Pharmaceutical composition for treating brain injury

Abstract

The present invention provides an agent or the like useful in the treatment of brain injury caused by cerebrovascular disorders and traumatic brain injury. The present invention relates to a pharmaceutical composition or the like comprising a compound that blocks or inhibits the expression of the Zfp384 gene, a compound that blocks or inhibits the activity of ZFP384 protein, or the like.

Description

TECHNICAL FIELD

[0001] The present application relates to a pharmaceutical composition for treating brain injury caused by cerebrovascular disorder or traumatic brain injury. BACKGROUND

[0002] Stroke, which is one of brain injuries caused by cerebrovascular disorder, becomes a major cause of serious sequelae and bedriddenness in the world, and the number of patients is expected to increase with the aging society. There is still a lack of therapeutic method for stroke, and although the current situation continues, it is well known that improvement in neurological symptoms and life function prognosis can be expected through active rehabilitation about several months after onset. On the other hand, if the onset exceeds 6 months, significant improvement in neurological symptoms cannot be confirmed even through active rehabilitation, and the possibility of stable symptoms as sequelae increases. In this way, the repair window after stroke (for example, cerebral infarction, etc.) disappears with the passage of time (for example, Non-Patent Literature 1).

[0003] In recent years, with the advancement of single-cell RNA-seq analysis (transcriptome analysis) technology, various properties of glial cells constituting the brain such as microglia have attracted worldwide attention. Microglia is an immune cell that resides in the central nervous system and plays an important role in inflammation after brain injury, but gradually assumes a neurorestorative function of producing neurotrophic factors such as insulin-like growth factor 1 (IGF1) about 1 week after injury (for example, Non-Patent Literature 2). However, it is completely unclear how reparative microglia is induced (repair begins) in brain tissue and what fate (loss of repair ability) it will undergo. If this molecular mechanism can be elucidated, it will be possible to develop a groundbreaking brain function restorer that enhances the repair function based on microglia and enables the continuation (extension) and restart of the repair period.

[0004] PRIOR ART DOCUMENT

[0005] Non-Patent Literature 1: Levard, D. et al. Filling the gaps on stroke research: Focus on inflammation and immunity. Brain Behav Immun 91, 649-667 (2021).

[0006] Non-patent literature 2: Crotti, A. & Ransohoff, R. M. Microglial Physiology and Pathophysiology: Insights from Genome-wide Transcriptional Profiling. Immunity 44, 505-515 (2016). SUMMARY

[0007] Under such circumstances, development of a new drug or the like that can be used for the treatment of brain damage caused by cerebrovascular disorders, traumatic brain injury is desired.

[0008] The present application was completed in consideration of the above circumstances, and provides a pharmaceutical composition or the like shown below.

[0009] (1) A pharmaceutical composition comprising a compound that blocks or inhibits expression of a Zfp384 gene or a compound having a blocking or inhibiting activity against a ZFP384 protein, or a prodrug thereof, or a pharmacologically acceptable salt thereof, or a hydrate or solvate thereof.

[0010] (2) The pharmaceutical composition according to the above (1) for use in the treatment of brain damage caused by cerebrovascular disorders or traumatic brain injury.

[0011] (3) The pharmaceutical composition according to the above (2), wherein the cerebrovascular disorders are stroke, preferably cerebral infarction, cerebral hemorrhage, or subarachnoid hemorrhage.

[0012] (4) The pharmaceutical composition according to the above (2), wherein the treatment is recovery of neurological symptoms in brain damage, or continuation and / or restart of the recovery effect thereof.

[0013] (5) The pharmaceutical composition according to the above (1), wherein the compound that blocks or inhibits expression of a Zfp384 gene comprises a nucleic acid containing a sequence complementary to at least a part of a base sequence of the gene.

[0014] (6) The pharmaceutical composition according to the above (5), wherein the at least a part of a base sequence of the gene comprises at least a part of a base sequence encoding a DNA binding domain of a ZFP384 protein.

[0015] (7) The pharmaceutical composition according to the above (1), wherein the compound having a blocking or inhibiting activity against a ZFP384 protein is one or a combination of two or more selected from the group consisting of a decoy nucleic acid, a compound that can decompose the protein, and a compound that can induce decomposition of the protein.

[0016] (8) A therapeutic agent for cerebral injury caused by cerebrovascular disorder or traumatic brain injury, comprising a compound that blocks or suppresses the expression of the Zfp384 gene or a compound that has a blocking or suppressing activity against the ZFP384 protein, or a prodrug thereof, or a pharmacologically acceptable salt thereof, or a hydrate or solvate thereof.

[0017] (9) A therapeutic method for cerebral injury caused by cerebrovascular disorder or traumatic brain injury, the method comprising the step of administering the pharmaceutical composition described in the above (1) or the therapeutic agent described in the above (8) to a subject who has or is likely to have cerebral injury caused by cerebrovascular disorder or traumatic brain injury.

[0018] (10) A screening method for a compound that blocks or suppresses the expression of the Zfp384 gene or a compound that has a blocking or suppressing activity against the ZFP384 protein, the screening method comprising the steps of:

[0019] adding a candidate compound to microglia cells that overexpress the ZFP384 protein and evaluating the candidate compound for blocking or suppressing the expression of the Zfp384 gene or for having a blocking or suppressing activity against the ZFP384 protein.

[0020] (11) A pharmaceutical composition for the treatment of cerebral injury caused by cerebrovascular disorder or traumatic brain injury, or a therapeutic agent for the cerebral injury, comprising a compound obtained by the screening method described in the above (10), or a prodrug thereof, or a pharmacologically acceptable salt thereof, or a hydrate or solvate thereof.

[0021] Effects of the Invention

[0022] According to the present application, it is possible to provide, for example, a pharmaceutical composition for cerebral injury caused by cerebrovascular disorder or traumatic brain injury, a therapeutic agent for the cerebral injury, a therapeutic method for the cerebral injury, and a screening method for a compound that becomes an effective ingredient of the pharmaceutical composition or the therapeutic agent. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 is a graph showing the expression dynamics of the repair period-related gene groups in microglia cells after cerebral infarction.

[0024] (A) Extracting gene groups characteristic of the repair period after cerebral infarction as repair period-related gene groups.

[0025] (B) These repair period-related gene groups are typical gene expressions in neural repair such as vascularization, formation of neural tissue, and the like.

[0026] (C) The expression of the repair period-related gene groups in microglia cells after cerebral infarction is lost within 1 month.

[0027] Figure 2 is a graph concerning the loss of the function of microglia to repair before 28 days after cerebral infarction, and the cells expressing IGF1 after cerebral infarction taking over the function recovery.

[0028] (A) IGF1-CreER: Cerebral infarction was made using iDTR mice, 4-OHT was administered on days 4 to 14 after onset, and DTX was administered intracerebroventricularly on days 11 and 17 after onset, whereby IGF1-expressing cells were removed from the brain.

[0029] (B) In mice in which IGF1-expressing cells were removed (Cre(+)), no recovery of neurological symptoms was confirmed compared to mice in which they were not removed (Cre(-)).

[0030] (C) IGF1-expressing cells are mainly microglia, and their presence was not confirmed in the brain until 28 days after onset.

[0031] Figure 3 is a graph concerning the fate tracking of reparative microglia, showing that microglia that lost the function to repair after cerebral infarction remain.

[0032] The fate of Igf1-expressing cells was tracked, and cells that were IGF1-EGFP-negative but TdTomato-positive were observed in the part around the infarction 28 days after onset of cerebral infarction.

[0033] Figure 4 is a graph concerning enhancer and promoter analysis in microglia after cerebral infarction.

[0034] (A) Open chromatin regions (promoter regions and enhancer regions) detected by ATAC-seq upstream and downstream of the Igf1 gene, and chromatin loops in which promoters and enhancers detected by HiCHIP are connected.

[0035] (B) Time-dependent changes in open chromatin regions in the upstream and downstream of repair-related genes that can be detected by ATAC-seq after cerebral infarction.

[0036] (C) Candidates for transcription factors that bind to open chromatin regions that changed from 14 to 28 days after cerebral infarction.

[0037] Figure 5 is a graph concerning the screening of factors that end repair.

[0038] Among 21 transcription factors that are likely to function in microglia from 14 to 28 days after cerebral infarction, Zfp384 suppressed the expression of Igf1.

[0039] Figure 6 is a graph concerning the expression of Zfp384 in microglia, which increased from 6 to 28 days after cerebral infarction.

[0040] (A) Temporal changes in Zfp384 expression in microglia after cerebral infarction.

[0041] (B) Immunohistological staining showing that ZFP384-expressing microglia do not express IGF1.

[0042] Figure 7-1 (A) is a graph showing that when the expression of YY1 is reduced in the microglia strain BV2, the expression of Igf1 is significantly reduced.

[0043] (B) is a graph showing that in the BV2 cell strain, YY1 binds to the enhancer region upstream of the Igf1 gene, but if Zfp384 is overexpressed, the binding of YY1 is lost and ZFP384 takes over the binding.

[0044] (C) is a graph showing that chromatin loops that can be detected by HiCHIP disappear through overexpression of Zfp384 (H3K27ac is an open chromatin region).

[0045] Figure 7-2 (as shown above Figure 7-1 ).

[0046] Figure 8-1 (A) is a graph related to the evaluation of long-term neurological symptoms after cerebral infarction based on the corner test. By the loss of Zfp384 specific to microglia after the onset of cerebral infarction after 7 days, long-term neurological symptoms were improved.

[0047] (B) is a graph showing that by the loss of Zfp384 specific to microglia, the proportion of repair microglia expressing Igf1 increases, and the expression of a gene group related to vascularization, formation of neural tissue increases.

[0048] Figure 8-2 (as shown above Figure 8-1 ).

[0049] Figure 9 is a graph related to the design of ASO targeting Zfp384 gene, etc.

[0050] (A) Schematic diagram of Gapmer type antisense oligonucleotide (ASO) and search of ASO sequence that efficiently suppresses Zfp384 expression in BV2 overexpressing Zfp384.

[0051] (B) By intracerebroventricular administration of ASO-Zfp384, significant suppression of Zfp384 expression was observed mainly in microglia.

[0052] Figure 10is a graph showing that the recovery of neurological symptoms is promoted, maintained by administration of ASO-Zfp384. It is shown that ASO-Zfp384 makes brain function recovery continue.

[0053] (A) Even in the case of administration of ASO-Zfp384 at 8 days after onset of cerebral infarction, long-term neurological symptoms were significantly improved.

[0054] (B) Microglia at 28 days after onset were isolated and subjected to single cell RNA-seq analysis, and it was found that the cell proportion of microglia expressing repair-related genes was significantly increased.

[0055] Figure 11 is a graph showing that ASO targeting the DNA binding domain of ZFP384 protein improves neurological symptoms after cerebral infarction.

[0056] (A) Administration of ASO-5 at 8 days after onset of cerebral infarction significantly improved long-term neurological symptoms.

[0057] (B) Sequence positions of each ASO designed against the DNA binding domain of ZFP384 protein and mRNA sequence equivalent to the DNA binding domain.

[0058] (C) Comparison of the degree of expression of Igf1 mRNA when ZFP384 mutant proteins were overexpressed in BV2. Zfp384-FL: overexpression of ZFP384 full-length protein; Zfp384 N-Del: ZFP384 protein with N-terminal deletion; Zfp384 C-Del: ZFP384 protein with C-terminal deletion; Zfp384 DBD-Del: ZFP384 protein with deletion of DNA binding domain; Zfp384-DBD: overexpression of only the DNA binding domain of ZFP384 protein.

[0059] Figure 12 is a graph showing changes in the expression of Igf1 mRNA and Zfp384 mRNA when shRNA against Zfp384 was expressed in BV2.

[0060] Figure 13 is a graph related to the development of Zfp384 blockers using a protein knockdown method.

[0061] (A) Conceptual diagram of protein knockdown of ZFP384.

[0062] (B) Protein knockdown agent screening in BV2. The concentrations from left to right in each group are 100 nM, 300 nM, 1 μM, respectively.

[0063] Figure 14is a schematic diagram summarizing the present application. It was found that microglia cells remain in the brain in a state of loss of repair function, and ZFP384 in microglia cells after cerebral infarction is a factor that loses repair function. By inhibiting the expression of the Zfp384 gene with an antisense oligonucleotide, the functional recovery after cerebral infarction was successfully and continuously promoted. DETAILED DESCRIPTION

[0064] Hereinafter, the present application will be described in detail. The scope of the present application is not limited to these descriptions, and can be appropriately changed and implemented without departing from the gist of the present application, even if it is not exemplified below. Note that the present specification includes the entire contents of Japanese Patent Application No. 2023-044551 (filed on March 20, 2023) as a basis for claiming priority of the present application. Note that all publications, such as prior art documents and published gazettes, patent publications, and other patent documents cited in the present specification are incorporated by reference into the present specification.

[0065] 1. Summary of the Invention

[0066] Cerebral vascular disorders (stroke) are a major cause of shortening of healthy life, and the current situation is that there is a lack of means for restoring brain function other than rehabilitation. Even with rehabilitation, only a significant functional recovery after stroke can be expected within a few months after onset, and it is therefore believed that the repair function based on brain cells is lost with the passage of time after stroke. It is known that microglia cells take on a repair role when brain tissue is damaged, but the repair function thereof and the cell fate of microglia cells involved in repair are not clear. The present inventors have clarified that microglia cells remain in brain tissue even if they lose repair function, and have successfully identified Zfp384 as a factor that loses repair function after stroke (repair loss factor). Based on this result, by developing a compound (e.g., antisense oligonucleotide) that inhibits the expression of the repair loss factor, it has become possible for the first time in the world to continuously recover neurological symptoms by maintaining the repair mechanism after cerebral infarction. The present application provides a therapeutic strategy that can reduce sequelae by continuously (extending) the original repair mechanism of the brain, and continuously and / or restart the functional recovery of neurological symptoms in patients whose brain has been damaged.

[0067] 2. Pharmaceutical composition, etc.

[0068] The pharmaceutical composition according to the present application is characterized by containing, as an active ingredient, a compound that blocks or inhibits the expression of a Zfp384 gene (a gene encoding a ZFP384 protein (zinc finger protein 384)) or a compound that has a blocking or inhibiting activity against a ZFP384 protein (zinc finger protein 384), or a prodrug of the compound, or a pharmacologically acceptable salt thereof, or a hydrate or solvate thereof (hereinafter sometimes referred to simply as "Zfp384 blocking agent"). Note that, in the present specification, the case where only "Zfp384" is written also means a Zfp384 gene, and the case where only "ZFP384" is written also means a ZFP384 protein. The pharmaceutical composition according to the present application is not limited, and for example, a pharmaceutical composition for treating brain damage caused by cerebrovascular disorder or traumatic brain injury is preferred.

[0069] In the present application, among brain damage as a therapeutic target, brain damage caused by cerebrovascular disorder is not limited, and for example, brain damage caused by stroke, specifically, brain damage caused by cerebral infarction, cerebral hemorrhage, or subarachnoid hemorrhage can be mentioned.

[0070] In the present application, as the treatment of brain damage caused by cerebrovascular disorder or traumatic brain injury, specifically, for example, recovery of neurological symptoms in brain damage, or continuation and / or restart of the recovery effect thereof can be mentioned, and in addition, development inhibition, prognosis improvement, and the like of the brain damage are also included.

[0071] Note that, in the present application, for example, each of the following inventions can also be included:

[0072] (i) a pharmaceutical composition for use in a method of treating brain damage caused by cerebrovascular disorder or traumatic brain injury in a subject, the pharmaceutical composition containing a Zfp384 blocking agent as an active ingredient; (ii) a therapeutic agent for brain damage caused by cerebrovascular disorder or traumatic brain injury, containing a Zfp384 blocking agent;

[0073] (iii) a method of treating brain damage caused by cerebrovascular disorder or traumatic brain injury, comprising a step of using a Zfp384 blocking agent, specifically, for example, administering an effective amount of a Zfp384 blocking agent to a subject;

[0074] (iv) use of a Zfp384 blocking agent for the manufacture of a medicament for the treatment of the brain damage;

[0075] (v) use of a Zfp384 blocking agent for the treatment of the brain damage; and

[0076] (vi) the Zfp384 blocking agent for the treatment of brain injury.

[0077] The Zfp384 blocking agent as an effective ingredient of the pharmaceutical composition and the like of the present application can use a substance obtained by self-synthesis, extraction, and purification, and the like, but is not limited thereto, and can use a publicly known substance or a commercially available substance.

[0078] In the present application, the compound that blocks or inhibits the expression of the Zfp384 gene as the Zfp384 blocking agent is not limited, and for example, a compound including a nucleic acid including a sequence complementary to at least a part of the base sequence of the Zfp384 gene can be exemplified, and preferably, a compound in which at least a part of the base sequence of the gene includes at least a part of the base sequence encoding the DNA binding domain of the ZFP384 protein can be exemplified. Here, the Zfp384 gene of the mouse is registered and disclosed, for example, as Accession No. NM_001347452 in the website of GenBank of NCBI (National Center for Biotechnology Information) (https: / / www.ncbi.nlm.nih.gov / genbank / ). In the base sequence of the Zfp384 gene (SEQ ID NO: 1), the base sequence encoding the DNA binding domain of the ZFP384 protein (SEQ ID NO: 2) is a sequence region consisting of the bases from position 756 to position 1265 of the sequence shown in SEQ ID NO: 1.

[0079] In the present application, the kind of the nucleic acid including a sequence complementary to at least a part of the base sequence of the Zfp384 gene (SEQ ID NO: 1) is not limited, and can have a single-stranded structure or a double-stranded structure, and for example, an antisense nucleic acid (RNA- decomposing antisense nucleic acid (Gapmer-type antisense nucleic acid), splice-modulating antisense nucleic acid, and the like), short interfering RNA (siRNA), short hairpin RNA (shRNA), and the like can be exemplified. As for these nucleic acids, the base length can be appropriately designed according to the kind of the nucleic acid and the use mode, and for example, 5 to 50 bases, 6 to 24 bases, or 8 to 22 bases, and the like are not limited. The nucleic acid used in the present application can be DNA or RNA, and the nucleotide constituting the nucleic acid can be a natural nucleotide, or a modified or artificial nucleotide (for example, LNA (Locked Nucleic Acid), PNA (Peptide Nucleic Acid), phosphorothioate nucleic acid, morpholino nucleic acid (morpholino oligonucleotide), and the like nucleotide mimetic), or a combination thereof.

[0080] As the nucleic acid used in the present application, it is not limited to a nucleic acid containing a sequence complementary to at least a part of the base sequence of the Zfp384 gene (SEQ ID NO: 1), and for example, a nucleic acid containing a sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 95%, 96%, 97%, 98%, or 99% sequence identity to the complementary sequence is also preferably used.

[0081] As the nucleic acid used in the present application, it can be, for example, a modified nucleic acid (modifier) to improve the thermal stability of the complex with at least a part of the base sequence of the Zfp384 gene (SEQ ID NO: 1) as the target.

[0082] As the modifier, a nucleic acid in which all or a part of the bases (at least 1 base or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the bases) are modified can be given. As the modified base, for example, 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, or 5-iodocytosine; 5-fluorouracil, 5-bromouracil, 5-iodouracil, or 5-hydroxyuracil; 2-thiothymine; N6-methyladenine or 8-bromo-adenine; and N2-methylguanine or 8-bromo-guanine, etc. can be given.

[0083] In addition, as the modifier, a nucleic acid in which the sugar moiety of the base, that is, the sugar moiety of all or a part of the bases (at least 1 base or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the bases) is modified can be given. A nucleic acid having a structure in which any substance is added to or substituted from the chemical structure of the sugar of the nucleotide can be given, and by containing a modified sugar, nuclease resistance is increased. As examples of the modified sugar, for example, 2'-F, 2'-OCH3 (2'-methoxy or 2'-O-methyl), and 2'-O(CH2)2OCH3 substituents, etc. can be given. A nucleic acid containing a bicyclic sugar moiety is called a bridged nucleotide (BNA), and as such a nucleic acid, a sugar having a methyleneoxy (4'-CH2-O-2') bridge (LNA (registered trademark), 2', 4'-BNA), a sugar having an ethyleneoxy (4'-(CH2)2-O-2') bridge (ENA), a sugar having a 4'-CH(CH3)-O-2' bridge (cEt, constrained ethyl), a sugar having a 4'-CH(CH2OCH3)-O-2' bridge (cMOE, constrained MOE), a sugar having an amide bridge (AmNA, Amido-bridged nucleic acid), etc. can be given.

[0084] Further, as the modification, all or a part (at least 1 bond or at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the bonds) of the phosphodiester bond of the nucleic acid can be modified. As the modification of the bond, a phosphorothioate bond, a phosphorodithioate bond, a phosphorodiamidite bond, a phosphoramidite bond, and the like can be mentioned. These modified bonds have higher nuclease resistance than the naturally occurring bond.

[0085] As the nucleic acid used in the present application, specifically, for example, the following antisense nucleic acids (ASO-1 to ASO-12) can be mentioned. Among them, from the viewpoint of excellent activity in inhibiting the expression of the Zfp384 gene, ASO-2, ASO-4 to ASO-6, and ASO-9 to ASO-11 are preferred, ASO-2, ASO-4, and ASO-5 are more preferred, and ASO-2 is particularly preferred.

[0086] ASO-5, and ASO-2 is particularly preferred. Each of the following antisense nucleic acids (ASO-1 to ASO-12) is a nucleic acid in which a 3-base LNA sequence is bound to both ends of a 10-base DNA sequence, the DNA is represented by the lower case letters "a, t, g, c", and the LNA is a symbol in which "(L)" is added to the symbol of the upper case letter "A, T, G" or the symbol of "5" (meaning "5-methylcytosine"). Note that the introduction position of the LNA in the antisense nucleic acid that can be used in the present application is not limited to both ends of the DNA sequence as described above, and a part or all of the LNA can be introduced to any base in the DNA sequence at 1 base or 2 bases or more as needed, without limitation. In addition, the phosphodiester bond between all the bases is thio-phosphorylated (represented by "^"). Note that a nucleic acid in which this thio-phosphorylation is not performed on all or a part of the bases can also be used as the nucleic acid used in the present application.

[0087] In addition, only a part of the DNA sequence (10 bases) in the following antisense nucleic acids (ASO-1 to ASO-12) or a nucleic acid sequence containing the same can be used as the nucleic acid used in the present application. In this case, the above-described thio-phosphorylation can be performed between all the bases, or can not be performed between a part or all of the bases, without limitation.

[0088] ASO-1: G(L) ^ G(L) ^ A(L) ^ t ^ t ^ t ^ c ^ t ^ C ^ a ^ C ^ a ^ g ^ A(L) ^ A(L) ^ G(L) (SEQ ID NO: 3)

[0089] AS0-2: G(L)A(L)A(L)g g a t t t c t c a 5(L)A(L)G(L) (SEQ ID NO: 4)

[0090] AS0-3: 5(L)T(L)5(L) a C a g a a g t t a 5(L)A(L)A(L) (SEQ ID NO: 5)

[0091] AS0-4: A(L)5(L)A(L) t t t g t a t g g t 5(L)T(L)A(L) (SEQ ID NO: 6)

[0092] AS0-5: G(L)5(L)A(L) c a t t t g t a t g G(L)T(L)5(L) (SEQ ID NO: 7)

[0093] AS0-6: T(L)G(L)G(L) a g a g t t g t g t G(L)A(L)A(L) (SEQ ID NO: 8)

[0094] AS0-7: G(L)A(L)T(L) t g g a g a g t t g T(L)G(L)T(L) (SEQ ID NO: 9)

[0095] AS0-8: A(L)G(L)A(L) t t g g a g a g t t G(L)T(L)G(L) (SEQ ID NO: 10)

[0096] AS0-9: 5(L)A(L)G(L) a t t g g a g a g t T(L)G(L)T(L) (SEQ ID NO: 11)

[0097] AS0-10: G(L)5(L)A(L) C t t g a a g g g t T(L)T(L)A(L) (SEQ ID NO: 12)

[0098] AS0-11: T(L)G(L)G(L) c a C t t g a a g g G(L)T(L)T(L) (SEQ ID NO: 13)

[0099] AS0-12: G(L)T(L)G(L) g c a C t t g a a g G(L)G(L)T(L) (SEQ ID NO: 14)

[0100] Note that, as to the bases in the sequence represented by SEQ ID NO. 1 complementary to the DNA sequence (10 bases) in each of the above-described antisense nucleic acids (ASO-1 to ASO-12),

[0101] In the case of ASO-1, the bases at positions 929 to 944 in the sequence represented by SEQ ID NO. 1;

[0102] In the case of ASO-2, the bases at positions 932 to 947 in the sequence represented by SEQ ID NO. 1;

[0103] In the case of ASO-3, the bases at positions 923 to 938 in the sequence represented by SEQ ID NO. 1;

[0104] In the case of ASO-4, the bases at positions 995 to 1010 in the sequence represented by SEQ ID NO. 1;

[0105] In the case of ASO-5, the bases at positions 997 to 1012 in the sequence represented by SEQ ID NO. 1;

[0106] In the case of ASO-6, the bases at positions 1035 to 1050 in the sequence represented by SEQ ID NO. 1;

[0107] In the case of ASO-7, the bases at positions 1038 to 1053 in the sequence represented by SEQ ID NO. 1;

[0108] In the case of ASO-8, the bases at positions 1039 to 1054 in the sequence represented by SEQ ID NO. 1;

[0109] In the case of ASO-9, the bases at positions 1040 to 1055 in the sequence represented by SEQ ID NO. 1,

[0110] In the case of ASO-10, the bases at positions 1085 to 1100 in the sequence represented by SEQ ID NO. 1,

[0111] In the case of ASO-11, the bases at positions 1087 to 1102 in the sequence represented by SEQ ID NO. 1,

[0112] In the case of ASO-12, the bases at positions 1088 to 1103 in the sequence represented by SEQ ID NO. 1.

[0113] Further, as the nucleic acid used in the present application, for example, shRNA of the following sequence is also preferably exemplified.

[0114] 5'-GCTCAGACTTTCCCTATTTTCAAGAGAAATAGGGAAAGTCTGAGCTGC-3' (SEQ ID NO. 15)

[0115] In the above shRNA, the bases complementary to the sequence (21 bases at the 3' end; AATAGGGAAAGTCTGAGCTGC) that functions as an siRNA in a cell are the bases at positions 471 to 491 of the sequence shown by SEQ ID NO: 1 (5'-GCAGCTCAGACTTTCCCTATT-3').

[0116] Note that, in the sequence of the shRNA, although not limited, at least a part of the bases can be constituted by LNA, for example.

[0117] The nucleic acid used in the present application is not limited, and can be synthesized by a publicly known chemical synthesis method or an enzyme transcription method. As the chemical synthesis method, for example, a phosphorothioate method, a phosphoramidite method, a phosphorothioate method, and the like can be mentioned, and as the enzyme transcription method, for example, a method using an RNA polymerase can be mentioned.

[0118] In the present application, the compound having a blocking or inhibiting activity against the ZFP384 protein as the Zfp384 blocking agent is not limited, and a compound that can be used for so-called protein knockdown technology can be designed or selected, and for example, a decoy nucleic acid, a compound that can decompose the protein, and a compound that can induce decomposition of the protein, and the like can be mentioned, and they can be used in appropriate combination. Here, the blocking or inhibiting activity of the compound against the ZFP384 protein can be determined or confirmed by, for example, a method of quantifying the amount of ZFP384 protein by Western blotting or the like using a microglial cell line, a cell line in which the Zfp384 gene is overexpressed exogenously as needed, a method of ChIP-seq (chromatin immunoprecipitation) using an antibody against the ZFP384 protein, and the like.

[0119] The decoy nucleic acid is not limited, and a binding sequence of the ZFP384 protein (or a part thereof) is preferably used, and for example, a double-stranded sequence composed of TTTTTTT-AAAAAAA (complementary strands are connected with a hyphen "-"), a sequence containing the sequence can be mentioned.

[0120] The compound that decomposes the ZFP384 protein is not particularly limited, and publicly known or appropriately synthesized various compounds having the decomposing activity, and the like can be mentioned.

[0121] The compound that induces decomposition of the ZFP384 protein is not limited, and PROTAC, SNIPER, Cereblon E3 modulator, and the like can be mentioned.

[0122] The Zfp384 blocking agent that can be used in the present application can also use a derivative of the blocking agent together with or instead of the blocking agent. As the derivative, there is no limitation as long as it is considered to be a derivative of the blocking agent based on the technical common sense of those skilled in the art, and in addition to a substance that is subjected to metabolism such as oxidation, reduction, hydrolysis, or conjugation in a living body, a compound that is generated by metabolism such as oxidation, reduction, or hydrolysis in a living body to generate the blocking agent, a derivative thereof (so-called prodrug) is also included. The above derivative is preferably a derivative that is at least the same degree as the Zfp384 blocking agent in terms of the degree of blocking or inhibiting Zfp384 gene expression, the degree of blocking or inhibiting activity of the ZFP384 protein.

[0123] The Zfp384 blocking agent that can be used in the present application can also use a pharmacologically acceptable salt thereof. As the above pharmacologically acceptable salt, for example, a hydrohalide salt (for example, hydrochloride, hydrobromide, and hydroiodide, etc.), an inorganic acid salt (for example, sulfate, nitrate, perchlorate, phosphate, carbonate, and bicarbonate, etc.), an organic carboxylic acid salt (for example, acetate, trifluoroacetate, maleate, tartrate, fumarate, and citrate, etc.), an organic sulfonic acid salt (for example, methanesulfonate, trifluoromethanesulfonate, ethanesulfonate, benzenesulfonate, toluenesulfonate, and camphorsulfonate, etc.), an amino acid salt (for example, aspartate and glutamate, etc.), a quaternary ammonium salt, an alkali metal salt (for example, sodium salt and potassium salt, etc.), an alkaline earth metal salt (for example, magnesium salt and calcium salt, etc.), and the like can be preferably selected. In addition, the Zfp384 blocking agent is sometimes present in the form of a hydrate, a solvate, and the like, and they can also be used as the effective ingredient of the pharmaceutical composition and therapeutic agent of the present application.

[0124] In the pharmaceutical composition and therapeutic agent of the present application, the containing ratio of the Zfp384 blocking agent as the effective ingredient is not limited, and can be appropriately set within a range capable of blocking or inhibiting Zfp384 gene expression, or within a range having blocking or inhibiting activity to the ZFP384 protein, further considering each condition such as the dosage form described later, for example, it can be within a range of 0.01 to 99% by weight, or it can be within a range of 0.01 to 30% by weight, 0.05 to 20% by weight, 0.1 to 10% by weight, with respect to the whole of the pharmaceutical composition or therapeutic agent.

[0125] The administration route of the pharmaceutical composition and therapeutic agent of the present application is not limited, and as long as the Zfp384 blocking agent as the effective ingredient can exert an effect in a living body (particularly, in the brain tissue), it can be administered by injection (intravenous injection, subcutaneous injection, intradermal injection, intramuscular injection, intra-articular injection), transdermally (topical application), nasally, transmucosally, intranasally, intratracheally, orally, inhalation, or the like.

[0126] The pharmaceutical composition and therapeutic agent according to the present application are not limited in form, and can be in the form of an injection (including a drip), inhalation, liquid, emulsion, suspension, solution, ointment, nasal drop, tablet, granule, spray, capsule, syrup, suppository, tape, and liposome, etc. The pharmaceutical composition and therapeutic agent according to the present application can contain pharmacologically acceptable carriers, diluents, excipients, binders, disintegrants, lubricants, flavoring agents, coloring agents, sweetening agents, corrigents, suspending agents, wetting agents, emulsifying agents, dispersing agents, adjuvants, preservatives, buffers, stabilizers, coating agents, etc. that are commonly used in the field of formulation. As the carriers and excipients, for example, lactose, starch, talc, magnesium stearate, crystalline cellulose, methyl cellulose, carboxymethyl cellulose, glycerol, sodium alginate, gum arabic, etc. can be mentioned, and as the binders, polyvinyl alcohol, polyvinyl ether, ethyl cellulose, gum arabic, shellac, sugar, etc. can be mentioned. As the aqueous solution for injection, physiological saline, isotonic solution containing glucose, other auxiliary drugs, etc. can be used, and can be used in combination with an appropriate co-solvent such as an alcohol, a polyhydric alcohol such as propylene glycol, a nonionic surfactant, etc. As the oily solution, sesame oil, soybean oil, etc. can be used, and as the co-solvent, benzyl benzoate, benzyl alcohol, etc. can be used.

[0127] The pharmaceutical composition and therapeutic agent according to the present application can be administered in an amount that is therapeutically effective for the Zfp384 blocking agent as an active ingredient. The therapeutically effective amount can be appropriately changed depending on the severity of the patient's condition, sex, age, body weight, etc. For example, for the Zfp384 blocking agent, the administration can be performed at about 1 μg to about 2000 mg, further preferably about 10 μg to about 1000 mg, further preferably about 100 μg to about 500 mg, per 1 kg of the patient's body weight at a time. The administration can be performed once a day to several times a day, for example, 4 to 6 times, and can be intermittently administered several days or weeks at a time.

[0128] The pharmaceutical composition and therapeutic agent according to the present application can also be used for the treatment of brain damage or traumatic brain damage caused by cerebrovascular disorders in any animal. It is particularly suitable for use in mammals such as humans, monkeys, cows, sheep, horses, dogs, cats, etc.

[0129] In the present application, a kit containing a Zfp384 blocking agent (as a specific example, a kit containing the above-mentioned pharmaceutical composition or therapeutic agent according to the present application) can also be used for the treatment of brain damage or traumatic brain damage caused by cerebrovascular disorders.

[0130] The Zfp384 blocking agent in the kit is not limited in form, and can be provided in a dissolved state, for example, in consideration of stability (preservation) and ease of use, etc.

[0131] The kit can appropriately contain other components in addition to the Zfp384 blocking agent.

[0132] The kit is a kit having at least the Zfp384 blocking agent as a component. Therefore, the kit can be a kit having all components necessary for the treatment of brain damage caused by cerebrovascular disorders or traumatic brain injury together with the Zfp384 blocking agent, or can be a kit having each component separately, and is not limited.

[0133] 3. Screening method, etc.

[0134] In the present application, a method of screening a compound useful for the treatment of brain damage caused by cerebrovascular disorders or traumatic brain injury, etc. is provided.

[0135] Specifically, a method of screening a compound that blocks or inhibits the expression of a Zfp384 gene, or a compound having a blocking or inhibiting activity against a ZFP384 protein, is provided, the method being characterized by comprising the steps of: adding a candidate compound to a microglial cell that overexpresses a ZFP384 protein; and evaluating the candidate compound for blocking or inhibiting the expression of a Zfp384 gene, or having a blocking or inhibiting activity against a ZFP384 protein. The microglial cell that overexpresses a ZFP384 protein is not limited, and a transformed cell into which a Zfp384 gene has been introduced using a known gene recombination technique to a known strain of a microglial cell (BV2 cell, etc.) can be used. To the microglial cell, a candidate compound is added in vitro, and the cells expressing a ZFP384 protein (positive cells) are quantified by, for example, FACS, etc., whereby the degree of blocking or inhibition of the expression of a Zfp384 gene by the candidate compound can be evaluated. Alternatively, after the addition of the candidate compound, the amount of expression of a ZFP384 protein is quantified by, for example, a western blot method, etc., whereby the degree of blocking or inhibiting activity against a ZFP384 protein (i.e., the degree of protein knockdown) can be evaluated.

[0136] The compound obtained by the above-described screening method can be used as an effective ingredient of a pharmaceutical composition for the treatment of brain damage caused by cerebrovascular disorders or traumatic brain injury, or a therapeutic agent for the brain damage. In addition, a prodrug of the obtained compound, or a pharmacologically acceptable salt thereof, or a hydrate or solvate thereof can also be used as the above-described effective ingredient.

[0137] The present application will be described more specifically below by citing examples, but the present application is not limited to these examples.

[0138] [Examples]

[0139] In the examples of the present application, the following general matters, etc. are described.

[0140] Example 1: It was found that formation of higher-order structure of chromatin is important in expression of a group of repair-related genes of microglia cells after cerebral infarction. Expression of the group of repair-related genes and enhancer interaction disappeared at 28 days after onset in a cerebral infarction model mouse (equivalent to 90 days after onset of cerebral infarction in humans), but it was confirmed that the microglia cells involved in repair remained in the brain tissue although the repair function stopped.

[0141] Example 2: As a transcription factor that causes loss of repair ability (expression of repair-related genes) of microglia cells, ZFP384 was identified. It was confirmed that inhibition of expression of ZFP384 in microglia cells after cerebral infarction can prolong expression of repair-related genes and improve long-term neurological symptoms after cerebral infarction.

[0142] Example 2: As a transcription factor that causes loss of repair ability (expression of repair-related genes) of microglia cells, ZFP384 was identified. It was confirmed that inhibition of expression of ZFP384 in microglia cells after cerebral infarction can prolong expression of repair-related genes and improve long-term neurological symptoms after cerebral infarction.

[0143] Example 3: An antisense oligonucleotide (nucleic acid drug) that inhibits expression of ZFP384 was constructed, and even when administration was started 7 days after onset of cerebral infarction, expression of repair-related genes of microglia cells was sustained and long-term neurological symptoms were improved.

[0144] [Materials and methods, etc.]

[0145] Before explaining each embodiment, the following explains the materials and methods, etc. used in the present embodiment.

[0146] [Brain ischemia model]

[0147] Using 8- to 24-week-old mice, a plug line coated with silicon at the front end (Ethilon (filament 7-0), Johnson & Johnson) was inserted from the total carotid artery of 8- to 24-week-old mice. The brain temperature was maintained at 36°C, and the cerebral blood flow was monitored using a Doppler flowmeter ALF21 (Advance Co., Ltd.), and the plug line was left in the starting portion of the middle cerebral artery in a manner to maintain the cerebral blood flow of the middle cerebral artery perfusion area at 20-40% of the normal state. After 60 minutes of ischemia, the plug line was pulled out, thereby reperfusing the brain tissue. As a control, sham-operated mice (n = 5) were prepared. Figures 1-4 、 Figure 6 , FIG. 8, Figure 10 、 Figure 11 ).

[0148] [Neurological symptoms after induction of cerebral ischemia]

[0149] By the corner test reported by Schallert T et al. (Neuropharmacology. 2000 Mar 3; 39(5): 777-87), the evaluation score of neurological symptoms was evaluated over time (FIG. 8, Figure 2 , FIG. 8, Figure 10 ,Figure 11 ).

[0150] <immunostaining>

[0151] Brain ischemia model mice after 28 days after onset were perfused with 4% paraformaldehyde and fixed brain tissue, after the brain was removed and thin cut to 10-15 pm, immunohistochemical staining was performed. The first antibody used anti-ZFP384 antibody (Sigma-Aldrich, Cat. # HPA004051) (1:300 dilution), anti-EGFP antibody (Aves Labs, Cat. # 1010) (1:500 dilution). The second antibody used Alexa 488 labeled secondary antibody (anti-chicken IgG, Thermo Fisher Scientific, Cat. # A-11039) (1:300 dilution), Alexa 546 labeled antibody (anti-rabbit IgG, Thermo Fisher Scientific, Cat. # A-11081) (1:300 dilution). To perform nuclear staining, the second antibody and dihydrochloride (DAPI) (DOJINDO, Cat. # SE196) (1:200 dilution) were used. The scale of the immunostaining image represents 100 pm Figure 3 , Figure 6 ).

[0152] <production of lentivirus>

[0153] The lentivirus vector (CSII-EF, RIKEN) cloned with each transcription factor was transfected into HEK293 cells with polyethyleneimine together with packaging plasmid pMDL g / p-RRE and envelope plasmid pCMV-VSV-G-RSV-Rev, and after 72 hours the supernatant was centrifuged at 8000g at 4°C overnight, whereby the lentivirus was recovered Figure 5 ).

[0154] <functional analysis of transcription factor>

[0155] The lentivirus was infected into microglial cell line BV2, and after 48 hours, gene expression analysis was performed by the above qPCR method Figure 5 ).

[0156] <shrna>

[0157] The following sequence of shRNA was synthesized and used.

[0158] GCTCAGACTTTCCCTATTTTCAAGAGAAATAGGGAAAGTCTGAGCTGC (SEQ ID NO: 15)

[0159] The sequence was cloned into a lentivirus vector (CS-EG-H1, RIKEN), and lentivirus was produced, recovered, and used in the same manner as the lentivirus for transcription factor expression. Figure 12 ).

[0160] <Protein knockdown>

[0161] A compound in which a double-stranded sequence of TTTTTTT-AAAAAAA, which is a binding sequence of VHL (von Hippel Lindau; von Hippel Lindau syndrome) as an E3 ligase and a DNA-binding domain of ZFP384 protein, is bound with amide-PEG3-amine was used as a PROTAC. As a SNIPER, a compound in which A410099.1, which is an IAP (inhibitor of apoptosis protein) antagonist, is bound with nucleic acid with amide-PEG3-amine was used. In addition, Pomalidomide was bound with nucleic acid with 4'-PEG2-Amine. All of these three protein knockdown compounds were synthesized by ordering to Biosource Biomedical Corporation Figure 13 ).

[0162] <Antisense oligonucleotide (ASO) and knockdown of Zfp384>

[0163] ASO was purchased by ordering to Biosource Biomedical Corporation to synthesize a designed sequence. As a functional evaluation of ASO, in BV2 in which Zfp384-P2A-mCherry was overexpressed using a lentivirus, ASO was added at a concentration of 1 μM, and mCherry-positive cells were quantified by FACS, whereby the evaluation was performed Figure 9 ). Regarding the knockdown of Zfp384, Cx3cr1-CreER; Zfp384 flox / flox Mice were intraperitoneally administered 4-hydroxytamoxifen (Sigma-Aldrich, Cat. # H6278) at a frequency of once every two days at 10 mg / kg from the 7th day to the 21st day after induction of cerebral ischemia, thereby knocking out Zfp384 in microglia (Fig. 8). In addition, administration of ASO to mice was performed by intracerebroventricular administration of ASO diluted with PBS to mice at 5 nmol / 10 μL ( Figure 10 、 Figure 11 ).

[0164] Isolation of microglia

[0165] Live cell fraction was recovered from the brain tissue perfused with physiological saline by Percoll density gradient, and fluorescent immunostaining was performed with anti-CD45 antibody (eBioscience, Cat. #11-0451-85) (30-F11) (1:400 dilution) and anti-CD11b antibody (eBioscience, Cat. #45-0112-82) (M1 / 70) (1:400 dilution), and microglia were isolated using FACS Figure 2 、 Figure 4 、 Figure 6 ). In addition, when using Igf1-Egfp mice, as an anti-CD45 antibody, APC-labeled 30-F11 (BioLegend, Cat #103112) (1:400 dilution) was used Figure 3 ).

[0166] Gene expression of microglia and BV2

[0167] RNA was extracted using RNeasy Micro Kit (Qiagen) or RNAiso (Takara), and after a reaction using a reverse transcriptase, quantitative PCR was performed to quantitatively evaluate the expression of target genes, and in addition, an RNA-seq library was prepared by Ovation SoLo RNA-Seq Library Preparation Kit (Tecan) Figure 1 、 Figures 5-12 ). Data analysis of RNA-seq was performed using STAR (Dobin A et al. Bioinformatics. 2013 Jan 1; 29(1): 15-21) to map to mouse mm10 genome, and the reads mapped to mRNA were normalized by Transcripts per million (TPM) method, and were used as gene expression. For comprehensive functional analysis of gene expression, g:profiler (https: / / biit.cs.ut.ee / gprofiler / ) as a public database was used, and functional analysis of the extracted characteristic genes was performed Figure 1 , Fig. 8, Figure 10 ).

[0168] ATAC-seq library

[0169] Microglia isolated by FACS were used to adjust the ATAC-seq library using Tagment DNA TDE1 Enzyme and Buffer Kits (Illumina), based on the method of Buenrostro JD et al. (Nat Methods., 2013 Dec; 10(12):1213-8). Figure 4 , Figure 5 ATAC-seq data were mapped to the mouse mm10 genome using bowtie2 (Langmead B et al., NatMethods., 2012 Mar 4; 9(4):357-9) and normalized using reads per genome coverage (RPGC). ATAC-seq peak calls were obtained through...

[0170] Genrich (https: / / github.com / jsh58 / Genrich) was used for implementation. Regarding HiCHIP, cells were fixed with 1% formaldehyde, and the genome was cut using the restriction enzyme mboI (New England Biolabs Japan, Cat#.R0147). After smoothing the cut ends with biotinylated ATP, ligation and sonication were performed. Chromatin immunoprecipitation was performed using anti-H3K27ac antibody (abcam, Cat.#ab4729) (1:100 dilution). Libraries were constructed using the method of Mumbach MR et al. (Nat Genet., 2017 Nov; 49(11):1602-1612). Figure 4 Figure 7). Data analysis using HiCHIP was performed by mapping the mouse mm10 genome using the default parameters of the HiC-Pro pipeline (Servant N et al., 2015, Genome Biology volume 16, Article number: 259), and loops were detected using FitHiCHIP (Bhattacharyya Setal. Nat Commun., 2019 Sep 17; 10(1): 4221). Enhancer regions interacting with promoters of gene groups related to the repair phase were detected using HiCHIP. After extracting chromatin proximity of the enhancer regions using ATAC-seq, heatmaps were generated using deepTools (Ramírez F et al., Nucleic Acids Research., Volume 44, Issue W1, 8, 2016). For motif analysis, the following methods were used:

[0171] findMotifsGenome.pl of HOMER software (http: / / homer.ucsd.edu / homer / index.html) extracted condensed transcription factor motifs Figure 4 ) As ChIP-seq, cells were permeabilized with 5% digitonin, and anti-ZFP384 antibody (Sigma-Aldrich, Cat. # HPA004051) or anti-YY1 antibody (Abeam, Cat. # ab109237) (EPR4652) was added at 100-fold dilution, and after shaking overnight, the library was adjusted using CUT&Tag method (Kaya-Okur HS et al., Nat Commun., 2019 Apr 29; 10(1): 1930) (Fig. 7). Single cell-RNA-seq (scRNA-seq) was adjusted using Chromium Next GEM Single Cell 5' Reagent Kits v2 purchased from 10x Genomics. scRNA-seq data was mapped using cellranger-6.0.1, and visualized by Loupe Browser (10x Genomics) and Seurat (https: / / satijalab.org / seurat / ) (Fig. 8, Figure 10 ).

[0172] [Example 1]

[0173] Expression of repair-related genes of microglia is induced by chromatin higher-order structure, and remains in the brain after loss of repair function.

[0174] (1) To analyze the gene group characteristic of microglia in the recovery period of neurological symptoms of cerebral infarction, i.e., after the onset of 6 days, a comprehensive gene expression analysis was performed using RNA-seq. The repair period-related gene group of microglia was induced to express after the onset of 6 to 14 days after cerebral infarction, and decreased to a level not different from that of the normal brain until 28 days after the onset. Further, using Igf1-EGFP reporter mice, microglia cells that highly express IGF1 in the cerebral infarction lesion were isolated, and 390 genes that were expressed highly in these repair microglia cells and showed high expression compared to the normal brain microglia cells were identified as repair period-related genes. To investigate the expression dynamics of these repair period-related gene groups, microglia cells were isolated at 1, 6, 14, and 28 days after cerebral infarction, and gene expression profiles were obtained by RNA-seq, and it was confirmed that the expression of the repair period-related gene group showed a peak at 6 days after cerebral infarction, and was no longer observed at 28 days after cerebral infarction (loss of repair function) Figure 1 ​

[0175] (2) To analyze the significance of IGF1-expressing cells during the recovery period of cerebral infarction, Igf1-CreERT2 knock-in mice were prepared and crossbred with mice expressing diphtheria toxin receptor (iDTR) in the presence of 4-hydroxytamoxifen (4-OHT). When these mice were given diphtheria toxin (DTX) intracerebrospinally in addition to 4-OHT, IGF1-producing cells in the brain were eliminated. The results indicate that, since the recovery of neurological symptoms after cerebral infarction has not been confirmed (…),… Figure 2 The presence of Cre(+) indicates that IGF1-expressing cells play an important role in functional recovery after cerebral infarction. IGF1-expressing cells after cerebral infarction are primarily microglia, but by day 28 after the onset of the disease, IGF1-expressing microglia are no longer visible in the brain. Figure 2 (Cre(+)n=24, Cre(-)n=18)(*p<0.05 Two-way ANOVA based on Tukey post-hoc test)

[0176] (3) The cell fate of microglia that have lost their repair function remains unknown. Therefore, Igf1-CreERT2 knock-in mice were created to track the fate of Igf1-expressing cells, and these mice were crossbred with stop-flox-tdTomato and Igf1-EGFP mice to track the cell fate of repairing microglia. The results confirmed the presence of microglia that previously expressed Igf1 but had lost their repair function in the peri-infarct region 28 days after the onset of cerebral infarction. Figure 3 These cells were identified as Iba1-positive microglia. These results confirm that even if repair-functional microglia lose their repair function, they still remain in the brain.

[0177] [Example 2]

[0178] Microglial-specific defects in Zfp384, identified as a repair loss factor, resulted in long-term, sustained recovery of neurological symptoms in mice with cerebral infarction.

[0179] (1) Based on the fact that microglia with lost repair function remain in brain tissue, it is predicted that factors causing the loss of microglial repair capacity exist. Therefore, in order to clarify the expression control mechanism of repair-related gene groups, ATAC-seq and HiChIP were implemented to identify the interaction between enhancers and promoters via chromatin loops across the entire genome. The results showed that in the promoter regions of repair-related gene groups, although the number of interacting enhancers increased after the onset of cerebral infarction, forming a significant number of chromatin loops, 28 days after the onset of cerebral infarction, the chromatin state became almost indistinguishable from that of normal brain. Figure 4 ). This result is consistent with the dynamics of gene expression caused by RNA-seq. It is thus suggested that the interaction with the enhancer via the chromatin loop is important in the expression of the repair machinery-related gene group in microglia after cerebral infarction.

[0180] (2) Next, for the transcription factors functioning in microglia after 14 to 28 days from the onset of cerebral infarction, transcription factor motifs binding to the open chromatin region (DNA sequence) obtained in ATAC-seq were widely examined ( Figure 4 ). As a result, 21 transcription factors became candidates, and it was considered that among them, the repair loss factor was contained, so using the microglial cell line BV2 stably expressing IGF1, a repair termination factor that suppresses the expression of Igf1 by overexpressing the candidate factor contained in the transcription factor motif was screened. As a result, it was found that the expression of IGF1 was significantly suppressed by overexpression of Zfp384 ( Figure 5 ) (n = 3).

[0181] (3) It was found that the expression of Zfp384 in microglia increased from the 6th day to the 28th day after cerebral infarction ( Figure 6 ). The expression of Zfp384 and IGF1 was observed by qPCR and immunostaining using Igf1-EGFP mice, and it was found that microglia expressing ZFP384 did not express IGF1.

[0182] (4) It is known that proteins such as CTCF, YY1, RAD21, etc. bind to genomic DNA in the formation of chromatin loops, and promoter-enhancer interactions are generated. Among them, a search for factors that affect the expression of the Igf1 gene was performed, and it was clarified that YY1 is important for the expression of the Igf1 gene (Fig. 7). In fact, using the microglial cell line BV2, analysis of the region to which YY1 binds with ZFP384 by CHIP-seq was performed, and as a result, it was clarified that in BV2 stably expressing IGF1, YY1 binds to the enhancer region of the Igf1 gene, but in BV2 overexpressing Zfp384, the binding of YY1 is lost, and instead, ZFP384 binds. The chromatin loop identified around the Igf1 gene disappeared by overexpression of Zfp384. These results suggest that the expression of repair-related genes such as IGF1 decreases by the increase in the expression of ZFP384.

[0183] (5) Zfp384-deficient microglia-specific mice (Cx3cr1-CreERT2; Zfp384 flox mice) were prepared, and a cerebral infarction model was prepared. When Zfp384 expression in microglia was deficient by administration of 4-OHT after 7 days after cerebral infarction, neurological symptoms were significantly improved for a long period compared with the control group without Zfp384 deficiency (Fig. 8) (Cre(+) n = 24, Cre(-) n = 18) (*p < 0.05 based on Tukey's post-hoc test of two-way ANOVA).

[0184] Microglia were isolated from brain tissue 28 days after the onset of cerebral infarction, and single-cell RNA-seq analysis was performed. As a result, in Zfp384-deficient microglia-specific mice, Igfl-highly-expressing repair microglia increased (8.3% vs 21.0%) compared with wild type (Control). Among the group of genes whose expression increased in repair microglia, factors related to vascularization and formation of neural tissue were enriched (Fig. 8). It was thus shown that by inhibiting the expression of Zfp384, microglia with repair functions can be maintained in the brain.

[0185] [Example 3]

[0186] <The brain function recovery by microglia caused by antisense oligonucleotide targeting Zfp384 and the like is sustained.>

[0187] (1) From the results of the previous examples, it can be considered that by developing an agent that blocks Zfp384, a therapeutic drug that can sustain the repair window after cerebral infarction can be developed. Therefore, the present application developed antisense oligonucleotides (ASOs) that inhibit or block the expression of the Zfp384 gene, and investigated the therapeutic effect on a cerebral infarction model mouse. As a nucleic acid structure, it was clarified that a chimeric nucleic acid of phosphorothioated DNA and LNA (Locked Nucleic Acid) significantly inhibited the expression of Zfp384. Twelve different ASOs (ASO-1 to ASO-12 (SEQ ID NOs: 3 to 14)) complementary to the mRNA of the Zfp384 gene were designed. The sequence details of each ASO can be referred to the above description of the present application. When these ASOs (ASO-1 to ASO-12) were added to a BV2 microglia cell line overexpressing Zfp384, as a result, although there were differences in the degree, any of the ASOs could inhibit the expression of the Zfp384 gene. Among them, ASO-2, ASO-4 to ASO-6, ASO-9 to ASO-11 had a higher inhibitory effect on the expression of the Zfp384 gene, and in particular, ASO-2 (hereinafter referred to as "ASO-Zfp384") most effectively inhibited the expression of the Zfp384 gene Figure 9 ). When this ASO-Zfp384 was fluorescently labeled with Cy3 and administered intracerebroventricularly, it was confirmed that the ASO was efficiently taken up in microglia cells with high efficiency, and that the expression of Zfp384 was significantly inhibited.

[0188] (2) When ASO-Zfp384 was administered intracerebroventricularly to a cerebral infarction model mouse, a significant improvement effect on neurological symptoms was confirmed even when administered at 8 days after onset Figure 10 )(ASO-con n=7, ASO-Zfp384 n=7) (**p<0.01 by two-way ANOVA based on Tukey's post-hoc test). From the results of single-cell RNA-seq analysis of microglia cells at 28 days after cerebral infarction, it was found that microglia cells expressing repair-related genes could be maintained in the brain. That is, ASO-Zfp384 can sustain nerve repair by blocking the loss of repair function, thereby enabling long-term recovery of brain function. From the above results, it was possible to develop a groundbreaking brain function restorer (long-term nerve symptom restorer for brain tissue) based on a nucleic acid drug targeting Zfp384.

[0189] (3) Research was conducted on methods of inhibiting the expression of Zfp384. For example, ASO-5 Figure 9 ), which had an expression inhibition effect on Zfp384 in BV2 that was only slightly weaker than ASO-Zfp384 (ASO-2), was administered to a cerebral infarction model mouse, and a long-term improvement effect on neurological symptoms was still obtained at a level only slightly weaker than ASO-Zfp384 Figure 11 )(ASO-con (control ASO; n=7), ASO-5 (n=4)) (**p<0.01 by two-way ANOVA based on Tukey's post-hoc test). That is, it was suggested that the degree of improvement in neurological symptoms after cerebral infarction varied depending on the strength of the expression inhibition of Zfp384. Figure 9 The verification of the ASO shown to have an expression inhibition effect on Zfp384 in BV2 was conducted against the mRNA sequence corresponding to the DNA-binding domain of the ZFP384 protein Figure 11 This is based on the fact that the DNA-binding domain of the ZFP384 protein plays an important role in reducing the expression of repair-related genes such as IGF1. Specifically, in BV2 cells, expression of the full-length ZFP384 protein, mutant proteins with deletions of the N-terminus or C-terminus of ZFP384, significantly reduced IGF1 expression was observed. However, expression of mutant ZFP384 proteins with deletions of the DNA-binding domain had no effect on IGF1 expression (n=3) (***p<0.001, one-way ANOVA based on Dunnet post-hoc test). This clarifies that even overexpression of only the DNA-binding domain of the ZFP384 protein in BV2 can significantly reduce IGF1 expression (n=3) (****p<0.0001, two-sided t-test).

[0190] (4) On the other hand, even when expressing the shRNA targeting Zfp384 (GCTCAGACTTTCCCTATTTTCAAGAGAAATAGGGAAAGTCTGAGCT GC (Sequence No. 15)), an inhibitory effect on Zfp384 expression and an enhancing effect on Igf1 expression were observed in BV2. Figure 12 (n=2), therefore, it can be used as an example for the treatment of brain injuries such as cerebral infarction. Furthermore, the expression inhibition effect of ZFP384 protein in BV2 was verified by using an E3 ligase ligand that binds to the DNA motif sequence that binds to the ZFP384 protein via protein knockdown. ZFP384 protein is a transcription factor that binds to double-stranded DNA with the TTTTT-AAAAA sequence. Therefore, it is believed that by attaching a low-molecular-weight E3 ubiquitin ligase to the oligonucleotide (7dAT) (5'-CTTTTTTTGAGAAAAAAAAG-3' (Sequence No. 16)) that can act as a decoy for ZFP384 protein, this E3 ubiquitin ligase can ubiquitinate the protein and induce proteasome-based degradation, thereby selectively degrading ZFP384 protein. Three E3 ligands were prepared: VHL ligand known as PROTAC, cIAP ligand known as SNIPER, and pomalidomide, a thalidomide derivative. 7dAT and E3 ligase ligand were added to the microglial cell line BV2 to bind 7dAT. After 72 hours, the protein was recovered, and the amount of ZFP384 protein was quantified by Western blot. The results showed that no concentration-dependent effect was observed in the sample with added E3 ligase ligand to bind 7dAT, but a tendency to decrease the amount of ZFP384 protein was observed. In fact, due to the observed tendency to decrease the amount of ZFP384 protein, it can be considered that protein knockdown can also be applied to the treatment of brain injuries such as cerebral infarction. Figure 13 (n=1).

[0191] [Investigation]

[0192] In the present embodiment, the cell fate of microglia cells that assume a repair function was clarified, and based on the finding of the transcription factor ZFP384 that causes loss of the repair function, a groundbreaking nucleic acid (drug candidate) that continuously promotes the repair function was discovered. In the present embodiment, by inhibiting the action of ZFP384, the chromatin state in microglia cells that assumes a nerve repair was maintained, and as a result, the functional recovery after cerebral infarction was successfully maintained. As a means of inhibiting the action of ZFP384, in addition to antisense oligonucleotides (ASOs), the design and development of all nucleic acid drugs that inhibit the expression of Zfp384, block the action thereof, and the like, such as artificial nucleic acids that function as decoys for Zfp384, can be considered. In addition to nucleic acid drugs, the development of low-molecular-weight compounds that have a blocking action on Zfp384, compounds designed in a manner that specifically promotes the decomposition of ZFP384 protein, and the like, can be considered. As advantages of nucleic acid drugs, the following can be cited: long-term pharmacological effects can be expected even with a small number of administration times; and uptake into microglia cells is relatively high, and pharmacological effects are exhibited. In human patients, for example, intrathecal administration can be considered by lumbar puncture, and a method in which the drug reaches the brain ventricles based on the specific gravity of the drug can be considered. The same method is widely used in ventriculography performed on patients with normal pressure hydrocephalus, and administration of nucleic acid drugs using lumbar puncture has already been performed on patients with spinal muscular atrophy. Such a treatment strategy can be applied to trauma of the central nervous system in addition to cerebrovascular disorders (stroke) such as cerebral infarction and cerebral hemorrhage.

[0193] In past reports, the concept and examples of developing therapeutic drugs by using nucleic acid drugs to act on microglia cells are few. The ASO-Zfp384 developed by the present inventors can bring long-term effects on microglia cells in the brain by intracerebroventricular administration. The present inventors verified several ASOs and determined a target sequence that effectively inhibits the expression of Zfp384. In fact, in the present embodiment, the most effective ASO was administered intracerebroventricularly to mice on day 8 after the onset of cerebral infarction, and the continuation, maintenance of the repair effect, and improvement of neurological symptoms on days 28 to 56 after the onset (equivalent to 3 to 6 months after the onset in patients with cerebral infarction) were confirmed. Figure 14 The treatment strategy of using ASO-Zfp384 and the like to maintain brain function recovery over the long term is very groundbreaking for the medical treatment of modern brain injury patients, who are mainly treated with rehabilitation.

[0194] Industrial applicability

[0195] According to the present application, it is possible to provide a pharmaceutical composition which is useful for the treatment of brain damage caused by cerebrovascular disorder, traumatic brain injury, a therapeutic agent for the brain damage, a therapeutic method for the brain damage, and a screening method for a compound which is an effective ingredient of the pharmaceutical composition, the therapeutic agent, and the like.

[0196] Free text of sequence listing

[0197] SEQ ID NOs: 3-16: Synthetic oligonucleotides< / shrna>

Claims

1. A pharmaceutical composition comprising a compound that blocks or inhibits expression of a Zfp384 gene or a compound that has a blocking or inhibiting activity against a ZFP384 protein, or a prodrug thereof, or a pharmacologically acceptable salt thereof, or a hydrate or solvate thereof.

2. The pharmaceutical composition according to claim 1, which is used for the treatment of brain damage caused by a cerebrovascular disorder or traumatic brain injury.

3. The pharmaceutical composition of claim 2, wherein, The cerebrovascular disorder is stroke, preferably cerebral infarction, cerebral hemorrhage or subarachnoid hemorrhage.

4. The pharmaceutical composition of claim 2, wherein, The treatment is recovery of neurological symptoms in brain damage, or continuation and / or restart of the recovery thereof.

5. The pharmaceutical composition of claim 1, wherein, The compound that blocks or inhibits expression of a Zfp384 gene comprises a nucleic acid comprising a sequence complementary to at least a part of a base sequence of the gene.

6. The pharmaceutical composition of claim 5, wherein, The at least a part of a base sequence of the gene comprises at least a part of a base sequence encoding a DNA binding domain of a ZFP384 protein.

7. The pharmaceutical composition of claim 1, wherein, The compound that has a blocking or inhibiting activity against a ZFP384 protein is one or a combination of two or more selected from the group consisting of a decoy nucleic acid, a compound that decomposes the protein, and a compound that induces decomposition of the protein.

8. A therapeutic agent for brain damage caused by a cerebrovascular disorder or traumatic brain injury, which comprises a compound that blocks or inhibits expression of a Zfp384 gene or a compound that has a blocking or inhibiting activity against a ZFP384 protein, or a prodrug thereof, or a pharmacologically acceptable salt thereof, or a hydrate or solvate thereof.

9. A method for treating brain damage caused by a cerebrovascular disorder or traumatic brain injury, the method comprising the step of administering the pharmaceutical composition according to claim 1 or the therapeutic agent according to claim 8 to a subject who has or is likely to have brain damage caused by a cerebrovascular disorder or traumatic brain injury.

10. A screening method for a compound that blocks or inhibits expression of a Zfp384 gene or a compound that has a blocking or inhibiting activity against a ZFP384 protein, the screening method comprising the steps of: adding a candidate compound to microglial cells that overexpress a ZFP384 protein, and evaluating the candidate compound for blocking or inhibiting expression of a Zfp384 gene or for having a blocking or inhibiting activity against a ZFP384 protein.

11. A pharmaceutical composition for treating brain damage caused by a cerebrovascular disorder or traumatic brain injury, or a therapeutic agent for the brain damage, which comprises a compound obtained by the screening method according to claim 10, or a prodrug thereof, or a pharmacologically acceptable salt thereof, or a hydrate or solvate thereof.

Images