Novel promoter and application

Abstract

The invention provides a novel promoter and application thereof. The promoter comprises a nucleotide sequence as shown in any one of SEQ ID NO: 4 to SEQ ID NO: 27. According to the invention, 24 promoters with high relative fluorescence intensity are screened to further construct a series of inducible expression systems suitable for corynebacterium arrest, and the inducible expression systems are suitable for escherichia coli and corynebacterium arrest at the same time; the expression quantity of the alpha-amylase protein in the corynebacterium arrest is investigated by taking a part of the induced expression system as an example, and the enzyme activity is obviously improved.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to novel promoters and their applications. Background Technology

[0002] In the fields of molecular biology, genetic engineering, and microbiology, the construction of induction systems is an important research direction. Particularly in bacteria, the establishment of induction systems allows for the control of exogenous gene expression, which is of great significance for gene function research, protein production, and bioengineering applications.

[0003] Corynebacterium stationis is an important industrial microorganism widely used in the production of amino acids, antibiotics, and other chemical products. With the completion of genome sequencing of this important industrial microorganism and the continuous improvement of related protein functional annotations, the accumulation of relevant genetic information has made it possible to apply modern technologies such as synthetic biology and metabolic engineering to enhance the application of modern biological methods to target products, potentially making it the next excellent industrial production substrate.

[0004] The repressor protein CymR, derived from *Pseudomonas putidaf1*, can bind to the operator gene CuO on the chromosome, preventing transcription and protein expression of genes downstream of CuO. Upon binding to propylbenzoic acid (Cumate), CymR dissociates from CuO, allowing transcription and expression of genes downstream of CuO. The key to the applicability of this induction system lies in constructing promoter elements on plasmids or chromosomes that constitutively regulate the appropriate expression of the repressor protein CymR. Currently, inducible expression systems constructed based on these elements have shown robust induction in *Escherichia coli*, *Corynebacterium glutamicum*, and mammalian cells, but no research progress has been made in its application in *Corynebacterium stallion*, an industrial microorganism with important applications.

[0005] Among existing induction systems for Corynebacterium stationaryae, a commonly used system is the induction of the lacZ gene expression using IPTG (isopropyl-β-D-thiogalactoside). This method relies on the strength of the T7 promoter upstream of the lacZ gene to control gene expression. However, IPTG is expensive and may have some cytotoxicity. Although existing IPTG induction systems have solved the gene expression induction problem to some extent, some shortcomings remain. First, the high cost of IPTG limits its application in industrial production. Second, the use of IPTG may be cytotoxic, affecting cell growth and metabolism. Therefore, there is a need to develop a more economical, safe, and efficient induction system to meet the needs of Corynebacterium stationaryae research and industrial applications. Summary of the Invention

[0006] The purpose of this invention is to improve the accuracy of Corynebacterium catarrhalis induction expression, reduce cytotoxicity, and reduce the cost of the induction expression system, thereby providing novel promoters and applications.

[0007] To achieve the above technical objectives, the technical solution adopted in this application is as follows:

[0008] In a first aspect, the present invention provides a promoter comprising a nucleotide sequence as shown in any one of SEQ ID NO:4 to SEQ ID NO:27.

[0009] Secondly, the present invention provides an inducible expression system suitable for Corynebacterium tarda, the inducible expression system comprising the promoter, target gene, repressor protein gene, operator gene, strong promoter, ribosome binding site, and expression vector described in the first aspect; wherein, the promoter described in the first aspect is used to initiate the repressor protein gene, and the strong promoter is used to control the expression of the operator gene; the ribosome binding site includes: a ribosome binding site for controlling the expression of the target gene, and a ribosome binding site for controlling the expression of the repressor protein gene.

[0010] Preferably, the repressor protein gene includes CymR.

[0011] Preferably, the expression vector is P19_PTP_KanR_BsaI, having the sequence shown in SEQ ID NO:32.

[0012] Preferably, the manipulator gene comprises CuO having the sequence shown in SEQ ID NO:2.

[0013] Preferably, the strong promoter is tacMM, having the sequence shown in SEQ ID NO:3.

[0014] Preferably, the promoter is a nucleotide sequence as shown in SEQ ID NO:23.

[0015] Thirdly, the present invention provides a microorganism comprising the inducible expression system described in the second aspect.

[0016] Fourthly, the present invention provides a method for preparing a target substance encoded by an expression target gene, comprising assembling the inducible expression system described in the second aspect with a target gene fragment, and then transferring it into a microbial culture.

[0017] Preferably, an inducer is added during the microbial culture process; more preferably, the inducer is p-propylbenzoic acid.

[0018] More preferably, the final concentration of p-propylbenzoic acid in the culture system is 0.10–0.20 mM.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] This invention screened 24 promoters with relatively high fluorescence intensity from the *Corynebacterium glutamicum* ATCC13032 pyruvate carboxylase (Pyc) promoter library, and used these promoters to construct a series of inducible expression systems suitable for *Corynebacterium stationaryum*. These inducible expression systems are also applicable to *Escherichia coli* and *Corynebacterium stationaryum*. Taking some of these inducible expression systems as examples, the expression level of α-amylase protein in *Corynebacterium stationaryum* was examined. The differences in α-amylase activity measured based on the varying promoter intensities were significant, and the inducible expression systems significantly increased enzyme activity. The inducible expression systems of this invention can be applied to Gram-negative and Gram-positive bacteria for the expression of Cas9 protein or recombinant enzymes, etc. Attached Figure Description

[0021] Figure 1 This refers to the artificial starter sub-library constructed in Example 1.

[0022] Figure 2 This is the screening backbone for the Cumate-induced expression system in Example 2.

[0023] Figure 3 The relative fluorescence intensity represents the induced expression system screened by different promoters in Example 3. Detailed Implementation

[0024] In the description of this invention, it should be noted that unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0025] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0026] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0027] Example 1:

[0028] This embodiment performs artificial promoter screening as follows:

[0029] The artificial promoter of this invention is derived from the promoter sequence of pyruvate carboxylase (Pyc) from Corynebacterium glutamicum ATCC13032. The core regions -35 and -10 are determined, and a promoter library is generated (see Chinese Patent 202211309420.9). The library sequence is: TAGCTNNNNNNATNNTANNNNNNNNNNNNNNNAATCAANNNNNNCAGGT (SEQ ID NO:30);

[0030] Furthermore, BsaⅠ restriction sites and extension protection sequences were designed and added to both ends of the promoter to form a template (the promoter library was synthesized by Genewiz Biotechnology Co., Ltd.). The promoter nucleotide sequence library is as follows:

[0031] AAAGGTCTCTAGCTNNNNNNATNNTANNNNNNNNNNNNNNNAATCAANNNNNNNCAGGTGAGACCCGTGAGCTA (SEQ ID NO: 31);

[0032] S1: The obtained promoter library was annealed and amplified using primer Promoter-F (TAGCTCACGGGTCTCACCTG, SEQ ID NO:40) to obtain the promoter double-stranded fragment. The nucleic acid concentration was detected using a NanoDrop Spectrophotometer, with 70 ng / μL reserved for later use.

[0033] S2: The obtained promoter double-stranded fragment and the P19_PTP_KanR_BsaI plasmid vector (SEQ ID NO:32) were ligated with T4 ligase and BsaI restriction endonuclease and GoldenGate was performed to obtain the recombinant plasmid P19_Promoter_GFP containing the promoter.

[0034] SEQ ID NO:32

[0035]

[0036] S3: The obtained recombinant plasmid P19_Promoter_GFP was transformed into Escherichia coli DH5α, plated on LB solid medium containing 40 μL / mL kanamycin and cultured overnight. After the colonies growing on the plate were washed into test tubes with 2 mL of LB liquid medium containing 40 μL / mL kanamycin, they were cultured overnight again and the plasmid was extracted and stored at -20℃.

[0037] S4: The promoter plasmid obtained from S3 was introduced into Corynebacterium ATCC6872 via electroporation. The plasmid was then plated on LBHis solid medium and kanamycin was used as a selection marker to obtain a recombinant strain that showed fluorescence under blue light.

[0038] S5: A total of 101 recombinant strains obtained from S4 were selected and inoculated into well plates containing LBB liquid medium. The plates were cultured at 800 rpm / min for 22 hours. The fermentation broth was diluted 20 times with water, and the OD600 and fluorescence intensity (excitation wavelength 485 nm, emission wavelength 515 nm) were measured.

[0039] S6: Different strains obtained from S5 were sorted by relative fluorescence intensity. One strain out of every 4-5 strains was sequenced, and 24 recombinant strains were finally identified and named P1 to P24. The nucleotide sequences are shown in SEQ ID NO:4-SEQ ID NO:27, and the relative fluorescence intensities of their corresponding promoters are shown in... Figure 1 .

[0040] SEQ ID NO:4

[0041] CTAGAGTTGATTAGAAGAAAACTTAGCTAGGATTCTAAA.

[0042] SEQ ID NO:5

[0043] AGAAACTTGATTGCGTTATCCTTGCGTTATGATATGTGC.

[0044] SEQ ID NO:6

[0045] CCCCTGTTGATTTCCCGACACATATTATAGCATTGTCGC.

[0046] SEQ ID NO:7

[0047] AGATTATTGATTTTCCGTGTTAGCCGTTATCATAGTAGC.

[0048] SEQ ID NO:8

[0049] AACCCATTGATTAGACAGTATGGCCTATAATATATCAGT。

[0050] SEQ ID NO:9

[0051] GCCGCTTTGATTACTTTCAACCAGGACTATCATAATATA。

[0052] SEQ ID NO:10

[0053] AACTTGTTGATTTTGTAAGACTACATCTAGTATAACTCG

[0054] SEQ ID NO:11

[0055] AAGCGATTGATTCCAGATGATATATCATAACATTATTGA。

[0056] SEQ ID NO:12

[0057] CTTCCATTGATTTCTGCTCCGCCCGTGTATAATTGTTCA。

[0058] SEQ ID NO:13

[0059] CGCCAATTGATTTCAATGGTATATCCTTACCATGGGCCC。

[0060] SEQ ID NO:14

[0061] TGAAAATTGATTATTGCGATTAAACAGTATTATTCCAAA。

[0062] SEQ ID NO:15

[0063] GATCTGTTGATTTGAAGACTTTTAAAGTACCATTACATG。

[0064] SEQ ID NO:16

[0065] CACCAATTGATTTACCGCTAAAGACTTTAGGATGAAGTA。

[0066] SEQ ID NO:17

[0067] AGGTAATTGATTAACCCCCGAGTATGTTAGCATGCTCAT。

[0068] SEQ ID NO:18

[0069] CCAAAATTGATTAGCATCAGTCCCGTATATAATCTTTGT。

[0070] SEQ ID NO:19

[0071] ACCATCTTGATTTTCCAGCCTAGATATTATGATTCATGC。

[0072] SEQ ID NO:20

[0073] CACCCATTGATTTGCTGTACCCTAGTCTATAATGGCCGT。

[0074] SEQ ID NO:21

[0075] TAGAGCTTGATTGCACTTCGACAAGCCTATAATGTAAAA。

[0076] SEQ ID NO:22

[0077] GCGGAATTGATTGGTTAGGACAAACCGTAATATAATAAT。

[0078] SEQ ID NO:23

[0079] TGAAAATTGATTTAAACTTGGGCATGTTAAGATAAGTGG。

[0080] SEQ ID NO:24

[0081] TGTGATTTGATTGAAAATCTAAAGAGGTATTATATACCC。

[0082] SEQ ID NO:25

[0083] AACCGGTTGATTTAAAGATCCTTAGGATATCATTCAATT。

[0084] SEQ ID NO:26

[0085] ATACTATTGATTGAACTTTCTCGTCAGTACGATTCTTTT。

[0086] SEQ ID NO:27

[0087] CGGCAATTGATTGCCCCCCACCACCGCCTACCATCGACTA.

[0088] Example 2:

[0089] This embodiment describes the construction of the Cumate-induced expression system, as detailed below:

[0090] In the Cumate-induced expression system, the expression level of the repressor protein directly affects the promoter strength. When the repressor protein expression level is too high, adding cumate inducer cannot completely relieve the repression, resulting in excessively low expression of the target gene, which cannot be precisely controlled. Conversely, when the repressor protein expression level is too low, it cannot saturately bind to the operon, leading to severe gene leakage and making it impossible to regulate expression intensity. Therefore, a Cumate-induced expression system plasmid (P19-cumate-test-CymR) was designed. Figure 2 As shown, the Cumate-induced expression system includes: a repressor protein CymR gene, a promoter for initiating the CymR gene, a ribosome binding site RBS2, a tacMM promoter, an operator gene CuO, a spacer sequence RiboJ, a ribosome binding site RBS1, sfGFP green fluorescent protein, and an expression vector. The CymR gene is a repressor protein CymR gene expressed under the control of the Corynebacterium glutamicum promoter, and its nucleotide sequence is shown in SEQ ID NO:1. The promoter for initiating the CymR gene is the P1-P24 promoter constructed in Example 1; the nucleotide sequence of the operator gene CuO is shown in SEQ ID NO:2. tacMM is a promoter derived from the backbone of the strong promoter Ptac, and its nucleotide sequence is shown in SEQ ID NO:3. Two important ribosome binding sites are identified. One is the ribosome binding site controlling the expression of the target gene sfGFP, denoted as RBS1, with its nucleotide sequence shown in SEQ ID NO:28. The other is the ribosome binding site controlling the expression of the repressor protein gene CymR, denoted as RBS2, with its corresponding nucleotide sequence shown in SEQ ID NO:29. The expression vector is P19_PTP_KanR_BsaI.

[0091] SEQ ID NO:1

[0092] 。

[0093] SEQ ID NO:2

[0094] ACAAAGACAATCTGGTCTGTTTGTATT。

[0095] SEQ ID NO:3

[0096] TTGAGAATTAATCATCGTGTGGTACCATGTGTGGA。

[0097] SEQ ID NO:28

[0098] AAAGGAGGAAACTTTA.

[0099] SEQ ID NO:29

[0100] TACTAGAAAGGAGAAATACTAG.

[0101] In this embodiment, the most preferred Cumate-induced expression system is the artificial promoter P20 (SEQ ID NO:23).

[0102] The Cumate-induced expression system is well adapted to Corynebacterium catarrhalis and can be loaded with exogenous genes from Corynebacterium catarrhalis. It should be noted that this Cumate-induced expression system is also applicable to other microbial systems; this explanation focuses on Corynebacterium catarrhalis as an example.

[0103] Construction of P19-cumate-test-CymR plasmid:

[0104] The P19-cumate-test-CymR plasmid was constructed using the P19_PTP_KanR_BsaI vector, RBS1, CymR gene, tacMM, CuO, RBS2, and sfGFP genome, as follows:

[0105] Step 1: P19_PTP_KanR_BsaI was amplified by PCR using the following primers and then recovered by gel extraction to obtain fragment S1;

[0106] Primer-1F:ATGCGTAAAGGCGAAGAGCT (SEQ ID NO:33);

[0107] Primer-1R:GGGGATCCTCTAGAGTCGACCT (SEQ ID NO:34);

[0108] Step 2: Fragment S2 (genetically synthesized by Beijing Qingke) containing CymR, RBS2, the substitution region promoter test, tacMM, CuO, Riboj, and RBS2 was obtained by gene fragment synthesis, totaling 1001 bp.

[0109] S2 fragment (SEQ ID NO:35):

[0110]

[0111] Step 3: The two fragments S1 and S2 were assembled using a Gibson cloning enzyme, transformed into *E. coli* DH5α, and plated on a Kanr antibody plate to obtain clones. After propagation of the clones, plasmid extraction was performed to obtain the P19-cumate-test-CymR plasmid, in which the sfGFP gene uses tacMM as the promoter and RBS2 as the ribosome binding site. Here, promoters of different strengths from the promoter library were selected as test promoters. Molecular cloning was performed using GoldenGate with the artificial promoter double-stranded sequences P1-P24 under the action of T4 ligase and BsaI restriction endonuclease, resulting in P19_P1_CymR, P19_P2_CymR, ..., P19_P24_CymR.

[0112] Example 3:

[0113] The 24 different promoters obtained in Example 2 were applied in the cumate-induced system as follows:

[0114] The P19_0_CymR plasmid was constructed following the same method as the P19-cumate-test-CymR plasmid. The difference between the P19_0_CymR and P19_cumate-test-CymR plasmids is that the CymR gene lacks a corresponding promoter sequence, therefore CymR is not expressed. A total of 25 plasmids, including the 24 plasmids obtained in Example 2 and the P19_0_CymR plasmid, were electroporated into Corynebacterium ATCC 6872. After plating on LBhis agar plates containing 25 mg / L kanamycin, single colonies were picked and inoculated into 10 mL of LBhis liquid medium containing 25 mg / L kanamycin. The cultures were incubated at 220 rpm and 30°C for 12 h to obtain 25 bacterial suspensions.

[0115] Each of the above bacterial cultures was divided into two portions and inoculated into two 50 mL Erlenmeyer flasks containing 10 mL of 25 mg / L kanamycin in LBhis liquid medium, with an initial OD600 of 0.3. One flask was supplemented with 0.15 mM cumate inducer, while the other contained no cumate inducer. Induction was performed at 220 rpm and 30 °C. After 24 h of induction, 1 mL of bacterial culture was collected from both the induction and non-induction flasks for each culture. The cells were collected by centrifugation at 4500 rpm for 10 min, washed once with 30 mM Tris / HCl (pH 8.0) buffer, resuspended in buffer, and diluted to an OD600 between 0.7 and 0.9. Fluorescence intensity was measured at an emission wavelength of 485 nm and an absorption wavelength of 515 nm. Fluorescence intensity (fluorescence measurement / OD600) was used to represent the sfGFP unit expression level.

[0116] Measurement of relative fluorescence intensity of bacterial cells containing 25 plasmids, as follows Figure 3 As shown, except for P19_0_CymR, among the 25 plasmids constructed in this invention, there were significant differences in fluorescence intensity between bacterial cultures induced with and without cumate after 24 hours of culture. Among them, under the p20 promoter condition, the relative fluorescence intensity showed the largest fold difference between bacterial cultures induced with cumate (final concentration of 0.15 mM) and those induced without cumate after 24 hours of culture. This indicates that CymR expression is relatively balanced under this promoter strength, with low local leakage and no decrease in fluorescence intensity due to excessive CymR protein expression. Therefore, the P20 promoter element is most suitable for this cumate-induced system.

[0117] Example 4:

[0118] Based on the results of Example 3, this embodiment investigated the effect of certain promoters and their cumate-induced expression systems on increasing the expression level of α-amylase protein in Corynebacterium tarda. The specific operation is as follows:

[0119] Step 1: Using primers Primer-amy-F and Primer-amy-R, the gene fragment containing α-amylase (EC3.2.1.1) was amplified using the whole genome of Bacillus subtilis as a template. After recovery, fragment A1 was obtained.

[0120] Primer-amy-F:atgtttgcaaaacgattcaaaacctctttact (SEQ ID NO: 36);

[0121] Primer-amy-R:tcaatggggaagagaaccgctt(SEQ ID NO:37);

[0122] Step 2: Using primers p19-cumate-F and p19-cumate-R, the plasmids P19_0_CymR and the more stringent P19_p18_test_CymR, P19_p20_test_CymR, and P19_p22_test_CymR from the aforementioned Cuamte system were amplified and recovered to obtain fragments L0, L18, L20, and L22. The selection of these promoters was based on... Figure 2 The fluorescence intensity and stringency of the cumate system shown are represented by three superior promoters. This does not mean that this invention can only use these three promoters, but that all 24 promoters obtained can be used. This is hereby stated.

[0123] p19-cumate-F:gcggttctcttccccattgaGGGTACCGAGCTCGAATTCAG (SEQ ID NO: 38);

[0124] p19-cumate-R:ttgaatcgttttgcaaacatTAAAGTTTCCTCCTTTTTAAACAAAATTATTTGTAGAGGCT (SEQ ID NO: 39);

[0125] Step 3: Fragment A1 was assembled with L0, L18, L20, and L22 using Gibson assembly and then introduced into E. coli DH5α. The fragments were then plated on LB solid plates containing Kanr resistance. After obtaining single clones, they were propagated and plasmids were extracted to obtain the corresponding plasmids: P19_0_CymR_Amy, P19_P18_CymR_Amy, P19_P20_CymR_Amy, and P19_P22_CymR_Amy.

[0126] Step 4: The recombinant plasmids obtained above and P19_0_CymR (negative control) were transformed into Corynebacterium ATCC6872, plated on LBHis solid medium, and kanamycin was used as a selection marker to obtain recombinant strains C.Sta_0_CymR (negative control), C.Sta_0_CymR_Amy, C.Sta_P18_CymR_Amy, C.Sta_P20_CymR_Amy, and C.Sta_P22_CymR_Amy.

[0127] Step 5, seed activation of recombinant strains: Using the C. sta_0_CymR strain with empty vector plasmid as a negative control, and the recombinant strains C. Sta_0_CymR_Amy, C. Sta_P18_CymR_Amy, C. Sta_P20_CymR_Amy, and C. Sta_P22_CymR_Amy as experimental groups, they were inoculated into 2 mL of LBB liquid medium (20 μL / mL kanamycin) and cultured at 30℃ and 220 rpm for 12 hours to obtain seed culture solution.

[0128] Step 6: Prepare two batches of the seed culture solution. Inoculate each batch with the same initial OD in 50 mL Erlenmeyer flasks containing 10 mL of LBB fermentation medium. Ferment and culture at 30°C and 220 rpm for 20 hours. Then, add 25 μg / mL cumate inducer to induce fermentation for 4 hours to obtain the fermentation broth. Also prepare a separate fermentation broth for 24 hours without adding cumate inducer. Then, detect the α-amylase (amyE) expression level in the fermentation broth.

[0129] α-Amylase (amyE) expression level detection method: Amylase activity was determined using the EnzChek™ Amylase Assay Kit (catalog number E33651). The fermentation broth was centrifuged after cell disruption, and the supernatant was collected at 6000 rpm. One unit of enzyme activity (U / ml) was defined as the amount of enzyme required to release 1 mg of maltose from starch within 3 minutes at 20°C and pH 6.9. Each strain was tested in triplicate. The results are shown in Table 1 below.

[0130] Table 1

[0131]

[0132]

[0133] The plasmid P19_p20_CymR_Amy, mediated by promoter P20, induced the best amylase activity, which was 2.1 times that of the constitutively expressed P19_0_CymR_Amy α-amylase.

[0134] In summary, this invention constructs a cumate-induced expression system using screened promoters, offering the following advantages:

[0135] 1. Reduced cost: The induction expression system for Corynebacterium catarrhalis constructed in this invention uses inexpensive p-propylbenzoic acid, which can significantly reduce the cost of the induction expression system.

[0136] 2. No cytotoxicity issues: The induction expression system of this invention avoids the use of IPTG and instead uses low-concentration, inexpensive, and non-toxic p-propylbenzoic acid as an inducer, thereby reducing the risk of cytotoxicity.

[0137] 3. The plasmid vector containing the cumate induction system is a shuttle plasmid for both Escherichia coli and Corynebacterium catarrhalis, and is suitable for both strains.

[0138] 4. The cumate induction system of the present invention can be applied to Gram-negative and Gram-positive bacteria for the expression of Cas9 protein or recombinase, etc.

[0139] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A promoter, characterized in that, It contains a nucleotide sequence as shown in any one of SEQ ID NO:4 to SEQ ID NO:

27.

2. An inducible expression system, characterized in that, The inducible expression system comprises the promoter, target gene, repressor protein gene, operator gene, strong promoter, ribosome binding site, and expression vector as described in claim 1; wherein, the promoter as described in claim 1 is used to initiate the repressor protein gene, and the strong promoter is used to control the expression of the operator gene; the ribosome binding site includes: a ribosome binding site for controlling the expression of the target gene, and a ribosome binding site for controlling the expression of the repressor protein gene.

3. The inducible expression system according to claim 2, characterized in that, The repressor protein gene includes CymR.

4. The inducible expression system according to claim 2, characterized in that, The expression vector is P19_PTP_KanR_BsaI, which has the sequence shown in SEQ ID NO:

32.

5. The inducible expression system according to claim 2, characterized in that, The operator gene includes CuO, having the sequence shown in SEQ ID NO:

2.

6. The inducible expression system according to claim 5, characterized in that, The strong promoter is tacMM, which has the sequence shown in SEQ ID NO:

3.

7. A microorganism, characterized in that, It includes the inducible expression system according to any one of claims 2 to 6.

8. A method for preparing a target substance encoded by an expression target gene, characterized in that, This includes assembling the inducible expression system according to any one of claims 2 to 6 with a target gene fragment, and then transferring it into microbial culture.

9. The method according to claim 8, characterized in that, An inducer is added during the cultivation of the microorganism; preferably, the inducer is p-propylbenzoic acid.

10. The method according to claim 9, characterized in that, The final concentration of p-propylbenzoic acid in the culture system is 0.10–0.20 mM.

Images