Arabinose glycosyl transferase and application of arabinose glycosyl transferase in preparation of panax japonicus saponin IV

Abstract

The invention discloses arabinose glycosyl transferase PnUGT73B4 and application thereof to preparation of panax japonicus saponin IV, the amino acid sequence of the arabinose glycosyl transferase is shown as SEQ ID NO: 1, under the catalysis of the arabinose glycosyl transferase PnUGT73B4, UDP-arabinose is added to a glucuronic acid group on the C3 site of panax japonicus saponin IVa, and the panax japonicus saponin IV is generated; according to the method, the requirement for raw material plants can be reduced, agricultural land is saved, the product is single, preparation of the panax japonicus saponin IV is facilitated, the biosynthesis route of oleanane type triterpenoid saponin is analyzed, and a breakthrough solution is provided for biosynthesis of the panax japonicus saponin IV.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine preparation, and particularly relates to an arabinose glycosyltransferase gene PnUGT73B4 and application thereof in preparation of chikusetsusaponin IV. BACKGROUND

[0002] Oleanane-type saponins are a kind of widely existing pentacyclic triterpene saponins in the plant kingdom, and have a variety of significant pharmacological activities, such as anti-tumor, hypoglycemic, and liver protection activities, which are more obvious than those of free oleanane-type aglycone. Chikusetsusaponin IV, as a rare oleanane-type pentacyclic triterpene saponin, has attracted much attention in the medical field due to its unique pharmacological activities. Studies have shown that the compound can exert a strong anti-inflammatory effect by inhibiting the NF-κB signaling pathway, and can penetrate the blood-brain barrier to promote the growth of nerve synapses, showing significant potential in the treatment of Alzheimer's disease. More remarkably, the anti-tumor mechanism of chikusetsusaponin IV is that it can activate caspase-3 to induce hepatoma cell apoptosis, and the toxicity to normal cells is much lower than that of the clinical chemotherapeutic drug paclitaxel.

[0003] At present, the preparation of chikusetsusaponin IV is mainly through chemical extraction, but the separation process is complex, the preparation time is long, the preparation amount is small, and the solvent demand is large. In addition, chikusetsusaponin IVa has a low content in Panax plants, the cultivation of Panax plants takes a long time, and the chemical extraction process has problems such as low efficiency and environmental pollution, so that the price of chikusetsusaponin IV is high, and its application in the medical and health industries is limited to a certain extent. How to effectively obtain a large amount of high-purity chikusetsusaponin IV to meet the scientific test and market application demand has always been the focus of attention. SUMMARY

[0004] In view of the problems existing in the prior art, the present application successfully obtains an arabinose glycosyltransferase PnUGT73B4 by mining the genome sequence of Panax notoginseng, the amino acid sequence of which is shown as SEQ ID NO: 1, and the nucleotide sequence of which is shown as SEQ ID NO: 2; the arabinose glycosyltransferase can catalyze the synthesis of chikusetsusaponin IV in vitro, and it adds one UDP-arabinose to the glucuronic acid group at the C3 position of chikusetsusaponin IVa to generate chikusetsusaponin IV; the present application not only analyzes the biosynthesis pathway of oleanane-type triterpene saponin, but also provides a breakthrough solution for the biosynthesis of chikusetsusaponin IV.

[0005]

[0006] The object of the present application is achieved by the following technical solutions: (1) obtaining the arabinose glycosyltransferase PnUGT73B4 from Panax notoginseng (P. notoginseng) by the following steps: Panax notoginseng) The total RNA is extracted from the root, and cDNA is synthesized by reverse transcription, and the first strand cDNA is used as a template to obtain the Panax notoginseng gene PnUGT73B4 ; (2) The gene PnUGT73B4 is connected to the pET32a prokaryotic expression vector, and is transformed into BL21 (DE3), and the positive monoclonal is screened by PCR; (3) The PnUGT73B4 prokaryotic expression protein is induced, and the enzyme catalysis reaction is carried out; (4) The HPLC is used for detecting the enzyme catalysis product.

[0007] The PnUGT73B4 protein is expressed by the prokaryotic expression, and it is found that the PnUGT73B4 can add a UDP-arabinose on the glucuronic acid group at the C3 position of the Panaxy sanguineum saponin IVa to generate the Panaxy sanguineum saponin IV; this not only analyzes the biosynthesis pathway of the oleanane type triterpenoid saponin, but also provides a breakthrough solution for the biosynthesis of the Panaxy sanguineum saponin IV. BRIEF DESCRIPTION OF DRAWINGS

[0008] Figure 1 As PnUGT73B4 the electrophoretic detection result of the gene product, M in the figure is a DNA Marker; Figure 2 As PnUGT73B4 the PCR detection result schematic diagram of the gene connected with the pET32a vector and the DH5 alpha bacteria liquid, M is a DNA Marker; 1-8 are positive escherichia coli strains; "-" is that ddH2O is a template; "+" is that cDNA is a template; Figure 3 As the PCR detection result schematic diagram of the pET32a- PnUGT73B4 plasmid and the agrobacterium bacteria liquid, M is a DNA Marker; 1-8 are positive agrobacterium strains; "-" is that ddH2O is a template; "+" is that cDNA is a template; Figure 4 As the purified protein of the PnUGT73B4 protein; Figure 5 As the HPLC spectrum of the PnUGT73B4 protein enzyme reaction of the Panax notoginseng glycosyltransferase. DETAILED DESCRIPTION

[0009] The application will be further described in detail through the examples, but the protection scope of the application is not limited to the content, and the method in the examples is a conventional method without special instructions, and the reagent used is a conventional market reagent or a reagent prepared according to the conventional method without special instructions.

[0010] Example 1: Acquisition of arabinose glycosyltransferase gene PnUGT73B4 ​ Based on the known functions of arabinosyltransferase genes, such as UGT73F4 and UGT73P10 of soybean, and the characteristics of gene expression, a possible candidate gene was preliminarily screened. The Panax notoginseng was used as the material, and the Panax notoginseng was ground into powder with liquid nitrogen, and then was transferred into a centrifuge tube. The total RNA was extracted by the guanidine isothiocyanate method, and the cDNA first strand was synthesized by using the total RNA as the template and the reverse transcriptase M-MLV (promega). The reaction system and operation process were as follows: 5 μg of the total RNA was taken, and 50 ng of oligo (dT), 2 μL of dNTP (2.5 mM each), and DEPC water were added to the reaction volume of 14.5 μL. After mixing, 70 ℃ heating denaturation was performed for 5 min, and then rapid cooling was performed on ice for 5 min. Then, 4 μL of 5×First-stand buffer, 0.5 μL of RNasin (200 U), and 1 μL of M-MLV (200 U) were added in sequence, mixed, and centrifuged for a short time. The 42 ℃ incubation was performed for 1.5 h, and then the reaction was terminated by heating at 70 ℃ for 10 min. The cDNA first strand was stored at -20 ℃ for standby use after synthesis.

[0011] The synthesized first strand cDNA was used as the template, and the forward and reverse primers were designed with reference to the gene sequence in the Panax notoginseng genome. PnUGT73B4 The gene in the Panax notoginseng was cloned, and the amplification primers were as follows: PnUGT73B4 PnUGT73B4 FP: ATGGCAACTGAAGACCCTAAACTC; PnUGT73B4 RP: TTATCCATTTTTTGATTTCTCAAAAGC; The AdvantageTM 2 PCR Enzyme (Clontech) was used to amplify the target gene; the PCR reaction conditions were as follows: 94 ℃ for 5 min; 94 ℃ for 30 s, 60 ℃ for 30 s, and 72 ℃ for 1 min, 32 cycles; 72 ℃ for 7 min; the reaction system (20 μL) was 0.5 μL of cDNA, 2 μL of 10×Advantage 2 PCR Buffer, 0.4 μL of 50×dNTP Mix (10 mM each), 0.4 μL of forward primer (10 μM), 0.4 μL of reverse primer (10 μM), 0.4 μL of Advantage 2 PCR Polymerase Mix, and 15.9 μL of PCR-Grade water; after the PCR, 10 μL was used for agarose gel electrophoresis to detect the specificity and size of the amplification product; the results are shown in Figure 1 PnUGT73B4 The fragment size was 1467 bp.​​

[0012] Example 2: Gene PnUGT73B4 Construction of prokaryotic expression vector Based on PnUGT73B4 the nucleic acid sequence of the gene, combined with its insertion position in the plant expression vector pET32a, the CE Design software was used to design primers with homologous arms; PnUGT73B4 The upstream primer of the gene is atcggatccgaattcgagctcATGGCAACTGAAGACCCTAAACTC, and the downstream primer is tgcggccgcaagcttgtcgacTCCATTTTTTGATTTCTCAAAAGC. High-fidelity enzymes were used for PnUGT73B4 Gene cloning, the total system of PCR reaction was 50 μL, including: PrimeSTAR MAX Premix 25 μL, upstream primer 1 μL, downstream primer 1 μL, cDNA 1 μL, ddH2O 22 μL; the PCR reaction conditions were: 98℃ 3min; 98℃ 10s, 60℃ 15s, 72℃ 15s, 35 cycles; 72℃ 5min. After the PCR was completed, agarose gel electrophoresis was performed, the target band was recovered after confirming the successful amplification, SanPrep column DNA gel recovery kit (Shanghai Sangon) was used; 1 μL of the recovered product was detected by agarose gel electrophoresis to detect the size and concentration of the recovered fragment, and was stored at -20℃ for standby. The plant expression vector pET32a was linearized by using restriction endonuclease, the enzyme digestion system was 15 μL pET32a plasmid, 5 μL 10×M buffer, 2.5 μL Sac I, 2.5 μL Sal1. Mix 25 μL ddH2O, centrifuge briefly, and digest at 37℃ for 3.5 h. Spot the digested product onto an agarose gel for electrophoresis, and then recover the large fragment of the pCAMBIA1300s vector using a SanPrep column DNA gel recovery kit (Shanghai Sangon Biotech). Take 1 μL of the recovered product and detect the size and concentration of the recovered fragment by agarose gel electrophoresis. Store at -20℃ for later use. For homologous recombination, the ClonExpressMultiS One Step Cloning Kit was used for assembly. The homologous recombination enzyme was assembled according to its instructions. The amounts of each component were calculated based on the concentrations of the insert fragment and vector, following the recombination instructions. Finally, the components were added to the PCR reaction tubes on ice and incubated at 37°C for 0.5 h. After assembly, the recombinant expression plasmid was transformed into DH5α competent cells. Plating was performed on LB agar plates supplemented with ampicillin, and the cells were incubated in the dark at 37°C for 12-15 h. Single colonies were then selected for PCR amplification. Positive clones were sent to a sequencing company for further confirmation. After successful assembly, the cells were preserved, resulting in 8 strains containing [the desired enzyme]. PnUGT73B4 Gene-positive strains ( Figure 2 ).

[0013] Example 3: Conversion of BL21(DE3) pET32a- was extracted and purified from the above-mentioned E. coli using a plasmid extraction kit. PnUGT73B4 Plasmid; the recombinant expression plasmid was transformed into competent prokaryotic expression strain BL21(DE3); plating was performed on LB agar plates supplemented with ampicillin, and the cells were incubated in the dark at 37°C for 12-15 h. Single colonies were picked, shaken, and subjected to PCR to screen for cells containing the recombinant vector pET32a- PnUGT73B4 The plasmid was used for protein-induced expression, and the PCR detection results are as follows: Figure 3 As shown, 8 plants were obtained from the pET32a-transformation. PnUGT73B4 The plasmid-positive Agrobacterium strain was obtained and sequenced to confirm that the sequence was exactly the same as the original sequence. The strain was stored in glycerol at -80°C for later use.

[0014] Example 4: Expression, purification, and catalytic synthesis of PnUGT73B4 protein and its ginsenoside IV 1. Take the recombinant expression strain for scale-up culture, and wait for OD... 600When the value is between 0.6 and 0.8, 0.1 mM IPTG is added, the mixture is uniformly mixed, and then cultured in a 16°C shaking bed at a speed of 140 rpm / min for 12 hours; then centrifuged at 4°C and 5000 rpm / min. The bacterial body after centrifugation is resuspended with Tris-Hcl buffer, and after resuspension, the cell disrupter is used for crushing; the crushed bacterial liquid is centrifuged at 4°C, and the supernatant is reserved; the supernatant is purified by a nickel column (Ni NTA beads), and after purification, the Millipore ultrafiltration tube is used for concentration. The results of protein purification are shown in Figure 4 , PnUGT73B4 The protein size is 54 kDa.

[0015] 2. The purified protein is used for in vitro enzyme catalysis reaction, and the reaction system is as shown in the following table:

[0016] The reaction is cultured at 37°C for 12 hours, and then terminated by 100 μL n-butanol; at the same time, a control group (without adding PnUGT73B4 protein) is set; 3. HPLC detection of enzyme catalysis product The saponin after enzyme catalysis reaction is detected by HPLC; the HPLC detection conditions are as follows: the chromatographic column is Waters-XTerra-MS-C18 (5 μm, 250 mm x 4.6 mm, USA), the mobile phase is 0.1% phosphoric acid water and acetonitrile; gradient elution: 0-15 min, 25%-30% acetonitrile; 15-30 min, 30%-45% acetonitrile; 30-45 min, 45%-65% acetonitrile; 45-50 min, 65%-80% acetonitrile; 50-53 min, 80-85% acetonitrile. The flow rate is 1.0 mL / min, the column temperature is 30°C, and the detection wavelength is set to 203 nm; the high performance liquid chromatography detection results are shown in Figure 5 In the control group, no product appears, while in the reaction product added with the glycosyltransferase PnUGT73B4 protein, a product appears at 29.5 minutes, which basically corresponds to the peak time of the standard product Panax notoginseng saponin IV.

Claims

1. An arabinose glycosyltransferase PnUGT73B4 derived from Panax notoginseng, the amino acid sequence of which is shown in SEQ ID NO:

1.

2. The application of the arabinose glycosyltransferase PnUGT73B4 according to claim 1 in the preparation of ginsenoside IV.

Images