker, method and application, belong to powdery mildew resistance identification technical field.The application first finds that InDel marker MM365 is closely linked with the powdery mildew resistance of melon, InDel marker MM365 is located at the 22.56Mb of the 12th chromosome of DHL92 melon genome V4.0 version, nucleotide sequence is as shown in SEQ ID NO.1;It also provides the upstream and downstream primer sequence of identifying InDel marker MM365 and identification method;Can be identified at melon seedling period, without being inoculated with pathogenic bacteria, detection result is not influenced by plant growth period, external environmental condition change, and the result is stable and reliable;The molecular marker provided and closely linked with the powdery mildew resistance of melon can be used for melon powdery mildew resistance variety breeding, and it has important significance for simplifying breeding process, shortening identification period and breeding period, reducing breeding cost, and promoting melon powdery mildew breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of powdery mildew resistance identification technology, and in particular to a molecular marker, method, and application for rapid identification of powdery mildew resistance in melons. Background Technology

[0002] Cantaloupe (Cucumis melo L.) is a plant belonging to the Cucurbitaceae family and the Cucumis genus. It is also known as white cantaloupe, honeydew melon, and fragrant melon. The flesh is white, yellow, or green, crisp, and sweet. It contains a large amount of carbohydrates, citric acid, carotene, B vitamins, and vitamin C. It also has the effects of relieving summer heat and promoting urination, and improving headaches caused by damp heat. It is a popular summer fruit.

[0003] Powdery mildew of melons, commonly known as white mold or powdery mildew, is a fungal disease caused by *Sphaerotheca cucurbitae* (Jacz.) ZYZhao and *Erysiphe Cucurbitacearum* Zheng & Chen (Cucurbitaceae). It is one of the major diseases in melon production, with a high incidence rate, typically between 30% and 100%. The disease primarily affects leaves, petioles, and stems. Initially, small, nearly circular, white, star-shaped powdery spots appear on the upper surface of the leaves. As the disease spreads, these spots expand into indistinct, confluent patches of white powder, eventually covering the entire plant. Infected plants develop yellowing, brittle leaves, and may even die. The conidia of the pathogen can also spread through air currents, leading to widespread infection and severely impacting early fruit development and growth, resulting in a significant decrease in melon yield and quality.

[0004] Disease-resistant variety breeding is an important means to reduce pesticide use and production costs, increase melon yield and quality, reduce environmental pollution, enhance agricultural sustainability, and ensure food security. Traditional disease-resistant breeding methods rely on pathogen inoculation in the field or greenhouse to induce disease and long-term phenotypic observation. This process is not only time-consuming and labor-intensive, but the identification results are also easily affected by environmental conditions and other factors, resulting in low screening efficiency and a long breeding cycle.

[0005] Marker-assisted selection (MAS) technology utilizes DNA molecular markers tightly linked to target traits to accurately predict genotypes at any growth stage of a plant (especially the seedling stage), offering advantages such as high efficiency, accuracy, and stability. Therefore, developing a molecular marker tightly linked to a powdery mildew resistance gene in melons and capable of stable application is crucial for improving breeding efficiency and accelerating the development of disease-resistant varieties. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker, method, and application for rapid identification of powdery mildew resistance in melons, in order to overcome the shortcomings of existing technologies such as long identification cycle, high cost, time-consuming and labor-intensive process, great susceptibility to environmental influences, and poor result stability.

[0007] To achieve the above objectives, this invention provides a molecular marker for rapid identification of powdery mildew resistance in melons. The molecular marker is the InDel marker MM365, with the nucleotide sequence shown in SEQ ID NO.1, located on chromosome 12 at 22.56 Mb in the DHL92 melon genome V4.0 version (http: / / cucurbitgenomics.org / v2 / organism / 23).

[0008] Preferably, the disease-resistant plants have more nucleotide sequences than the disease-susceptible plants, as shown in SEQ ID NO.1.

[0009] Preferably, the upstream primer sequence for amplifying the InDel-labeled MM365 is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3.

[0010] A rapid method for identifying powdery mildew resistance in melons, utilizing the aforementioned molecular marker for rapid identification of powdery mildew resistance in melons, comprises the following steps:

[0011] Using the genomic DNA of the plant to be identified as a template, a reaction system was prepared with upstream and downstream primers for amplifying the InDel marker MM365. PCR amplification was performed, and the amplification products were subjected to electrophoresis. Plants with an electrophoretic band of 228 bp were considered resistant, while plants with an electrophoretic band of 218 bp were considered susceptible.

[0012] Preferably, the reaction system is a Taq enzyme reaction system or other reaction system for amplifying the target fragment.

[0013] Preferably, the PCR amplification program is as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 35 cycles of denaturation, annealing and extension; and finally 72℃ extension for 5 min.

[0014] Application of a molecular marker for rapid identification of powdery mildew resistance in melons as described above in the breeding of powdery mildew resistant varieties of melons.

[0015] Application of upstream and downstream primers for amplifying the InDel marker MM365 as described above in the breeding of powdery mildew resistant varieties of melon.

[0016] Application of a rapid method for identifying powdery mildew resistance in melons as described above in the breeding of powdery mildew-resistant melon varieties.

[0017] Therefore, the present invention provides a molecular marker, method, and application for rapid identification of powdery mildew resistance in melons, the specific technical effects of which are as follows:

[0018] (1) This invention is the first to discover that the InDel marker MM365 is closely linked to the powdery mildew resistance of melon. The InDel marker MM365 is located on chromosome 12, 22.56 Mb, of the DHL92 melon genome V4.0 (http: / / cucurbitgenomics.org / v2 / organism / 23), and its nucleotide sequence is shown in SEQ ID NO.1.

[0019] (2) The present invention also provides upstream and downstream primer sequences and identification methods for identifying InDel marker MM365; identification can be carried out during the seedling stage of melon without the need for pathogen inoculation, and the detection results are not affected by the plant growth period or changes in external environmental conditions, and the results are stable and reliable.

[0020] (3) There are currently no commercial melon varieties resistant to powdery mildew. The molecular markers provided by this invention that are closely linked to powdery mildew resistance in melons can be used for the breeding of powdery mildew resistant varieties of melons. This is of great significance for simplifying the breeding process, shortening the identification cycle and breeding years, reducing breeding costs, and promoting the breeding process of powdery mildew resistant melons.

[0021] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0022] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 This is a flowchart of constructing the RIL population in Embodiment 2 of the present invention;

[0024] Figure 2 This is a picture of the disease-resistant plant 'SN-1' in Example 2 of this invention;

[0025] Figure 3 This is a picture of the 'Honeysuckle' plant infected with the disease in Embodiment 2 of the present invention;

[0026] Figure 4This is the PAGE electrophoresis result in Embodiment 2 of the present invention; where M is the marker, lane 1 is '1-2', lane 2 is '1-4', lane 3 is '1-5', lane 4 is '1-7', lane 5 is '2-4', lane 6 is '2-5', lane 7 is '3-5', lane 8 is '3-7', lane 9 is '3-6', lane 10 is '3-9', lane 11 is '3-10', lane 12 is '4-3', lane 13 is '4-4', lane 14 is '4-5', lane 15 is '4-7', and lane 16 is '...'. Lanes 4-16, 17-5, 18-5, 19-5, 20-5, 21-6, 22-6, 23-7, 24-7, 25-7, 26-7, 27-8, 28-8, 29-8, 30-8, 31-9, 32-9, 33-16, 24-9, 25-9, 26-7, 27-8, 28-8, 29-8, 20-9, 21-9, 22-9, 23-9, 24-7, 25-7, 26-7, 27-8, 28-8, 29-8, 20-8, 21-9, 22-9, 23-9, 24-7, 25-7, 26-7, 27-8, 28-8, 29-8, 20-8, 21-9, 22-9, 23-9, 24-8 ...8-8, 29-8, 20-8, 28-8, 29-8, 20-8, 28-8, 29-8, 20-8, 28-8, 29-8, 20-8, 28-8, 29-8, 20-8, 28-8, 29-8, 20-8, 28-8, 29- Lanes 11-5, 34-6, 35-9, 36-11, 37-21, 38-4, 39-5, 40-9, 41-7, 42-2, 43-6, 44-8, 45-5, 46-5, 47-7, 48-9, 49-5, 49-6, 40-9, 41-7, 42-2, 43-6, 44-8, 45-5, 46-5, 47-7, 48-9, 49-5, 49-6, 49-9 ... Lane 29-9, Lane 50-11, Lane 51-12, Lane 52-4, Lane 53-7, Lane 54-1, Lane 55-14, Lane 56-4, Lane 57-8, Lane 58-4, Lane 59-8, Lane 60-7, Lane 61-9, Lane 62-12, Lane 63-1, Lane 64-YJM;

[0027] Figure 5These are the inoculation test results in Example 3 of the present invention; where 1 is '1-5', 2 is '1-7', 3 is '3-5', 4 is '3-7', 5 is '3-9', 6 is '3-10', 7 is '4-5', 8 is '4-7', 9 is '4-16', 10 is '5-1', 11 is '5-13', 12 is '6-3', 13 is '6-8', 14 is '7-5', 15 is '7-10', and 16 is '...'. 8-11', 17 is '8-13', 18 is '11-5', 19 is '11-6', 20 is '21-5', 21 is '23-4', 22 is '23-9', 23 is '26-2', 24 is '27-6', 25 is '27-8', 26 is '28-2', 27 is '28-5', 28 is '28-9', 29 is '29-9', 30 is '29-11', 31 is '30' -4', 32 is '31-1', 33 is '32-4', 34 is '32-8', 35 is '33-4', 36 is '33-8', 37 is '33-12', 38 is '1-2', 39 is '1-4', 40 is '2-4', 41 is '2-5', 42 is '3-6', 43 is '4-3', 44 is '4-4', 45 is '5-7', 46 is '5-12', 47 is '7-' 3', 48 is '7-4', ​​49 is '8-2', 50 is '8-17', 51 is '9-6', 52 is '9-11', 53 is '11-9', 54 is '11-11', 55 is '23-5', 56 is '24-7', 57 is '28-7', 58 is '29-12', 59 is '30-7', 60 is '31-14', 61 is '33-7', 62 is '33-9';

[0028] Figure 6This is the field powdery mildew phenotype in Example 4 of the present invention; wherein 1 is '1-2', 2 is '1-4', 3 is '1-5', 4 is '1-7', 5 is '2-4', 6 is '2-5', 7 is '3-5', 8 is '3-7', 9 is '3-6', 10 is '3-9', 11 is '3-10', 12 is '4-3', 13 is '4-4', 14 is '4-5', 15 is '4-7', and 16 is '4-1'. 6', 17 is '5-1', 18 is '5-7', 19 is '5-12', 20 is '5-13', 21 is '6-3', 22 is '6-8', 23 is '7-3', 24 is '7-4', ​​25 is '7-5', 26 is '7-10', 27 is '8-2', 28 is '8-11', 29 is '8-13', 30 is '8-17', 31 is '9-6', 32 is '9-11' 33 is '11-5', 34 is '11-6', 35 is '11-9', 36 is '11-11', 37 is '21-5', 38 is '23-4', 39 is '23-5', 40 is '23-9', 41 is '24-7', 42 is '26-2', 43 is '27-6', 44 is '27-8', 45 is '28-2', 46 is '28-5', 47 is '28-7', 4 8 is '28-9', 49 is '29-9', 50 is '29-11', 51 is '29-12', 52 is '30-4', 53 is '30-7', 54 is '31-1', 55 is '31-14', 56 is '32-4', 57 is '32-8', 58 is '33-4', 59 is '33-8', 60 is '33-7', 61 is '33-9', and 62 is '33-12'. Detailed Implementation

[0029] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0030] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0031] The instruments, equipment, reagents and materials used in the embodiments were all obtained through commercial means; the methods and steps not described in detail are all conventional techniques in the field.

[0032] Example 1

[0033] A rapid molecular marker for identifying powdery mildew resistance in melons, MM365, is an InDel marker located on chromosome 12 at 22.56 Mb in the DHL92 melon genome V4.0 (http: / / cucurbitgenomics.org / v2 / organism / 23). A nucleotide sequence with 10 bp more nucleotides is present in resistant plants than in susceptible plants (sequence shown in SEQ ID NO.1). The upstream primer sequence for amplifying the MM365 marker is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3.

[0034] SEQ ID NO.1:GAGAAAATGA

[0035] SEQ ID NO.2:CCTGGGATACTTGGTTTG

[0036] SEQ ID NO.3:AAGACTTTACTGCCTTCATA

[0037] Example 2

[0038] The constructed RIL population was used to identify powdery mildew resistance, as detailed below:

[0039] (1) Construct the RIL community, the flowchart is as follows: Figure 1 As shown, the disease-resistant plant 'SN-1' was used as the female parent (plant photo as shown). Figure 2 As shown, the plant is a germplasm resource that has been preserved in the inventor's laboratory for a long time. For details, please refer to Wang Shuoshuo's doctoral dissertation at Shandong Agricultural University in 2022, titled "Study on the Physiological and Molecular Mechanism of Powdery Mildew Resistance in Melon 'SN-1'". The infected plant 'Yangjiaomi' was used as the male parent (plant photo as shown). Figure 3 (As shown) The F1 generation seeds were obtained by hybridization. The F1 generation seeds were then self-pollinated to obtain the F2 generation seeds. The single-seed method was then used to continuously self-pollinate to the F6 generation, resulting in a RIL population containing 62 lines.

[0040] (2) Take approximately 1 cm from each strain of the RIL population. 2Leaves of various sizes were placed in a clean, sterilized, and cooled-to-room-room-temperature dry mortar, liquid nitrogen was added, and the mixture was thoroughly ground. The powder was then placed into 2 mL centrifuge tubes. DNA was extracted from each line of the RIL population using the CTAB method. The dried DNA was dissolved in 100 μL of sterile ddH2O. The concentration and purity of the obtained genomic solutions were tested using Nanodrop 2000, and the results are shown in Table 1. Based on the test results in Table 1, working solutions for 62 lineage genomic solutions were calculated and prepared using the qualified genomic DNA solutions, achieving a genomic concentration of 100 ng / μL. Genomic DNA from unqualified lineages was re-extracted using the same method until the purity and concentration met the requirements.

[0041] Table 162 DNA solution information for strains

[0042]

[0043]

[0044]

[0045] (3) Send the sequence information of SEQ ID NO.2 and SEQ ID NO.3 to the company to synthesize primers for amplifying MM365. Dissolve the received primers into a 10mM stock solution according to the attached instructions. Then, take a certain amount of the stock solution to prepare a 10μM / L working solution. Store the primer stock solution at -80℃ and the working solution at 4℃.

[0046] (4) Using the genomic DNA working solution of the 62 strains obtained in (2) as a template, and the primer working solution prepared in (3), the reaction system was prepared according to the instructions attached to the Taq enzyme: 5 μL of 2×Taq PCR MasterMix, 0.25 μL each of 10 μM / L upstream and downstream primers, 3.5 μL of ddH2O, and 1 μL of genomic working solution. After mixing the reaction system, PCR amplification was performed. The amplification program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 35 cycles of denaturation, annealing and extension; and finally, 72℃ extension for 5 min.

[0047] (5) Perform PAGE electrophoresis on the PCR products, and the results are as follows: Figure 4As shown, the RIL strains are '1-5', '1-7', '3-5', '3-7', '3-9', '3-10', '4-5', '4-7', '4-16', '5-1', '5-13', '6-3', '6-8', '7-5', '7-10', '8-11', '8-13', '11-5', '11-6', '21-5', '23-4', '23-9', '26-2', '27-6', '27-8', '28-2', '28-5', '28-9', '29-9', '29-11', '30-4', '31-1', '32-4', '32-8', ' The marker polymorphisms of materials 33-4', 33-8', and 33-12' are consistent with those of the susceptible parent 'Yangjiaomi', indicating they are susceptible materials. The marker polymorphisms of materials 1-2', 1-4', 2-4', 2-5', 3-6', 4-3', 4-4', 5-7', 5-12', 7-3', 7-4', ​​8-2', 8-17', 9-6', 9-11', 11-9', 11-11', 23-5', 24-7', 28-7', 29-12', 30-7', 31-14', 33-7', and 33-9' are consistent with those of the resistant parent 'SN-1', indicating they are resistant materials.

[0048] Example 3

[0049] Powdery mildew resistance was identified in 62 strains of the RIL population through inoculation tests, as detailed below:

[0050] The experiment was conducted in the artificial plant cultivation laboratory of Shandong Agricultural University. Melon seeds were germinated in a 28℃ incubator and then sown in 50-cell deep-cell trays (peat moss:vermiculite:perlite = 1:1:1, v / v). After the cotyledons unfolded, the seedlings were irrigated with Hoglund nutrient solution. The environmental conditions in the artificial cultivation laboratory were: photoperiod of 16h / 8h, temperature of 26℃ / 23℃. When the melon seedlings reached the three-leaf stage, they were inoculated with powdery mildew. Using a prepared pathogen inoculation box (see the utility model patent application CN202420732719.3, entitled "A Crop Seedling Pathogen Inoculation Box"), the melon seedlings to be inoculated were placed under the inoculation box. Pathogen spores were evenly dispersed onto the seedlings through the nylon mesh of the inoculation box using a clean brush. The seedlings were allowed to stand for 5-10 minutes to allow the spores to settle completely, thus completing the inoculation. (Group Standard: Technical Specification for Inoculation of Powdery Mildew Pathogen in Melon T / SDAS1137—2025) The leaves were observed and identified on the 15th day after inoculation. Plants with white spots on the leaf surface were considered susceptible, while plants without white spots on the leaf surface were considered resistant.

[0051] Photo of the third true leaf 16 days after inoculation. Figure 5 As shown, among them, '1-2', '1-4', '2-4', '2-5', '3-6', '4-3', '4-4', '5-7', '5-12', '7-3', '7-4', ​​'8-2', '8-17', '9-6', '9-11', '11-9', '11-11', '23-5', '24-7', '28-7', '29-12', '30-7', '31-14', '33-7', and '33-9' have no white spots on their leaf surfaces and have been identified as powdery mildew-resistant plants; '1-5', '1-7', '3-5', '3-7', '3-9', '3-10', and '4-5'... The leaves of the following plants have obvious powdery mildew spots and have been identified as susceptible to powdery mildew. The results are consistent with those obtained using the molecular marker MM365 in Example 2.

[0052] Example 4

[0053] To more accurately identify the phenotype of the 62 RIL plants, the seeds of these 62 plants were cultivated and transplanted to the experimental base of Shandong Agricultural University the following year. During the later stages of fruiting, powdery mildew naturally occurred in the field. Photos of each plant are shown below. Figure 6As shown, plants '1-2', '1-4', '2-4', '2-5', '3-6', '4-3', '4-4', '5-7', '5-12', '7-3', '7-4', ​​'8-2', '8-17', '9-6', '9-11', '11-9', '11-11', '23-5', '24-7', '28-7', '29-12', '30-7', '31-14', '33-7', and '33-9' all had no white spots on the surface of their leaves, and were identified as powdery mildew-resistant plants; plants '1-5', '1-7', '3-5', '3-7', '3-9', '3-10', and '4-5' all had no white spots on the surface of their leaves, and were identified as powdery mildew-resistant plants. The leaves of plants ', '4-7', '4-16', '5-1', '5-13', '6-3', '6-8', '7-5', '7-10', '8-11', '8-13', '11-5', '11-6', '21-5', '23-4', '23-9', '26-2', '27-6', '27-8', '28-2', '28-5', '28-9', '29-9', '29-11', '30-4', '31-1', '32-4', '32-8', '33-4', '33-8', and '33-12' all showed obvious powdery mildew spots of varying degrees on their surface, and were identified as plants susceptible to powdery mildew.

[0054] The field identification results of the RIL population were consistent with the identification results of the molecular marker MM365 in Example 2 and the inoculation test in Example 3.

[0055] Therefore, this invention is the first to discover that the InDel marker MM365 is closely linked to powdery mildew resistance in melon. The InDel marker MM365 is located on chromosome 12 at 22.56 Mb in the DHL92 melon genome V4.0 version, accessible at http: / / cucurbitgenomics.org / v2 / organism / 23, and its nucleotide sequence is shown in SEQ ID NO.1. The invention also provides upstream and downstream primer sequences and identification methods for the InDel marker MM365. Identification can be performed during the melon seedling stage without pathogen inoculation, and the results are stable and reliable regardless of plant growth stage or changes in external environmental conditions. The provided molecular marker, closely linked to powdery mildew resistance in melon, can be used for breeding powdery mildew-resistant varieties of melon, which is of great significance for simplifying the breeding process, shortening the identification cycle and breeding time, reducing breeding costs, and promoting the breeding process for powdery mildew-resistant melons.

[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A method for rapidly identifying powdery mildew resistance in melons, characterized in that, The steps are as follows: Using the genomic DNA of the plant to be identified as a template, a reaction system was prepared with upstream and downstream primers for PCR amplification. The amplification products were then subjected to electrophoresis. Plants with an electrophoretic band of 228 bp were considered resistant, while plants with an electrophoretic band of 218 bp were considered susceptible. The upstream primer sequence is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.

3.

2. The method for rapidly identifying powdery mildew resistance in melons according to claim 1, characterized in that: The reaction system is a Taq enzyme reaction system or a reaction system for amplifying the target fragment.

3. The method for rapidly identifying powdery mildew resistance in melons according to claim 1, characterized in that: The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 35 cycles of denaturation, annealing and extension; and finally 72℃ extension for 5 min.

4. The application of the method for rapid identification of powdery mildew resistance in melons as described in any one of claims 1 to 3 in the breeding of powdery mildew resistant varieties of melons.