Porcine reproductive and respiratory syndrome virus receptor cd163 key srcr5 domain epitope peptide and epitope peptide vaccine and application

By designing an epitope vaccine targeting the key SRCR5 domain of the porcine CD163 receptor, the safety and efficacy issues of existing PRRSV vaccines have been resolved, achieving broad-spectrum protection and enhanced safety against multiple PRRSV strains.

CN120965854BActive Publication Date: 2026-07-03YANGZHOU UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
YANGZHOU UNIV
Filing Date
2025-08-12
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Existing porcine reproductive and respiratory syndrome virus (PRRSV) vaccines have limitations in safety and efficacy, including problems such as viremia, virulence reversion, recombination with other strains, and inability to provide protection against multiple subtypes.

Method used

An epitope vaccine targeting the key SRCR5 domain of the porcine CD163 receptor was designed. Through epitope peptides, nucleic acid molecules, operons, recombinant expression vectors, and recombinant strains, specific antibodies against the CD163 SRCR5 domain were induced, blocking PRRSV infection.

Benefits of technology

It achieves high safety, does not affect pig production performance, can effectively resist infection by multiple PRRSV strains, and does not cause viremia or virulence reversion, thus having a broad-spectrum protective effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120965854B_ABST
    Figure CN120965854B_ABST
Patent Text Reader

Abstract

This invention discloses an epitope peptide of the key SRCR5 domain of porcine reproductive and respiratory syndrome virus (PRRSV) CD163, an epitope peptide vaccine, and its applications. The epitope vaccine of this invention exhibits good safety, without safety issues such as virulence reversion, viremia, or recombination with other PRRSV strains. It also demonstrates good immunogenicity; 14 days after secondary immunization, it can induce pigs to produce specific antibodies against the CD163 SRCR5-FP14 epitope with a maximum agglutination titer of 1:16. Immunized pigs can resist challenge from the highly pathogenic PRRSV JAX1 strain. Since all PRRSV subtypes rely on interaction with the CD163 receptor to infect susceptible host cells, and the CD163 molecule is conserved, the epitope vaccine blocking PRRSV infection also provides broad-spectrum protection against multiple subtypes without affecting pig production performance. This novel epitope vaccine has broad potential applications in PRRS prevention and control.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of veterinary biological products technology, specifically relating to the epitope peptide of the key SRCR5 domain of the porcine reproductive and respiratory syndrome virus (PRRSV) receptor CD163 and its application, and particularly to an epitope vaccine that can directly target the B-cell epitope of the key SRCR5 domain of the PRSV CD163 receptor. Background Technology

[0002] Porcine reproductive and respiratory syndrome (PRRS) is a disease characterized by reproductive disorders in late-pregnancy sows and respiratory symptoms in pigs of all ages, causing significant economic losses to the global pig industry. The causative agent of PRRS, porcine reproductive and respiratory syndrome virus (PRRSV), is an enveloped, single-stranded, positive-sense RNA virus, classified in the order Nidovirales, family Arterioviridae, and genus β-Arteriovir. Based on genomic variations, PRRSV is divided into two species: PRRSV-1 (formerly European PRRSV) and PRRSV-2 (formerly North American PRRSV). Currently, PRRSV-2 is the predominant species circulating in my country.

[0003] Currently, the main control measure against PRRSV in my country is the use of corresponding vaccines. my country has a wide variety of commercially available PRRSV vaccines, primarily including live attenuated vaccines and inactivated vaccines. While these vaccines play an indispensable role in PRRS control, their safety and efficacy still require optimization and improvement. Regarding safety, live attenuated PRRSV vaccines can induce viremia in vaccinated pigs for up to four weeks; notably, live attenuated vaccines can exhibit virulence reversion; and live attenuated vaccine strains can recombine with wild-type strains; furthermore, live attenuated vaccines can spread from vaccinated pigs to unvaccinated pigs, causing vaccine virus transmission. Regarding efficacy, increasing reports indicate that existing live attenuated vaccines using HP-PRRSV as the parent strain cannot provide complete protection against other subtypes, such as: how to target and control infections caused by the currently prevalent NADC30-like strains? In addition, while inactivated PRRSV vaccines are relatively safe, they require repeated vaccinations, and their effectiveness remains controversial. Therefore, there is an urgent need to develop a safer and more effective PRRSV vaccine.

[0004] CD163 is a 130 kDa type I transmembrane glycoprotein with a short cytoplasmic tail, a transmembrane segment, and nine scavenger receptor cysteine-rich (SRCR) domains. In pigs, CD163 has been identified as the major receptor for PRRSV and plays a crucial role in PRRSV infection. It has been reported that expression of CD163 in PRRSV-insensitive cell lines such as 3D4 / 21, CHO, PK-15, and BHK-21 allows these normally non-PRRSV-sensitive cells to allow PRRSV infection and replication. Conversely, gene-edited pigs lacking functional CD163, and alveolar macrophages (PAMs) isolated from gene-edited pigs, are resistant to PRRSV. The above evidence suggests that CD163 is a key target for effective prevention and control of PRRSV. Targeting the PRRSV receptor CD163 and blocking key CD163 sites in susceptible host cells that mediate PRRSV infection is a novel strategy for direct and effective prevention and control of PRRSV.

[0005] It is worth noting that although multiple studies have shown that CD163 knockout pigs can be completely resistant to PRRSV infection, the complete inactivation of CD163 may affect the normal physiological health of pigs due to the pleiotropic nature of the CD163 gene and its important role in other physiological processes. Therefore, it is necessary to identify the key sites for precise interaction between the CD163 protein and PRRSV. Several studies have found that the SRCR5 region of porcine CD163 is crucial for successful PRRSV infection. For example, by sequentially deleting and replacing important domains of the CD163 protein, it was found that the SRCR5 domain of CD163 is essential for PRRSV infection, while the N-terminal SRCR1-SRCR4 domain and the intracellular region are not essential for PRRSV infection. The SRCR5 domain of the CD163 protein was precisely deleted using CRISPR / Cas9 technology, and gene knockout pigs lacking this domain were prepared. The study found that the deletion of the SRCR5 domain had no effect on the weight and blood cell count of the pigs, nor on cell-specific surface markers of PAM cells and peripheral blood monocytes (PBMCs). Furthermore, PAM cells still have the biological activity of clearing hemoglobin-haptoglobin (Hb-Hp) complexes, demonstrating that the SRCR5-deficient CD163 protein can be correctly expressed, folded, and located on the cell surface in PAM cells to perform its biological functions. Cellular challenge assays using PRRSV revealed that PAM cells lacking the SRCR5 domain were completely resistant to PRRSV-1 and PRRSV-2 infection. These studies indicate that the SRCR5 domain in CD163 is a key region mediating PRRSV infection.

[0006] Given the limitations of existing PRRSV vaccines in terms of safety and efficacy, and the crucial role of the CD163SRCR5 domain of the PRRSV receptor in PRRSV infection, this study designs a vaccine targeting the B-cell epitope of the CD163 receptor's key SRCR5 domain in susceptible cells that mediates PRRSV infection. This aims to induce the body to produce antibodies that can block and inhibit the CD163 receptor's key SRCR5 domain, thereby directly blocking PRRSV infection of susceptible cells. Therefore, this epitope vaccine targeting the CD163 receptor's key SRCR5 domain has broad potential applications in PRRSV prevention and control. Compared to traditional PRRSV live and inactivated vaccines designed to target the virus, vaccines designed to target the viral receptor have the following advantages: 1. They do not involve viral strains, thus avoiding the safety issues associated with live PRRSV vaccines, such as viremia, virulence reversion, and recombination with other strains in vaccinated pigs; 2. Due to the extremely rapid evolution of PRRSV, PRRSV-2 can be divided into at least 9 lineages. Furthermore, increasing reports indicate that existing commercial PRRSV vaccines using classic PRRSV or HP-PRRSV as parent strains do not provide protection against the currently prevalent NADC30-like and NADC34-like strains. However, all PRRSV lineages rely on interaction with CD163 to infect the host, and the porcine CD163 gene is conserved. Therefore, epitope vaccines targeting the key SRCR5 domain of the CD163 receptor that mediates PRRSV infection also have broad-spectrum protection against multiple PRRSV lineages. Summary of the Invention

[0007] Purpose of the invention: In order to overcome the limitations of existing PRRSV vaccines, the technical problem to be solved by the present invention is to provide a novel epitope peptide.

[0008] Another technical problem that the present invention needs to solve is to provide a nucleic acid molecule encoding the epitope peptide.

[0009] Another technical problem that this invention aims to solve is to provide an operator.

[0010] Another technical problem that this invention aims to solve is to provide expression cassettes, recombinant expression vectors, recombinant cells, or recombinant strains.

[0011] Another technical problem that this invention aims to solve is to provide a method for constructing recombinant expression vectors and recombinant strains.

[0012] Another technical problem to be solved by the present invention is to provide the application of the epitope peptide, the nucleic acid molecule, the operon, the expression cassette, the recombinant expression vector, the recombinant cell or recombinant strain in the preparation of porcine PRRSV vaccine or porcine CD163 antibody detection reagent or kit.

[0013] The technical problem that this invention also aims to solve is to provide a safe PRRSV epitope vaccine that does not cause viremia in pigs, does not cause virulence reversion, does not recombine with other PRRSV strains, does not affect pig production performance, and effectively resists infection by multiple subtypes of PRRSV strains.

[0014] The final technical problem to be solved by this invention is to provide an epitope-specific antibody.

[0015] Technical solution: In order to achieve the above-mentioned objectives, the present invention provides an epitope peptide of the key SRCR5 domain of the CD163 receptor in host susceptible cells that mediates PRRSV infection. The epitope peptide is a B-cell epitope of the loop 5-6 region of the SRCR5 domain of porcine CD163 protein, and its amino acid sequence is shown in SEQ ID NO.1.

[0016] The present invention also includes a nucleic acid molecule encoding the epitope peptide, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0017] The present invention also includes an operon, which is obtained by inserting the nucleic acid molecule into the feed operon sequence of Escherichia coli F18 fimbriae, replacing nucleotides 268 to 309 in the feedA gene.

[0018] Preferably, the operon is the fed-CD163-SRCR5-FP14 operon, wherein the nucleotide sequence of the operon is shown in SEQ ID NO.3.

[0019] The present invention also includes expression cassettes, recombinant expression vectors, recombinant cells or recombinant strains, which contain the nucleic acid molecules or the operons described herein.

[0020] The present invention also includes a method for constructing a recombinant expression vector, comprising the following steps:

[0021] (1) Obtaining the gene sequence of the key SRCR5 domain epitope peptide of the CD163 receptor in host susceptible cells that mediates PRRSV infection, the gene sequence being shown in SEQ ID NO.2;

[0022] (2) The gene sequence obtained in step (1) is inserted into the F18 fimbriae fed operon gene sequence to replace nucleotides 268 to 309 in the fedA gene to obtain a recombinant gene fragment, which is then introduced into a vector to obtain a recombinant expression vector.

[0023] Preferably, the present invention also provides a recombinant expression vector pBR-fed-CD163-SRCR5-FP14, wherein the expression vector is obtained by cloning the fed-CD163-SRCR5-FP14 operon into the pBR322 vector for expression.

[0024] The present invention also includes a method for constructing the recombinant strain, wherein the method comprises introducing the recombinant expression vector into the vector bacteria by electroporation.

[0025] Preferably, the present invention also provides a recombinant bacterium HB101 (pBR-fed-CD163-SRCR5-FP14) that displays and functionally expresses the key SRCR5 domain FP14 epitope of the CD163 receptor mediated by PRRSV infection. The recombinant bacterium HB101 is formed by introducing the above-mentioned recombinant expression vector pBR-fed-CD163-SRCR5-FP14 into the engineered Escherichia coli bacterium HB101 via electroporation. After inactivation with formaldehyde, the functional display of the FP14 epitope on the surface of the recombinant bacterium HB101 (pBR-fed-CD163-SRCR5-FP14) is verified by plate agglutination test and immunization of pigs.

[0026] The present invention also includes the application of the epitope peptide, the nucleic acid molecule, the operon, the expression cassette, the recombinant expression vector, the recombinant cell or recombinant strain in the preparation of porcine PRRSV vaccine or porcine CD163 antibody detection reagent or kit.

[0027] The present invention also includes an epitope vaccine targeting the FP14 epitope of the key SRCR5 domain of the PRRSV CD163 receptor, wherein the epitope vaccine contains the epitope peptide, the nucleic acid molecule, the operon, the expression cassette, the recombinant expression vector, and the recombinant cell or recombinant strain.

[0028] Preferably, the epitope vaccine of the present invention comprises recombinant bacterium HB101 (pBR-fed-CD163-SRCR5-FP14) expressing FP14.

[0029] The epitope vaccine also includes a suitable immune adjuvant acceptable to pigs.

[0030] The present invention also includes an epitope-specific antibody, which is obtained by immunizing animals with the epitope vaccine.

[0031] The animals mentioned include, but are not limited to, pigs.

[0032] The HB101(pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing FP14 provided by this invention has good immunogenicity. After two doses of the HB101(pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing FP14, pigs can be induced to produce specific antibodies against the CD163 SRCR5-FP14 epitope with a maximum agglutination titer of 1:16. At the same time, it can protect immunized pigs against lethal challenge from the highly pathogenic PRRSV JXA1 strain. Compared with the control group, the immunized group did not show adverse clinical manifestations, no pig deaths, short duration of high fever, and two orders of magnitude lower viremia.

[0033] Beneficial Effects: Compared with the prior art, the present invention has the following advantages: Since the FP14-expressed HB101(pBR-fed-CD163-SRCR5-FP14) epitope vaccine of the present invention is inactivated using formaldehyde and does not involve PRRSV strains, there are no safety issues such as causing viremia in pigs, virulence reversion, recombination with other PRRSV strains, or transmission to unvaccinated pigs. Furthermore, the FP14-expressed HB101(pBR-fed-CD163-SRCR5-FP14) epitope vaccine does not affect the production performance of pigs after injection, indicating that the HB101(pBR-fed-CD163-SRCR5-FP14) epitope vaccine has excellent safety. Secondly, on day 14 after the second immunization with the HB101(pBR-fed-CD163-SRCR5-FP14) epitope vaccine, immunized pigs can produce a maximum agglutination titer of 1:16 against CD163. The SRCR5-FP14 epitope-specific antibody can protect immunized pigs to some extent against lethal challenge with the highly pathogenic PRRSV JXA1 strain. After challenge, no adverse clinical manifestations or pig deaths occurred in the immunized group, and the duration of high fever was shorter. Furthermore, viremia was two orders of magnitude lower than in the control group, indicating that the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing FP14 can resist PRRSV infection. In addition, due to the extremely rapid evolution of PRRSV, PRRSV-2 can be divided into at least nine lineages, and increasing reports indicate that existing parent strains using classic PRRSV or HP-PRRSV are more effective. Commercially available PRRSV vaccines do not provide protection against the currently prevalent NADC30-like and NADC34-like strains. However, all PRRSV lineages rely on interaction with CD163 to infect the host, and the porcine CD163 gene is conserved. Therefore, the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine targeting the FP14 epitope of the key SRCR5 domain of the CD163 receptor that mediates PRRSV infection has broad-spectrum protection against multiple PRRSV lineages. Attached Figure Description

[0034] Figure 1 This is a schematic diagram of the recombinant expression vector pBR-fed-CD163-SRCR5-FP14 plasmid.

[0035] Figure 2 This is a schematic diagram of the pUC57-fed recombinant plasmid.

[0036] Figure 3 This is a schematic diagram of the pUC57-fed-CD163-SRCR5-FP14 recombinant plasmid.

[0037] Figure 4 Electrophoresis images for PCR amplification and identification of the fed-CD163-SRCR5-FP14 operon and the fed operon, where lane M is the Trans 2K plus II DNA Marker; lane 1 is the genome amplification product of the DH5α engineered bacteria as a negative control; lane 2 is the genome amplification product of the F18ab fimbriae-producing standard strain 107 / 86 (O139:K12:H1) as a positive control; lane 3 is the amplification product of the pUC57-fed-CD163-SRCR5-FP14 plasmid; and lane 4 is the PCR amplification product of the pUC57-fed plasmid.

[0038] Figure 5 The images show the enzyme digestion identification of the pBR-fed-CD163-SRCR5-FP14 plasmid and the pBR-fed plasmid. Lane M is the Trans 2K plus II DNA Marker; lane 1 is the pBR-fed-CD163-SRCR5-FP14 plasmid; lane 2 is the product of double digestion of the pBR-fed-CD163-SRCR5-FP14 plasmid with EcoRI and Eag I restriction endonucleases; lane 3 is the pBR-fed plasmid; and lane 4 is the product of double digestion of the pBR-fed plasmid with EcoRI and Eag I restriction endonucleases.

[0039] Figure 6 The images show the PCR identification of recombinant HB101(pBR-fed-CD163-SRCR5-FP14) and recombinant HB101(pBR-fed) bacteria expressed by FP14. Lane M is the Trans 2K DNA Marker; lane 1 is the negative control (template is double-distilled water ddH2O); lane 2 is the genomic amplification product of the F18ab fimbriae-producing standard strain 107 / 86 (O139:K12:H1) as a positive control; lane 3 is the amplification product of recombinant HB101(pBR-fed-CD163-SRCR5-FP14) expressed by FP14; and lane 4 is the amplification product of recombinant HB101(pBR-fed).

[0040] Figure 7 The study investigated the changes in body temperature in pigs after injection of recombinant HB101 (pBR-fed-CD163-SRCR5-FP14) expressing FP14. The body temperatures of the HB101 (pBR-fed-CD163-SRCR5-FP14) injection group, the HB101 (pBR-fed) injection group, and the PBS injection group remained normal during the 14-day observation period.

[0041] Figure 8The study investigated the changes in body weight in pigs after immunization with recombinant HB101 (pBR-fed-CD163-SRCR5-FP14) expressing FP14. There was no significant difference in body weight gain between the HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group, the HB101 (pBR-fed) immunization control group, and the PBS injection group.

[0042] Figure 9 The study investigated the changes in the titer of CD163 SRCR5-FP14 epitope-specific antibodies in pigs after immunization with HB101 (pBR-fed-CD163-SRCR5-FP14) epitope-expressing vaccine with FP14 expression. Pigs immunized with HB101 (pBR-fed-CD163-SRCR5-FP14) expressed with FP14 expression were able to produce specific antibodies against the CD163 SRCR5-FP14 epitope. The highest titer of agglutinated antibodies was 1:16 and the lowest was 1:4 14 days after the second immunization. In contrast, no specific antibodies against the CD163 SRCR5-FP14 epitope were detected in pigs in the HB101 (pBR-fed) control group 14 days after the second immunization.

[0043] Figure 10 The clinical manifestations of pigs 7 days post-challenge were shown. Pigs in the HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group expressing FP14 showed no abnormalities, while pigs in the HB101 (pBR-fed) control group showed clinical symptoms such as depression, loss of appetite, redness of the whole body, inability to stand, and coughing after challenge.

[0044] Figure 11 To assess the survival of pigs after challenge, no pigs died in the HB101(pBR-fed-CD163-SRCR5-FP14) immunization group expressing FP14 during the 21-day observation period after challenge, while all 5 pigs in the HB101(pBR-fed) control group died after challenge, with 1 pig dying at 9 days post-challenge, 1 pig dying at 10 days post-challenge, 2 pigs dying at 11 days post-challenge, and 1 pig dying at 13 days post-challenge.

[0045] Figure 12 The image shows the results of body temperature monitoring after challenge. In the HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group expressing FP14, only a few pigs showed high fever, and the duration was short. In contrast, pigs in the HB101 (pBR-fed) control group showed persistent high fever starting from the second day after challenge, which lasted for a longer period of time until the pigs were on the verge of death.

[0046] Figure 13The image shows the results of weight monitoring after challenge. Pigs in the HB101(pBR-fed-CD163-SRCR5-FP14) immunization group, which expressed FP14, maintained weight gain after challenge, while pigs in the HB101(pBR-fed) control group showed weight loss after challenge.

[0047] Figure 14 The image shows the results of viremia monitoring after challenge. Compared with the HB101(pBR-fed) control group, the viremia of the HB101(pBR-fed-CD163-SRCR5-FP14) immune group expressing FP14 was about two orders of magnitude lower. Detailed Implementation

[0048] The embodiments of the present invention will be further described below with reference to examples. Obviously, the embodiments are intended to illustrate the present invention and should not be regarded as limiting the scope of the present invention. In addition to the specific methods, devices and materials used in the embodiments, based on the mastery of the prior art by those skilled in the art and the description of the present invention, any prior art methods, devices and materials similar to or equivalent to those described, devices and materials in the embodiments of the present invention can be used to implement the present invention.

[0049] Example 1: Obtaining the key SRCR5 domain B-cell epitope of the porcine CD163 receptor

[0050] The amino acid sequence of porcine CD163 protein (GenBank accession number: NP_999141.1) uploaded to the National Center for Biotechnology Information (NCBI) was used to predict B-cell epitopes using the online B-cell epitope prediction website (https: / / www.iedb.org / ). Based on the predicted amino acid score, B-cell epitopes in the CD163 SRCR5 loop 5-6 region were selected. Three overlapping B-cell epitopes in the CD163 SRCR5 loop 5-6 region were further optimized, and the final selected epitope was named WL14.

[0051] (WAEEFQCEGHESHL), FP14 (SEQ ID NO.1: FQCEGHESHLSLCP), GR14

[0052] (GHESHLSLCPVAPR).

[0053] The nucleotide sequences of the key SRCR5 domain B-cell epitopes of the porcine CD163 receptor are: WL14(TGGGCTGAAGAATTCCAGTGTGAGGGGCACGAGTCCCACCTTTCACTCTGCCCAGT AGCACCCCGCCCTGACGGGACATGT), FP14(SEQ ID NO.2: TTCCAGTGTGAGGGGCACGAGTCCCACCTTTCACTCTGCCCA), and GR14(GGGCACGAGTCCCACCTTTCACTCTGCCCAGTAGCACCCCGCCCTGACGGGACATG TAGCCACAGCAGGGACGTCGGCGTA). Since the different B-cell epitopes differ only in sequence, recombinant bacteria containing these epitopes will be constructed below.

[0054] Example 2: Construction of recombinant bacteria expressing the key SRCR5 domain of the CD163 receptor B-cell epitope (using the FP14 epitope as an example).

[0055] To construct a porcine immune delivery system by presenting the key SRCR5 domain FP14 epitope of the CD163 receptor using F18 fimbriae, the amino acid sequences of the F18 fimbriae operon fed (GenBank accession number: CP080237.1, location: 18423-23831) and its major subunit FedA of *E. coli* F18ab (O139:H1:F18ab) uploaded to NCBI were analyzed. The immunogenic position in FedA was replaced with the key epitope FP14 of the CD163 receptor's key SRCR5 domain, at positions 90-103 bp from the N-terminus of the FedA protein, corresponding to positions 268-309 bp in the FedA gene. A recombinant plasmid pUC57-fed containing the full-length sequence of the *E. coli* F18ab (O139:H1:F18ab) fed operon was synthesized by Beijing Qingke Biotechnology Co., Ltd. (see plasmid map). Figure 2 The pUC57-fed-CD163-SRCR5-FP14 recombinant plasmid (containing the fed operon inserted between the Sal I and EcoRI restriction sites of the pUC57 plasmid) and the full-length sequence of the fed-CD163-SRCR5-FP14 operon with the replaced fedA (SEQ ID NO.3) are shown in the plasmid map. Figure 3 The fed-CD163-SRCR5-FP14 operon was inserted between the Sal I and EcoRI restriction sites of the pUC57 plasmid. Simultaneously, a pair of full-length amplification primers were designed targeting the fed operon, with the upstream primer being fed-F: 5'-CAGC. GTCGACGTGAAAAGACTAGTGTTTATTTCTTTTGTT-3', downstream primer is fed-R: 5'-GAT CGGCCG TTACTGTATCTCGAAAACAATGGGC-3', where the underlined sequences represent Sal I and Eag I restriction enzyme sites, respectively. Primers were synthesized by Beijing TransGen Biotech Co., Ltd. Using the company's synthesized pUC57-fed and pUC57-fed-CD163-SRCR5-FP14 as templates, the full-length fed and fed-CD163-SRCR5-FP14 were amplified using forward and reverse primers fed-F / R. The amplification system consisted of 1 μL of pfu high-fidelity DNA polymerase (Beijing TransGen Biotech Co., Ltd., catalog number: AP221-11), 10 μL of 5×pfu DNA polymerase buffer, 4 μL of dNTPs, 1 μL each of forward and reverse primers (10 μM), 1 μL of pUC57-fed-CD163-SRCR5-FP14 / pUC57-fed template, and 32 μL of ultrapure water. After thoroughly mixing the above system, PCR amplification was performed using a Bio-Rad PCR instrument. The PCR program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 5 min, 30 cycles; 72℃ further extension for 10 min; after amplification, the temperature was lowered to 12℃ for storage. The genome of the F18ab fimbriae-producing standard strain 107 / 86 (O139:K12:H1) (a gift from the Microbiology Laboratory of the College of Veterinary Medicine, University of Pennsylvania, USA, preserved in our laboratory, Zhang Jianjun. Preliminary study on cloning, expression and bioactivity of the fed gene of the F18 fimbriae operon in Escherichia coli [D]. Yangzhou University, 2005) was used as a positive control; the genome of the engineered Escherichia coli strain DH5α was used as a negative control.

[0056] PCR products were electrophoresed in a 1.0% agarose gel at 110V. After electrophoresis, the gel was stained with ethidium bromide and the results were observed using a gel imaging system (Bio-Rad). The results are as follows: Figure 4As shown, the F18ab fimbriae-producing standard strain 107 / 86 (O139:K12:H1), pUC57-fed-CD163-SRCR5-FP14, and pUC57-fed all amplified 5428 bp DNA products, while the genome of the engineered E. coli strain DH5α did not amplify any bands. The full-length fed-CD163-SRCR5-FP14 operon amplified by pUC57-fed-CD163-SRCR5-FP14 and the full-length fed operon amplified by pUC57-fed were purified using a universal DNA purification and recovery kit (Tiangen Biotech (Beijing) Co., Ltd., catalog number: DP214) and stored at -20℃ for later use.

[0057] The purified fed-CD163-SRCR5-FP14, the fed operon, and the pBR322 plasmid (purchased from Miaoling Plasmid Platform) were double-digested with Sal I (NEB, catalog number: R3138L) and Eag I restriction endonucleases (NEB, catalog number: R3505L). A 1.0% agarose gel was prepared and electrophoresed at 110V. The target band was excised and purified using a universal DNA purification and recovery kit, and then purified using T4. DNA ligase (NEB, catalog number: M0202L) was used to ligate purified pBR322 plasmid digestion fragments with fed-CD163-SRCR5-FP14 operon digestion fragments and fed operon digestion fragments overnight at 16°C in a metal bath. The next day, the ligation products were transformed into DH5α competent cells (Shanghai Beyotime Biotechnology Co., Ltd., catalog number: D1031S) and plated on solid medium containing 100 μg / mL ampicillin (Amp; Beijing Solarbio Science & Technology Co., Ltd., catalog number: A8180) for resistance selection. After 16 h of inverted culture at 37°C, single colonies on the plates were picked and inoculated into a medium containing 100 μg / mL ampicillin. + After overnight culture in LB liquid medium, plasmids were extracted using a rapid plasmid mini-prep kit (Tiangen Biotech (Beijing) Co., Ltd., catalog number: DP105). The plasmids were then identified by double digestion with EcoRI (NEB, catalog number: R3101S) and EagI restriction endonucleases. A 1% agarose gel was prepared, and the digestion products were electrophoresed at 110V for 45 min. After staining with ethidium bromide, the images were obtained under UV imaging. The results are shown below. Figure 5 As shown, the recombinant plasmid pBR-fed-CD163-SRCR5-FP14 (plasmid map as shown) Figure 1As shown in the figure, the double digestion products of pBR-fed were a 3424 bp linear pBR322 vector and a 6068 bp fed-CD163-SRCR5-FP14 and fed linear DNA fragments, respectively, consistent with expectations. A pair of identification primers were designed targeting fedA to determine whether CD163 SRCR5-FP14 was inserted into the expected position in fedA. The upstream primer was fedA-F: ​​5'-GTGAAAAGACTAGTGTTTATTTCTTTTGTT-3'; the downstream primer was fedA-R: 5'-TTACTTGTAAGTAACCGCGTAAGCC-3'. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. After sequencing the pBR-fed-CD163-SRCR5-FP14 plasmid and the identification primers at Beijing Qingke Biotechnology Co., Ltd., it was found that CD163 SRCR5-FP14 was inserted into the expected position in fedA.

[0058] The engineered *E. coli* strain HB101 was preserved in our laboratory and stored in cryovials at -80°C. *E. coli* HB101 was streaked onto LB agar plates and incubated overnight at 37°C with the plates inverted. Single colonies were then picked and transferred to 4 mL of fresh LB medium and incubated overnight at 37°C with shaking at 220 rpm. After one generation, the bacterial culture was transferred to 40 mL of fresh LB medium at a volume ratio of 1:100. OD was then calculated. 600 When the bacterial concentration was 0.4-0.6, the bacterial culture was incubated on ice for 30 min, centrifuged at 4000 rpm for 10 min at 4℃, and then resuspended in 10% glycerol pre-chilled on ice. The culture was then centrifuged at 4000 rpm for 10 min at 4℃. The cells were washed three times with 10% glycerol. Finally, each 4 mL of bacterial culture was resuspended in 40 μL of 10% glycerol, and 100 μL / cell was aliquoted to prepare HB101 electroporation competent cells. Using an electroporator (Bio-Rad) at 1.8 kV, recombinant plasmids pBR-fed-CD163-SRCR5-FP14 and pBR-fed were electroporated into HB101 electroporation competent cells. Then, 1 mL of SOC medium (Qingdao High-Tech Industrial Park Haibo Biotechnology Co., Ltd., catalog number: HBDC002) was added, and the culture was shaken at 37℃ for 1 h. 200 μL of the bacterial culture was then spread onto a medium containing 100 μg / mL Ampicillin. + LB plates were incubated upside down at 37°C. Clones on the plates were picked and identified using identification primers fedA-F and fedA-R. The results are as follows. Figure 6 The positive clone containing pBR-fed-CD163-SRCR5-FP14 was named HB101(pBR-fed-CD163-SRCR5-FP14), and the positive clone containing pBR-fed was named HB101(pBR-fed).

[0059] The recombinant bacteria HB101(pBR-fed-CD163-SRCR5-FP14) and HB101(pBR-fed) were mixed in an ampoule containing 100 μg / mL Ampoules. + The bacteria were cultured in LB liquid medium until the plateau phase, then formaldehyde aqueous solution (Sinopharm Chemical Reagent Co., Ltd., catalog number: 10010018) was added to a final concentration of 0.3% (v / v). The culture was inactivated at 4°C for 3 days. After centrifugation at 4000 rpm for 10 min, the supernatant was discarded, and the bacteria were resuspended in an equal volume of PBS. The suspensions were washed twice to prepare recombinant bacterial suspensions HB101 (pBR-fed-CD163-SRCR5-FP14) and HB101 (pBR-fed). The final concentration was adjusted to 1×10⁻⁶. 10 CFU / mL.

[0060] The construction methods for recombinant strains HB101 (pBR-fed-CD163-SRCR5-WL14) based on WL14 epitope expression and HB101 (pBR-fed-CD163-SRCR5-GR14) based on GR14 epitope expression are the same as those for recombinant strain HB101 (pBR-fed-CD163-SRCR5-FP14).

[0061] Example 3: Functional validation of recombinant bacteria expressing the key SRCR5 domain of the CD163 receptor B-cell epitope.

[0062] To verify whether the key SRCR5 domain epitopes WL14, FP14, and GR14 of the CD163 receptor were correctly presented and expressed on the surface of the HB101 vector bacteria, the constructed recombinant bacterial suspensions HB101(pBR-fed-CD163-SRCR5-WL14), HB101(pBR-fed-CD163-SRCR5-FP14), HB101(pBR-fed-CD163-SRCR5-GR14), and HB101(pBR-fed) were subjected to agglutination assays with CD163 rabbit polyclonal antibody (Wuhan Boster Biological Engineering Co., Ltd., catalog number: A00812-1). The results are shown in Table 1. The recombinant strains HB101 (pBR-fed-CD163-SRCR5-WL14), HB101 (pBR-fed-CD163-SRCR5-FP14), and HB101 (pBR-fed-CD163-SRCR5-GR14) all agglutinated with the CD163 rabbit polyclonal antibody, but did not react with serum from unimmunized healthy rabbits (prepared in our laboratory by collecting blood from the marginal ear vein of healthy rabbits, promoting coagulation, and centrifuging). The HB101 (pBR-fed) control did not react with either the CD163 rabbit polyclonal antibody or the unimmunized rabbit serum. This indicates that the WL14, FP14, and GR14 epitopes of the key SRCR5 domain of the CD163 receptor are correctly presented and expressed on the surface of the HB101 vector bacteria. Meanwhile, the agglutination titers of recombinant bacteria HB101(pBR-fed-CD163-SRCR5-WL14), HB101(pBR-fed-CD163-SRCR5-FP14), and HB101(pBR-fed-CD163-SRCR5-GR14) against CD163 rabbit polyclonal antibodies were tested. The results showed that recombinant bacteria HB101(pBR-fed-CD163-SRCR5-FP14) exhibited a higher antibody titer, indicating that the FP14 epitope has stronger immunogenicity. Therefore, recombinant bacteria HB101(pBR-fed-CD163-SRCR5-FP14), which expresses the key SRCR5 domain FP14 epitope of the CD163 receptor, were used for related experiments.

[0063] Table 1. Verification of the expression of the key CD163 receptor SRCR5 domain B-cell epitope on the surface of HB101 cells.

[0064]

[0065] Note: "-" indicates no agglutination particles were produced, which is negative; "+, 1:1" indicates the presence of agglutination particles, which is positive, and the agglutination antibody titer is 1:1; "+, 1:4" indicates the presence of agglutination particles, which is positive, and the agglutination antibody titer is 1:4.

[0066] To verify whether the HB101 (pBR-fed-CD163-SRCR5-FP14) recombinant bacteria, which correctly presents and functionally expresses the CD163 SRCR5-FP14 epitope, can induce pigs to produce specific antibodies against the CD163 SRCR5-FP14 epitope, six healthy 28-day-old weaned piglets were purchased from Taizhou Taihe Biotechnology Co., Ltd. After a 3-day acclimatization period, three piglets were injected intramuscularly into the neck with the HB101 (pBR-fed-CD163-SRCR5-FP14) recombinant bacteria, while the other three piglets were injected intramuscularly into the neck as a control. The bacterial dose injected into all piglets was 1×10⁻⁶. 10 CFU / head. Whole blood was collected from all pigs 14 days later, and serum was separated. The CD163 SRCR5-FP14 epitope-specific agglutination antibody detection method previously developed in our laboratory was used to detect the CD163 SRCR5-FP14 epitope-specific agglutination antibody in the pig serum. The specific steps of the CD163 SRCR5-FP14 epitope-specific agglutination antibody detection method are as follows:

[0067] 1. The B-cell epitope prediction website (https: / / www.iedb.org / ) was used to predict the major subunit pegA (position 1-177aa) of the peg operon in Salmonella pullorum CVCC 526 (purchased from the China Institute of Veterinary Drug Control, stored in our laboratory, Yang Weifeng. Development and preliminary clinical application of anti-Salmonella PEG fimbriae monoclonal antibody [D]. Yangzhou University, 2016.). A site with strong immunogenicity in pegA was selected and replaced with the CD163SRCR5-FP14 epitope. The replacement site was position 59-72aa from the N-terminus of the pegA protein, with the replacement sequence: DRLTDLNPGDIYTG. The replacement site was position 175-216bp in the pegA gene, with the replacement sequence: GATAGATTGACTGACTTAAACCCTGGCGATATATATACAGGA.

[0068] 2. The recombinant expression vector pBR322-peg-CD163-SRCR5-FP14 (SEQ ID NO.4) containing the chimeric gene peg-CD163-SRCR5-FP14 was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0069] 3. The pBR322-peg-CD163-SRCR5-FP14 was electroporated into the inert carrier S9H developed in our laboratory (patent number: ZL202010427735.8) to obtain S9H (pBR322-peg-CD163-SRCR5-FP14) with the CD163 SRCR5-FP14 epitope correctly presented on the surface for the detection of antigen bacteria.

[0070] 4. Take 5 μL of porcine serum at different dilutions and mix it with 5 μL of S9H (pBR322-peg-CD163-SRCR5-FP14) detection antigen bacteria and 5 μL of S9H (pBR322-peg) control antigen bacteria (previously constructed in the laboratory, conserved neutralizing epitope QT7 of the major glycoprotein GP5 of North American porcine reproductive and respiratory syndrome virus envelope, nucleic acid molecule, expression vector, neutralizing antibody and its application, patent number: ZL202410695247.3) for plate agglutination test, so as to qualitatively and quantitatively detect the specific antibodies against the CD163 SRCR5-FP14 epitope in porcine serum.

[0071] The results of HB101(pBR-fed-CD163-SRCR5-FP14) recombinant bacteria inducing pigs to produce antibodies specific to the CD163 SRCR5-FP14 epitope are shown in Table 2 below. All pigs in the HB101(pBR-fed-CD163-SRCR5-FP14) injection group produced antibodies specific to the CD163 SRCR5-FP14 epitope on day 14 after injection. Two pigs had an antibody titer of 1:4, and one pig had an antibody titer of 1:2. However, pigs in the HB101(pBR-fed) control group did not produce antibodies against the CD163 SRCR5-FP14 epitope.

[0072] Table 2. Generation and testing of CD163 SRCR5-FP14 epitope-specific antibodies

[0073]

[0074] Note: "-" indicates no agglutination particles were produced, which is negative; "+, 1:4" indicates the presence of agglutination particles, which is positive, and the agglutination antibody titer is 1:4; "+, 1:2" indicates the presence of agglutination particles, which is positive, and the agglutination antibody titer is 1:2.

[0075] Example 4: Safety evaluation of the recombinant bacterial HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing the FP14 epitope.

[0076] To investigate whether the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing recombinant FP14 would have adverse effects on swine health and production, 15 28-day-old PRRSV antigen-antibody negative weaned piglets (Taizhou Taihe Biotechnology Co., Ltd.) were divided into three groups. After 3 days of acclimatization, 5 piglets were injected intramuscularly into the neck with an inactivated FP14-expressing HB101 (pBR-fed-CD163-SRCR5-FP14) bacterial suspension, and 5 piglets were injected intramuscularly into the neck with an inactivated HB101 (pBR-fed) bacterial suspension. The bacterial dose injected into all pigs was 1×10⁻⁶. 10 Five pigs were injected with the same dose of PBS and housed separately in another room. For 14 consecutive days after injection, all experimental pigs were monitored for their mental state, appetite, body temperature, weight, injection site, and absorption of the injected substance. All aspects of the animal experiments involved in this invention (hospitalization, handling, and euthanasia) were strictly performed in accordance with the requirements of the Experimental Animal Welfare and Ethics Committee of Yangzhou University. Results showed that no obvious clinical symptoms were observed in any injection group during the observation period; all pigs were in good mental condition, with normal feed and water intake; and their body temperature was normal. Figure 7 Compared to the PBS injection group, there was no significant difference in weight gain between the HB101 (pBR-fed-CD163-SRCR5-FP14) injection group and the HB101 (pBR-fed) injection group expressing FP14. Figure 8 No redness, swelling, or induration was observed at the injection site. These results indicate that the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing FP14 has good safety.

[0077] Table 3. Clinical observation of pigs injected with recombinant HB101 (pBR-fed-CD163-SRCR5-FP14) expressing FP14.

[0078]

[0079] Example 5: Efficacy evaluation of the recombinant bacterial HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing the FP14 epitope.

[0080] To investigate whether immunization with a recombinant HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing FP14 could provide protection against PRRSV challenge in pigs, ten 28-day-old PRRSV antigen-antibody negative weaned piglets (Taizhou Taihe Biotechnology Co., Ltd.) were divided into two groups. After a 3-day acclimatization period, five piglets were injected intramuscularly into the neck with an inactivated HB101 (pBR-fed-CD163-SRCR5-FP14) bacterial suspension (immunization group), while the other five piglets were injected intramuscularly into the neck with an inactivated HB101 (pBR-fed) bacterial suspension (control group). The bacterial dose injected into all pigs was 1×10⁻⁶. 10 CFU / head. A booster immunization was administered 14 days after the initial immunization, and all pigs were challenged with the highly pathogenic PRRSVJXA1 strain (a gift from Yangzhou Youbang Biological Pharmaceutical Co., Ltd.) 1×10⁻⁶ CFU / head. 4.5 TCID 50 / mL, 2mL / head, challenge route is nasal instillation, 1mL in each nostril. The immunization and challenge procedure is shown in Table 4 below.

[0081] Table 4. Immunization and Challenge Procedures

[0082]

[0083] Clinical symptoms, body temperature, and body weight were monitored in all pigs for 21 consecutive days after challenge. Serum samples were collected from all pigs at 14 dpi (day post-inoculation), 28 dpi, 3 dpc (day post-challenge), 5 dpc, 7 dpc, 14 dpc, and 21 dpc after immunization. The CD163 SRCR5-FP14 epitope-specific antibody detection method developed in our laboratory was used to detect CD163 SRCR5-FP14 epitope-specific antibodies in the serum of pigs at 14 dpi and 28 dpi after immunization. At the same time, the fluorescence quantitative detection method in the reference (Transbound Emerg Dis. 2019 Nov; 66(6):2271-2278.) was used to detect viremia in challenged pigs.

[0084] The results showed that after immunization with the HB101(pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing FP14, pigs were able to produce specific antibodies against the CD163 SRCR5-FP14 epitope. On day 14 after the second immunization, the highest titer of agglutinating antibodies against the CD163 SRCR5-FP14 epitope in immunized pigs was 1:16, and the lowest was 1:4. In contrast, no specific antibodies against the CD163 SRCR5-FP14 epitope were detected in the control group injected with HB101(pBR-fed). The production of CD163 SRCR5-FP14 epitope specific antibodies is shown in the figure below. Figure 9 As shown.

[0085] Following viral challenge, the HB101(pBR-fed) control group exhibited clinical symptoms such as depression, decreased appetite, immobility, generalized redness, and cough. However, the group immunized with the recombinant HB101(pBR-fed-CD163-SRCR5-FP14) epitope vaccine did not show any significant clinical symptoms. Figure 10 Furthermore, no pigs died in the HB101 (pBR-fed-CD163-SRCR5-FP14) immunized group during the observation period, while all 5 pigs in the HB101 (pBR-fed) control group died. The specific times and numbers of deaths were as follows: 1 pig died at 9 days post-conception (dpc), 1 pig died at 10 days post-conception (dpc), 2 pigs died at 11 days post-conception (dpc), and 1 pig died at 13 days post-conception (dpc). Figure 11 Regarding body temperature monitoring results, pigs in the HB101 (pBR-fed) control group began to develop fever on the second day, followed by persistent high fever in all pigs until they showed signs of impending death. In contrast, only a few pigs in the recombinant HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group developed high fever, and the duration of high fever was shorter. Figure 12 After challenge, although pigs in the recombinant HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group showed slow growth 7-14 days post-challenge, all pigs continued to grow, while pigs in the HB101 (pBR-fed) control group experienced weight loss. Figure 13 After challenge, compared with the HB101(pBR-fed) control group, the viremia in the blood of pigs immunized with recombinant HB101(pBR-fed-CD163-SRCR5-FP14) was about two orders of magnitude lower. At 3 days post-challenge, the average viral copy number in the blood of pigs immunized with recombinant HB101(pBR-fed-CD163-SRCR5-FP14) was 10. 3.8 The average viral copy number in the blood of pigs in the HB101 (pBR-fed) control group was 10 copies / μL. 6.2At 5 dpc, the average viral copy number in the blood of pigs immunized with recombinant HB101 (pBR-fed-CD163-SRCR5-FP14) was 10 copies / μL; 5.2 The average viral copy number in the blood of pigs in the HB101 (pBR-fed) control group was 10 copies / μL. 6.8 At 7 dpc, the average viral copy number in the blood of pigs immunized with recombinant HB101 (pBR-fed-CD163-SRCR5-FP14) was 10 copies / μL; 4.8 The average viral copy number in the blood of pigs in the HB101 (pBR-fed) control group was 10 copies / μL. 6.3 copies / μL ( Figure 14 The above results indicate that the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing FP14 can provide some immune protection against highly pathogenic PRRSV-challenged pigs.

[0086] In summary, this invention provides an epitope FP14 of the key SRCR5 domain of the CD163 receptor that mediates PRRSV infection, and an HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing the FP14 epitope. The HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine has good safety; no adverse reactions were observed in immunized pigs, and it does not affect pig production performance. Since the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine does not involve the PRRSV strain and has been inactivated using formaldehyde, it avoids the safety issues associated with existing PRRSV live vaccines, such as viremia in vaccinated pigs, virulence reversion, recombination with other PRRSV strains, and transmission to unvaccinated pigs. Furthermore, the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine can protect immunized pigs against highly pathogenic PRRSV. Lethal attack of JXA1 strain; HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine targeting the key SRCR5 domain FP14 epitope of the CD163 receptor that mediates PRRSV infection has broad-spectrum protection against multiple PRRSV strains.

Claims

1. An epitope peptide of the key SRCR5 domain of the CD163 receptor of a host cell susceptible to PRRSV infection, characterized in that, The epitope peptide is a B-cell epitope in the loop 5-6 region of the SRCR5 domain of porcine CD163 protein, and its amino acid sequence is shown in SEQ ID NO.

1.

2. A nucleic acid molecule encoding the epitope peptide of claim 1, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

2.

3. An operon, characterized in that, The operon is inserted into the E. coli F18 pilus Fed Substitution in the operon fedA between nucleotides 268 and 309 in the gene.

4. The operon according to claim 3, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

3.

5. An expression cassette, a recombinant expression vector, a recombinant cell or a recombinant bacterial strain, characterized in that, It comprises the nucleic acid molecule of claim 2 or the operon of claim 3 or 4.

6. The method for constructing a recombinant expression vector according to claim 5, wherein, Includes the following steps: (1) Obtaining the gene sequence of the key SRCR5 domain epitope peptide of the CD163 receptor in host susceptible cells that mediates PRRSV infection, the gene sequence being shown in SEQ ID NO.2; (2) Targeting insertion of the gene sequence obtained in step (1) into F18 pilus Fed Substitution in operon fedA The 268th to 309th nucleotides in the gene were replaced by the recombinant gene fragment, and then introduced into a vector to obtain a recombinant expression vector.

7. The method of constructing a recombinant strain of claim 5, wherein, The method comprises introducing the recombinant expression vector of claim 5 into a vector bacterium via electroporation.

8. The use of the recombinant strain according to claim 5 in the preparation of porcine PRRSV vaccine.

9. An epitope vaccine targeting the PRRSV CD163 receptor key SRCR5 domain FP14 epitope, characterized in that, The epitope vaccine contains the recombinant strain described in claim 5.

10. The epitope vaccine targeting the PRRSV CD 163 receptor key SRCR5 domain FP14 epitope according to claim 9, characterized in that, The epitope vaccine also includes a suitable immune adjuvant acceptable to pigs.

Citation Information

Patent Citations

  • CN111500504B

  • CN118496323B

  • CN110195080A

  • WO2024079463A1