Application of wheat disease resistance factor TaC4H1 in leaf rust prevention
By overexpressing the gene encoding the disease resistance factor TaC4H1 in wheat, the problem of insufficient resistance of wheat varieties to leaf rust was solved, achieving stable improvement of wheat resistance and environmentally friendly control effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-18
- Publication Date
- 2026-03-27
AI Technical Summary
Existing wheat varieties face challenges in resisting wheat leaf rust. Frequent use of fungicides has led to the emergence of resistant strains and environmental pollution. It is necessary to discover new disease-resistant gene resources to achieve sustainable and green prevention and control.
By utilizing the gene encoding the wheat disease resistance factor TaC4H1, a recombinant overexpression vector was constructed through an Agrobacterium-mediated genetic transformation system. Overexpression of the TaC4H1 gene in wheat enhanced its resistance to leaf rust.
Wheat lines with stable overexpression of the TaC4H1 gene were obtained, significantly improving resistance to wheat leaf rust, providing a pathway for breeding disease-resistant varieties, and offering an environmentally friendly and effective method for the control of wheat leaf rust.
Smart Images

Figure CN120944945B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and relates to application of a wheat disease resistance factor TaC4H1 in leaf rust prevention. BACKGROUND
[0002] Wheat leaf rust is a biotrophic fungal disease caused by Puccinia triticina. Puccinia triticina The pathogen mainly invades wheat leaves and sometimes damages leaf sheaths, and even spreads to stems and ears in severe cases. The spores produced by the pathogen adhere to the leaf surface, significantly hindering the normal process of photosynthesis, causing damage to the energy metabolism of wheat, and ultimately affecting the yield and quality of wheat. In addition, uredospores can be transmitted over long distances by wind, and can undergo multiple cycles of infection within a growing season, thereby causing widespread prevalence of leaf rust.
[0003] In the prevention and control of wheat leaf rust, two means are mainly relied on, i.e. the use of fungicides and the planting of disease-resistant varieties. However, the frequent use of fungicides has led to the emergence of drug-resistant strains, and has also caused environmental pollution problems. Compared with the use of fungicides, the promotion of disease-resistant varieties is a more environmentally friendly and effective prevention and control measure, and the screening of excellent disease-resistant genes is the key to the breeding of disease-resistant varieties. At present, wheat varieties carrying resistance genes have achieved certain results in controlling leaf rust, but new races can often break through the resistance defense of these varieties, making the disease resistance of many cultivated varieties face unprecedented challenges. Therefore, it is urgent to explore new disease-resistant gene resources and create new disease-resistant germplasm materials to achieve sustainable and green prevention and control of wheat leaf rust. SUMMARY
[0004] In view of the above technical problems and defects, the application provides application of a wheat disease resistance factor TaC4H1 in leaf rust prevention, and the function of the disease resistance factor TaC4H1 in the interaction between wheat and the pathogen is determined, thereby providing more excellent disease-resistant genes for leaf rust resistance breeding.
[0005] In a first aspect, the application provides application of a wheat disease resistance factor TaC4H1 in leaf rust prevention, and the wheat disease resistance factor TaC4H1 plays a positive regulation role in the immune response of wheat against leaf rust.
[0006] Further, in the application of the wheat disease resistance factor TaC4H1 in leaf rust prevention, the coding gene CDS sequence of the wheat disease resistance factor TaC4H1 is as shown in SEQ ID NO: 1, and the amino acid sequence is as shown in SEQ ID NO: 2.
[0007] Further, the wheat disease resistance factor TaC4H1 provided by the present application is used in the application of preventing and treating leaf rust, and the wheat disease resistance factor TaC4H1 is overexpressed to improve the resistance of the wheat to leaf rust.
[0008] In a second aspect, the present application provides a method for cultivating a wheat variety resistant to leaf rust, and the coding gene of the wheat disease resistance factor TaC4H1 is overexpressed.
[0009] Further, the method for cultivating a wheat variety resistant to leaf rust provided by the present application comprises the following steps: constructing a recombinant overexpression vector, and transforming the recombinant overexpression vector into the wheat.
[0010] The recombinant overexpression vector contains the coding gene of the wheat disease resistance factor TaC4H1.
[0011] Further, in the method for cultivating a wheat variety resistant to leaf rust provided by the present application, the transformation method is the Agrobacterium-mediated genetic transformation method.
[0012] Further, in the method for cultivating a wheat variety resistant to leaf rust provided by the present application, the primer sequence for constructing the recombinant overexpression vector is shown in SEQ ID NO: 5 and SEQ ID NO: 6.
[0013] Compared with the prior art, the technical scheme provided by the present application at least has the following beneficial effects or advantages:
[0014] The present application proves the feasibility of the wheat disease resistance factor TaC4H1 for cultivating a wheat variety resistant to leaf rust. The present application adopts the Agrobacterium-mediated genetic transformation system to obtain a wheat strain capable of overexpressing the disease resistance factor, and by comparing the disease incidence and the expression of the disease resistance related marker genes of the transgenic strain and the ordinary Fielder wheat after being infected with leaf rust THT and PHT, it is known that the wheat disease resistance factor TaC4H1 plays a positive regulation role in the process of the wheat resisting leaf rust. Based on the characteristics of the wheat disease resistance factor TaC4H1, it can be used to create a wheat germplasm material resistant to leaf rust, and is expected to play a practical role in preventing and treating wheat leaf rust. The present application provides an optimal method: a recombinant overexpression vector containing the coding gene of the wheat disease resistance factor TaC4H1 is constructed, and the recombinant overexpression vector is transformed into the wheat plant, and a wheat strain capable of stably overexpressing the disease resistance factor is obtained through subculture. The present application provides a technical approach for cultivating a wheat variety resistant to leaf rust, and provides an environmentally friendly and effective new method for preventing and treating wheat leaf rust. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 To construct TaC4H1 The vector map of the gene overexpression strain.
[0016] Figure 2 To constructTaC4H1 Schematic diagram of PCR detection fragment of gene overexpression strain.
[0017] Figure 3 For TaC4H1 Molecular detection and growth of gene overexpression strain. Among them, A is the PCR verification result of overexpression strain; B is TaC4H1 Relative expression amount of gene in overexpression strain and wild type Fielder wheat plant; C is the growth of overexpression strain at seedling stage; TaC4H1 -OE-T3, TaC4H1 -OE2-T3, TaC4H1 -OE3-T3, TaC4H1 -OE7-T3, OE2-T3, OE3-T3, OE7-T3, OE2, OE3, OE7 are T3 generation overexpression strains, Fielder is wild type Fielder wheat plant, * is P <0.05.
[0018] Figure 4 For TaC4H1 Disease resistance identification results of gene overexpression strain. Among them, A is TaC4H1 Phenotype statistical results of leaf disease of gene overexpression strain and wild type Fielder wheat plant; B is TaPR1 Relative expression amount of gene; C is TaPR2 Relative expression amount of gene; D is TaPR5 Relative expression amount of gene; TaC4H1 -OE, OE2, OE3, OE7 are overexpression strains, Fielder is wild type Fielder wheat plant, * is P <0.05. DETAILED DESCRIPTION
[0019] Next, the technical solutions of the present application will be described in conjunction with examples, but the present application is not limited to the following examples. The experimental methods and detection methods described in each example are all conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.
[0020] Example 1
[0021] This example provides the acquisition of the wheat disease resistance factor TaC4H1 encoding gene.
[0022] The nucleotide sequence of the coding gene of the wheat disease resistance factor TaC4H1 was obtained through the Ensembl Plants (https: / / plants.ensembl.org / Triticum_aestivum / Info / Index) website. The CDS sequence of the coding gene of the wheat disease resistance factor is as follows (SEQ ID NO: 1):
[0023]
[0024] The amino acid sequence of the wheat disease resistance factor TaC4H1 is shown below (SEQ ID NO: 2):
[0025] MAVSARRVAFATAASLAVYWLLKSFLHAPHPALLPAAAALVAVAIAVGAGGGAGAGAPPGPAAVPVFGNWLQVGNDLNHRFLARLSARYGPVFRLRLGVRNLVVVSDPRLATEVLHTQGVEFGSRPRNVVFDIFTANGADMVFTEYGDHWRRMRRVMTLPFFTARVVQQYRSMWEAEMDDVVSDLRGDSAALGAGVVVRRRLQLMLYNIMYRMMFDARFESVDDPMFVEATKFNSERSRLAQSFDYNYGDFIPILRPFLRGYLNKCRDLQTRRLAFFNANYVEKRRKVMETPGEDKNKLRCAIDHILAAEKSGEITPENVIYIVENINVAAIETTLWSIEWALAEVVNHPDVQRKVRGEIRDVLGDDEPITESSISKLPYLQAVIKETLRLHSPIPLLVPHMNLEEASLGGYTIPKGSKVVVNAWWLANNPELWEKPEEFCPERFLGEESNVDATVGGKVDFRFLPFGVGRRSCPGIILALPILALIVGKLVRSFEMVPPPGVDKLDVSEKGGQFSLHIANHSVVAFHPISA;
[0026] Amplification TaC4H1 The primer sequences for the full length of the gene are shown below (SEQ ID NO: 3 and SEQ ID NO: 4):
[0027] TaC4H1 F: 5'-ATGGCTGTCTCCGCGCGCAGGGTGGCCTTC-3' (SEQ ID NO: 3);
[0028] TaC4H1 R: 5'-TGCTGAGATGGGGTGGAAGGCGACGACGGA-3' (SEQ ID NO: 4).
[0029] Example 2
[0030] This example provides the construction of a transgenic line overexpressing.
[0031] According to Figure 1The vector pattern shown, combined with existing technology, utilizes the amplified vector from Example 1. TaC4H1 The full-length gene sequence (SEQ ID NO:1) was obtained through a gateway reaction of homologous recombination. TaC4H1 The full-length amplified fragment of the gene was ligated into the overexpression vector CUB to obtain the recombinant overexpression vector. TaC4H1 -CUB. The recombinant overexpression vector... TaC4H1 -CUB was transfected into wheat Fielder plants using an Agrobacterium-mediated genetic transformation system to obtain plants capable of stable overexpression. TaC4H1 Genetically modified plants.
[0032] Constructing recombinant overexpression vectors TaC4H1 The primers used for CUB are shown below:
[0033] TaC4H1 -CUB-F: 5'-CAGGTCGACTCTAGAGGATCCATGGCTGTCTCCGCGCAGGGTGGCCTTC-3' (SEQ ID NO: 5);
[0034] TaC4H1 -CUB-R: 5'-GAGCTCGGTACCCGGGGATCCTGCTGAGATGGGGTGGAAGGCGACGACGGA-3' (SEQ ID NO: 6).
[0035] To obtain overexpression that can be stably inherited TaC4H1 High-generation wheat lines of the gene, for overexpression TaC4H1 The transgenic plants were cultured in multiple generations until the T3 generation. PCR detection was then performed on the transgenic plants, and a schematic diagram of the detected fragments is shown below. Figure 2 As shown, the detection primers are as follows:
[0036] TaC4H1 -CUB-JC-F:GTGCCTTCCACCCCATCTCAGC (SEQ ID NO:7)
[0037] TaC4H1 -CUB-JC-R:CCCATCTCATAAATAACGTCATG (SEQ ID NO:8)
[0038] Test results as follows Figure 3 As shown in A, T3 generation positive strains (L2, L3 and L7) were selected based on the test results. Figure 3 B in the text is TaC4H1 Relative expression levels in overexpression lines and control groups were analyzed in transgenic plants. TaC4H1The relative expression of the gene is obviously higher than that of the wheat Fielder plant. The growth of the transgenic plant and the wheat Fielder plant at the seedling stage is recorded by taking pictures, as shown in FIG. C of Figure 3 The growth of the transgenic plant is not obviously different from that of the wheat Fielder plant.
[0039] Example 3
[0040] This example provides the disease resistance of the transgenic line overexpressing the gene.
[0041] According to the national standard GB / T 45211.2-2025 Wheat Disease Resistance Evaluation Technical Procedures Part 2: Leaf Rust Method, the leaf surfaces of the high-generation wheat lines overexpressing the gene and the Fielder wheat plants after the second leaf expansion are inoculated with leaf rust strains THT and PHT, respectively, wherein the Fielder wheat plant is used as a control group, and the T3 generation wheat lines overexpressing the gene include TaC4H1 TaC4H1 TaC4H1 -OE2, TaC4H1 -OE3, TaC4H1 -OE7. The disease incidence of each group of plants is observed 12 days after inoculation.
[0042] Figure 4 A of FIG. records the disease incidence of different wheat lines after inoculation with leaf rust physiological races THT and PHT. It can be observed from the figure that under the infection of leaf rust THT and PHT, obvious chlorosis spots and spore heaps can be observed on the leaf surfaces of the Fielder wheat plants and the high-generation wheat plants overexpressing the gene, but the number of spore heaps on the leaf surfaces of the high-generation wheat plants overexpressing the gene is significantly less than that on the leaf surfaces of the Fielder plants. TaC4H1 TaC4H1
[0043] Example 4
[0044] This example provides the relative expression analysis of the disease resistance related marker genes in the transgenic lines overexpressing the gene.
[0045] The leaf surfaces of the T3 generation TaC4H1 gene overexpression lines TaC4H1 -OE2, TaC4H1 -OE3, TaC4H1 -OE7 and the Fielder wheat plants after the second leaf expansion are inoculated with leaf rust THT and PHT, respectively, and sampling is performed 24h and 48h after inoculation for analysis.
[0046] The inoculation site leaves of wheat plants were cut, wrapped with tin foil paper, then put into liquid nitrogen for quick freezing, and stored at -80°C for standby. The total RNA of wheat leaves was extracted by Trizol method, the first strand cDNA was synthesized by using reverse transcriptase XL (AMV), and the cDNA was synthesized by using SMART method. The relative expression amount of the gene was detected by qRT-PCR TaC4H1 According to the sequences of the disease resistance related marker genes TaPR1 、 TaPR2 、 TaPR5 and the elongation factor gene TaEF , specific quantitative PCR primers were designed. The qRT-PCR primer sequences are as follows: TaPR1 -F: 5'-GAGAATGCAGACGCCAAGC-3' (SEQ ID NO: 9);
[0047] TaPR1 -R: 5'-CTGGAGCTTGCAGTCGTTGATC-3' (SEQ ID NO: 10).
[0048] TaPR2 -F: 5'-AGGATGTTGCTTCCATGTTTGCCG-3' (SEQ ID NO: 11);
[0049] TaPR2 -R: 5'-AAGTAGATGCGCATGCCGTTGATG-3' (SEQ ID NO: 12).
[0050] TaPR5 -F: 5'-CAAGCAGTGGTATCAACGCAGAG-3' (SEQ ID NO: 13);
[0051] TaPR5 -R: 5'-GTGAAGCCACAGTTGTTCTTGATGTT-3' (SEQ ID NO: 14).
[0052] TaEF -F: 5'-TGGTGTCATCAAGCCTGGTATGGT-3' (SEQ ID NO: 15);
[0053] TaEF -R: 5'-ACTCATGGTGCATCTCAACGGACT-3' (SEQ ID NO: 16).
[0054] The specificity and amplification efficiency of the qRT-PCR primers need to be detected before use, and the amplification efficiency should be ≥ 90%. The TaEFGenes were used as internal control genes in qRT-PCR analysis. Using AceQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) and Bio-Rad CFX Manager quantitative PCR instrument (Bio-rad, Hercules, California), according to the instructions, the cDNA of different sampling points of each strain was used as a template for qRT-PCR. Each gene was repeated 3 times, and the Ct value, average value and standard deviation of each repeat were generated by manual adjustment of the baseline by quantitative PCR instrument, using 2 -ΔΔCt The experimental data were analyzed by relative quantitative algorithm to determine the relative expression of TaPR1 , TaPR2 and TaPR5 genes.
[0055] The results of qRT-PCR are shown in B, C and D of Figure 4 , Figure 4 B of TaPR1 is a statistical diagram of the relative expression of Figure 4 C of TaPR2 is a statistical diagram of the relative expression of Figure 4 D of TaPR5 is a statistical diagram of the relative expression of TaC4H1 Compared with the control group (Fielder wheat plants), the relative expression of TaPR1 , TaPR2 and TaPR5 genes in the T3 generation transgenic lines overexpressing after inoculation with leaf rust was significantly up-regulated.
[0056] The above-described embodiments are part of the embodiments of the present application, rather than all the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the claimed application, but only represents selected embodiments of the application. All other embodiments obtained by related deduction and replacement made by those skilled in the art under the condition of the concept of the present application, without making creative efforts, belong to the scope of protection of the present application.
Claims
1. Use of the wheat disease resistance factor TaC4H1 in the control of leaf rust, characterized in that, The wheat disease resistance factor TaC4H1 plays a positive regulation role in the immune response of wheat against leaf rust; The CDS sequence of the coding gene of the wheat disease resistance factor TaC4H1 is shown as SEQ ID NO:1, and the amino acid sequence is shown as SEQ ID NO:
2.
2. The use of the wheat disease resistance factor TaC4H1 according to claim 1 for the control of leaf rust, characterized in that, Overexpression of the wheat disease resistance factor TaC4H1 improves the resistance of wheat to leaf rust.
3. A method of breeding a wheat variety resistant to leaf rust, characterized in that, The coding gene of the wheat disease resistance factor TaC4H1 is overexpressed. The CDS sequence of the coding gene of the wheat disease resistance factor TaC4H1 is shown as SEQ ID NO:
1.
4. The method of breeding a wheat leaf rust resistant variety according to claim 3, wherein, Comprise: Constructing a recombinant overexpression vector, and transforming the recombinant overexpression vector into wheat; The recombinant overexpression vector contains the coding gene of the wheat disease resistance factor TaC4H1.
5. The method of breeding a wheat leaf rust resistant variety according to claim 4, wherein, The transformation method is an Agrobacterium-mediated genetic transformation method.
6. The method of breeding a wheat leaf rust resistant variety according to claim 4, wherein, The primer sequences for constructing the recombinant overexpression vector are shown as SEQ ID NO:5 and SEQ ID NO:6.
Citation Information
Patent Citations
RNAI for the control of phytopathogenic fungi and oomycetes by inhibiting the expression of CYP51 genes
CN105518136A
Plant genes, the expression of which are altered by pathogen infection
WO2002022675A2