Biosynthetic nanomaterial-based biochemical detection method for tumor markers

By using the biosynthesized nanomaterial SPA [PEG (AgNP)]-Ab to enhance the detection signal of tumor markers in a biochemical detection platform, the problem of insufficient sensitivity of the biochemical detection platform is solved, and rapid quantitative detection of ultra-trace tumor markers is achieved in a cost-effective manner, making it suitable for primary healthcare institutions.

CN120971733BActive Publication Date: 2026-04-24MIKEBO (TIANJIN) BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
MIKEBO (TIANJIN) BIOTECHNOLOGY CO LTD
Filing Date
2025-07-31
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing biochemical testing platforms lack sufficient sensitivity for tumor marker detection, have limited applicability, and face difficulties in popularizing high-sensitivity detection technologies in primary healthcare institutions.

Method used

The biosynthesized nanomaterial SPA [PEG (AgNP)]-Ab was incubated with the sample to be tested, and the visible light absorption signal was detected using a fully automated biochemical analyzer. The detection signal was enhanced by combining the local surface plasmon resonance characteristics of bio-silver nanoparticles, and non-specific adsorption was reduced by PEG coating, while the fusion protein linker improved the antibody conjugation specificity.

Benefits of technology

It enables rapid quantitative detection of ultra-trace tumor markers, with the detection limit of quantitation improved to no more than 1.0 ng/mL and the linear detection range reaching 1-1500 ng/mL. It solves the problem of low sensitivity and reduces detection costs, making it suitable for primary healthcare institutions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120971733B_ABST
    Figure CN120971733B_ABST
Patent Text Reader

Abstract

The application is suitable for the field of biological detection technology, and provides a tumor marker biochemical detection method based on biosynthetic nanomaterials, which comprises the following steps: using biosynthetic nanomaterials SPA【PEG(AgNP)】-Ab to mix and incubate with a sample, so that the material specifically binds with a target tumor marker in the sample; detecting the visible light absorption signal of the mixed system at 600-650 nm by using a full-automatic biochemical analyzer; and determining the content of the tumor marker in the sample according to the strength of the visible light absorption signal. The material is coupled by a SPA【PEG(AgNP)】 complex and an antibody, the LSPR effect of AgNPs amplifies the signal, and PEG reduces interference. The application can detect tumor markers, the quantitative limit is less than or equal to 1.0 ng / mL, the linearity is 1-1500 ng / mL, is compatible with the existing biochemical platform, and is suitable for clinical detection and screening.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of biodetection technology, and in particular relates to a biochemical detection method for tumor markers based on biosynthetic nanomaterials. Background Technology

[0002] In vitro diagnostic (IVD) testing technologies have developed rapidly in recent years, forming a pattern of coexistence and complementarity among multiple technology platforms. Currently, the main IVD testing technology platforms include biochemical, immunological, molecular, microfluidic, and chip technology platforms. Among them, biochemical testing technology platforms are mainly based on enzyme-catalyzed reactions and substrate color development, detecting metabolites, enzymes, electrolytes, etc., in samples such as blood and urine. They are widely used for routine tests such as liver function, kidney function, blood glucose, and blood lipids. The testing technology is mature, and domestically produced products have largely replaced imports, widely used in hospitals at all levels. Immunological testing technology platforms mainly include chemiluminescence immunoassay (CLIA), enzyme-linked immunosorbent assay (ELISA), and immunochromatography (such as colloidal gold and fluorescence chromatography). Chemiluminescence immunoassay is one of the fastest-growing and most widely used technologies in the field of IVD in recent years, and has become an important pillar technology in the field.

[0003] While biochemical testing platforms offer advantages such as relatively inexpensive reagents and instruments, mature technology, ease of standardization, and support for multiple reagent brands, they also suffer from low sensitivity, poor specificity, and detection limits typically in the μg / mL range. They are unsuitable for low-concentration analysis, and some items are susceptible to interference from other substances in the sample. Their accuracy is also inferior to immunoassays, making them unsuitable for the detection of ultra-micro biomarkers (such as tumor markers and hormones).

[0004] Chemiluminescent immunoassay (CLIA) combines the high sensitivity of chemiluminescence with the high selectivity of immunoreaction, exhibiting both high sensitivity and specificity; theoretically, the sensitivity can reach 10-1. -18 At mol / L, it can detect low concentrations of substances that are difficult to detect by other methods. Furthermore, it has a wide linear range, with chemiluminescence exhibiting a linear range of 4-6 orders of magnitude, far exceeding that of traditional enzyme-linked immunosorbent assays (ELISA), making it suitable for detecting samples of varying concentrations. However, the chemiluminescence reagents and instruments used with it are expensive, maintenance costs are high, and it requires specialized operators, presenting a high technical barrier and limiting its widespread adoption in primary healthcare institutions. Summary of the Invention

[0005] The purpose of this application is to provide a biochemical detection method for tumor markers based on biosynthetic nanomaterials, aiming to solve the problems of insufficient sensitivity and limited applicability of existing biochemical detection platforms for tumor marker detection, as well as the difficulty in popularizing high-sensitivity detection technologies.

[0006] The embodiments of this application are implemented as follows: a biochemical detection method for tumor markers based on biosynthetic nanomaterials, comprising:

[0007] The biosynthetic nanomaterial SPA [PEG (AgNP)]-Ab was mixed and incubated with the sample to be tested to allow the biosynthetic nanomaterial to specifically bind to the target tumor marker in the sample to obtain a mixed system.

[0008] The visible light absorption signal of the mixture at 600-650 nm was detected using a fully automated biochemical analyzer.

[0009] The content of tumor markers in the sample to be tested is determined based on the intensity of the visible light absorption signal.

[0010] The SPA[PEG (AgNP)]-Ab is obtained by conjugating the SPA[PEG (AgNP)] complex with the antibody Ab of the corresponding tumor marker.

[0011] Another objective of this application is to provide a biosynthetic nanomaterial SPA[PEG(AgNP)]-Ab, wherein the biosynthetic nanomaterial SPA[PEG(AgNP)]-Ab is obtained by conjugating a SPA[PEG(AgNP)] complex with an antibody Ab, a tumor marker; the SPA[PEG(AgNP)] complex is self-assembled by a fusion protein linker SPA on the surface of PEG(AgNP) particles; the PEG(AgNP) particles are biosynthetic silver nanoparticles AgNPs encapsulated in PEG; the fusion protein linker SPA is constructed by fusing an S-layer protein with Protein A.

[0012] Another objective of this application is to provide a tumor marker biochemical detection reagent, which is obtained by blocking, washing, purifying, and reconstituted the aforementioned biosynthetic nanomaterial SPA [PEG (AgNP)]-Ab.

[0013] This application utilizes the biosynthetic nanomaterial SPA [PEG (AgNP)]-Ab to detect tumor markers on a biochemical detection platform. Leveraging the strong localized surface plasmon resonance (LSPR) properties of bio-silver nanoparticles (AgNPs), the detection signal is amplified. Combined with PEG coating to reduce non-specific adsorption and the fusion protein linker SPA to enhance antibody conjugation specificity, the limit of quantitation is raised to no more than 1.0 ng / mL, with a linear detection range of 1-1500 ng / mL. This overcomes the limitations of low sensitivity in traditional biochemical detection platforms, enabling rapid quantitative detection of trace amounts of tumor markers in human serum or plasma samples. Furthermore, this method can be operated on existing fully automated biochemical analyzers, eliminating the need for specialized and expensive instruments. It solves the problems of high cost and limited adoption of chemiluminescence immunoassay technology, providing a technical solution for tumor marker detection that combines high sensitivity, high specificity, and ease of adoption, facilitating its application in primary healthcare institutions. Attached Figure Description

[0014] Figure 1 A flowchart illustrating the preparation process of the biosynthetic nanomaterial SPA [PEG(AgNP)]-Ab reagent provided in this application embodiment;

[0015] Figure 2 This is a schematic diagram illustrating the reaction process between the biosynthetic nanomaterial SPA [PEG(AgNP)]-Ab reagent and the target antigen provided in the embodiments of this application.

[0016] Figure 3 The ultraviolet-visible absorption spectrum during the preparation process of bio-silver nanoparticles provided in the embodiments of this application.

[0017] Figure 4 The particle size variation during the preparation process of nanoparticles provided in the embodiments of this application (including intermediates at different stages: AgNP, PEG(AgNP), SPA [PEG(AgNP)])

[0018] Figure 5 Potential changes during the preparation process of nanoparticles provided in the embodiments of this application (including intermediates at different stages: AgNP, PEG(AgNP), SPA [PEG(AgNP)])

[0019] Figure 6 The image shows the SDS-PAGE characterization results of the fusion protein linker SPA provided in the embodiments of this application.

[0020] Figure 7 The molecular sieve characterization results of the working nanoparticles SPA [PEG(AgNP)]-Ab provided in the embodiments of this application are shown in the figure. Detailed Implementation

[0021] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0022] This application provides a biochemical detection method for tumor markers based on biosynthetic nanomaterials, comprising: mixing and incubating a sample to be tested with a biosynthetic nanomaterial SPA[PEG(AgNP)]-Ab to specifically bind the biosynthetic nanomaterial to the target tumor marker in the sample, thereby obtaining a mixed system; detecting the visible light absorption signal of the mixed system at 600-650 nm using a fully automated biochemical analyzer; and determining the content of the tumor marker in the sample to be tested based on the intensity of the visible light absorption signal. The SPA[PEG(AgNP)]-Ab is obtained by conjugating a SPA[PEG(AgNP)] complex with an antibody Ab corresponding to the tumor marker.

[0023] In this embodiment, the detection method is applied to a biochemical detection platform, using a fully automated biochemical analyzer to detect the content of trace tumor markers in human samples. Specifically, the detection method is applied to detect tumor markers, which include ferritin (FER), carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), free prostate-specific antigen (FPSA), total prostate-specific antigen (TPSA), carbohydrate antigen 72-4 (CA72-4), neuron-specific enolase (NSE), pepsinogen I (PG I), pepsinogen II (PG II), gastrin 17 (G17), human epididymal protein 4 (HE4), squamous cell carcinoma antigen (SCCA), progastrin-releasing peptide (ProGRP), carbohydrate antigen 153 (CA15-3), carbohydrate antigen 19-9 (CA19-9), carbohydrate antigen 50 (CA 50), carbohydrate antigen 242 (CA 242), and tumor-associated antigen CA125 (CA 50). 125), cytokeratin 19 fragment (CRFRA21-1), neuron-specific protein S100-β (S100-β), thyroglobulin (Tg), β2-microglobulin (β2-MG), abnormal prothrombin (PIVKA-II), calcitonin (CT), human epidermal growth factor receptor 2 (HER-2 / neu), tumor-specific growth factor (TSGF), tumor necrosis factor (TNF), prostatic acid phosphatase (PAP), but not limited to these tumor marker antigens.

[0024] In this embodiment of the application, the sample to be tested is one of human serum, plasma, urine, and cerebrospinal fluid.

[0025] In this embodiment of the application, the coupling step of SPA[PEG (AgNP)]-Ab is as follows: take an equimolar amount of antibody against the target tumor marker and SPA[PEG (AgNP)] complex at 2-8℃, mix them in the dark for 12-18h to obtain SPA[PEG (AgNP)]-Ab.

[0026] In this embodiment, the fusion protein adapter SPA is constructed by fusing an S-layer protein with Protein A. The S-layer protein includes SbpA, SbsB, EA1, etc. The construction steps of the fusion protein adapter SPA include: extracting the S-layer protein DNA sequence from an E. coli strain containing the S-layer protein sequence; adding the corresponding nucleotide sequence of the fusion peptide to the S-layer protein ORF; transfecting the fusion plasmid into E. coli, inducing expression, and purifying to obtain the SPA protein.

[0027] In this embodiment, the PEG (AgNP) particles are prepared by encapsulating AgNPs, a type of bio-silver nanoparticle, with PEG. The preparation steps of the PEG (AgNP) particles include: mixing the filtrate of Fusarium oxysporum strain with AgNO3 solution, reacting under light-protected shaking conditions at pH 8.0, 30℃, and 100 rpm for 24-48 h, and purifying to obtain AgNPs; mixing AgNPs with HS-PEG(2000-10000)-NH2 at a molar ratio of 1:200, reacting at 2-8℃ and pH 8.0 in an inert gas environment for 2 h, and purifying to obtain PEG (AgNP) particles.

[0028] This application also provides a biosynthetic nanomaterial SPA[PEG(AgNP)]-Ab mentioned above, wherein the biosynthetic nanomaterial SPA[PEG(AgNP)]-Ab is obtained by conjugating a SPA[PEG(AgNP)] complex with an antibody Ab of a tumor marker; the SPA[PEG(AgNP)] complex is self-assembled by a fusion protein linker SPA on the surface of PEG(AgNP) particles; the PEG(AgNP) particles are biosynthetic silver nanoparticles AgNPs encapsulated by PEG; the fusion protein linker SPA is constructed by fusing S-layer protein with Protein A.

[0029] This application also provides a tumor marker biochemical detection reagent, which is obtained by blocking, washing, purifying, and reconstituted the above-mentioned biosynthetic nanomaterial SPA [PEG (AgNP)]-Ab.

[0030] Specifically, the preparation method of the tumor marker biochemical detection reagent includes: taking the blocking solution, adding it to the purified biosynthetic nanomaterial SPA[PEG(AgNP)]-Ab, stirring at room temperature for 4-5 hours, centrifuging at 2-8℃ to obtain the first precipitate; resolving the first precipitate with glycine washing purification buffer, sonicating to make the SPA[PEG(AgNP)]-Ab nanoparticles uniformly dispersed, centrifuging at 2-8℃ to obtain the second precipitate; resolving the second precipitate with preservation solution, sonicating to make the SPA[PEG(AgNP)]-Ab nanoparticles uniformly dispersed, making up to volume with preservation solution, and filtering to obtain the final product.

[0031] The following specific examples use ferritin (FER), carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), total prostate-specific antigen (TPSA), and gastrin 17 (G17) in human serum samples for detection, but are not intended to limit the scope of this application. Where specific techniques or conditions are not specified in the examples, they should be performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0032] The preparation process of the SPA [PEG(AgNP)]-Ab reagent provided in the following specific examples is as follows: Figure 1 As shown, the preparation of the SPA [PEG(AgNP)]-Ab reagent includes the preparation of AgNPs bio-silver nanoparticles based on microbial fermentation, the encapsulation of PEG-based bio-silver nanoparticles, the preparation of fusion protein linkers based on bacterial S-layer protein structures, the final assembly of working nanoparticles, and the preparation of the SPA [PEG(AgNP)]-Ab reagent.

[0033] The preparation of AgNPs (silver nanoparticles) based on microbial fermentation includes strain activation and culture, preparation of AgNPs, centrifugal purification of the silver nanoparticles, and characterization and identification of the silver nanoparticles, and is obtained through the following steps:

[0034] Furthermore, the activation and culture of the strain were prepared by the following steps: Fusarium oxysporum spores were picked from the PDA slant and inoculated into 50 mL of PDB medium (250 mL Erlenmeyer flask); the culture was incubated at 28°C and 150 rpm for 48 hours until the mycelium grew vigorously; the culture solution was filtered through a 0.45 μm filter membrane to remove the mycelium, and the filtrate was kept at 4°C for later use.

[0035] Furthermore, the preparation of the bio-silver nanoparticles AgNPs is carried out by the following steps: Take 20 mL of filtrate and add 1 mM AgNO3 solution (final concentration, i.e., 20 mL filtrate + 200 μL 100 mM AgNO3); react at pH = 8.0, 30℃, and 100 rpm in the dark for 36 hours; take samples every 6 hours and detect the LSPR peak at 400-450 nm using UV-Vis.

[0036] Furthermore, the bio-silver nanoparticles were prepared by centrifugation purification using the following steps: under light-protected conditions, the reaction solution was centrifuged at 12000 rpm for 20 minutes, and the supernatant was discarded to remove unreacted Ag. + Remove impurities; resuspend the precipitate in sterile water and wash three times; place the AgNPs suspension in a dialysis bag (MWCO 10 kDa) and dialyze in ultrapure water for 24 hours, changing the solution every 6 hours; sterilize the purified AgNPs solution by passing it through a 0.22 μm filter membrane and store it at 4°C in the dark or freeze-dry it.

[0037] Furthermore, the characterization and identification of the bio-silver nanoparticles are carried out by the following steps: (1) UV-Vis spectroscopy scanning: wavelength range 300-600nm, a characteristic LSPR absorption peak appears at 400-450nm, and the absorption peak is positively correlated with the biosynthesis time; (2) Dynamic light scattering (DLS), (10 nm≤ average particle size≤15 nm, PDI≤0.3); (3) Zeta potential, (Zeta potential<-20 mV).

[0038] Furthermore, the UV-Vis spectral scanning results of the bio-silver nanoparticles are shown in [the image / document / etc.]. Figure 3 The dynamic light scattering (DLS) results of the bio-silver nanoparticles are shown in [the table below]. Figure 4 The zeta potential results of the bio-silver nanoparticles are shown in [the table below]. Figure 5 The characterization results of the bio-silver nanoparticles are shown in Table 1.

[0039] Table 1 Characterization results of bio-silver nanoparticles

[0040]

[0041] The encapsulation of the PEG-based bio-silver nanoparticles includes AgNP pretreatment, PEG encapsulation of AgNPs, purification of highly uniform AgNP-PEG particles, and product identification, and is prepared by the following steps:

[0042] Furthermore, the AgNPs pretreatment is prepared by the following steps: purified AgNPs are taken under light-protected conditions and resuspended in 1 mM HEPES (pH 8.0).

[0043] Furthermore, the PEG encapsulation of the AgNPs was prepared by the following steps: In a light-protected environment, 100 mM stock solution was prepared using anhydrous DMSO from mPEG(6000)-NHS; AgNPs and HS-PEG(6000)-NH2 were mixed at a molar ratio of 1:200, and reacted at 200 rpm for 2 hours in an inert gas environment (N2) at pH 8.0 at 4°C. 15 minutes before the end of the reaction, 1 / 10 volume of 0.5 M glycine (pH 8.0) was added, and stirring continued until the reaction was complete.

[0044] Furthermore, the highly uniform AgNP-PEG particles are purified by the following steps:

[0045] Small molecule impurities were removed by ultrafiltration with PBS at 4℃ in the dark; multi-PEGylated nanoparticles were removed by cation exchange column (SP Sepharose FF) to obtain highly uniform AgNP-PEG particles; sterilization was achieved by filtration through 0.22μm PVDF membrane and storage at 4℃.

[0046] Furthermore, the product is identified by the following steps: (1) Dynamic light scattering (DLS), (20 nm ≤ average particle size ≤ 30 nm, PDI ≤ 0.3); (2) Zeta potential, (the Zeta potential of AgNP-PEG is lower than that of AgNPs).

[0047] Furthermore, the dynamic light scattering (DLS) results of the AgNP-PEG particles are shown in [the table below]. Figure 4 The zeta potential results of AgNP-PEG particles are shown in [the table below]. Figure 5 The characterization results of AgNP-PEG particles are shown in Table 2.

[0048] Table 2 Characterization results of AgNP-PEG particles

[0049]

[0050] The preparation of the fusion protein linker based on the bacterial S-layer protein structure includes the fusion construction of S-layer protein (EA1) with Protein A or a polypeptide, expression of the EA1-Protein A fusion protein, preparation of the EA1-Protein A fusion protein, and product identification, and is obtained through the following steps:

[0051] Furthermore, the fusion construction containing S-layer protein (EA1) and Protein A or polypeptide is prepared by the following steps: (1) Extract the DNA sequence of the S-layer protein from the previously prepared E. coli strain containing the S-layer protein sequence; add the sequence GGCAGCTACTGGTACAACGTGTGGTTC to the ORF of the S-layer protein, which corresponds to the fusion protein EA1-GSYWYNVWF; (2) Transfect E. coli with the fusion plasmid to construct the expression strain.

[0052] Furthermore, the EA1-Protein A fusion protein expression was prepared by the following steps: single colonies were cultured at 37°C for 16 hours under double antibiotic conditions until the logarithmic phase (OD 600 was 0.4-0.6); IPTG was added to a final concentration of 1 mM, and the cells were induced and cultured at 28°C for 4 hours at 150 rpm to harvest the cells; the cells were collected by centrifugation at 4000g for 10 minutes at 2-8°C, and the supernatant was discarded.

[0053] Furthermore, the EA1-Protein A fusion protein was prepared by the following steps: the bacterial cells were broken up using a high-pressure homogenizer at 4°C and 16500psi for 2 cycles, and the residue was discarded by centrifugation; the fusion protein was obtained using the standard SEC method (size exclusion chromatography); the target protein was desalted by ultrafiltration through a 30KD ultrafiltration membrane; finally, it was concentrated to an appropriate volume with polyethylene glycol 20000 (SPA), abbreviated as SPA, and stored at -15~-25°C after aliquoting.

[0054] Furthermore, the product is identified by the following steps: (1) Protein concentration is determined by BCA method, and the concentration should be greater than 3.0 mg / mL. (2) Protein purity is determined by SDS-PAGE method, with a molecular weight range of 186-200 KD and a protein purity greater than 95%.

[0055] Furthermore, the protein purity was determined by the SDS-PAGE method. Figure 6 The characterization results of SPA protein are shown in Table 3.

[0056] Table 3 Characterization results of SPA protein

[0057]

[0058] The final assembly of the working nanoparticles includes the self-assembly of SPA on the surface of PEG(AgNP) particles, detection of the SPA[PEG(AgNP)] complex, antibody conjugation, purification of the working nanoparticles, and product identification, and is prepared by the following steps:

[0059] Furthermore, the SPA self-assembles on the surface of PEG (AgNP) particles, which is prepared by the following steps: SPA self-assembles on the surface of PEG (AgNP) particles: at 4°C, an equimolar amount of PEG (AgNP) particles are thoroughly mixed with SPA protein, and assembled overnight at 4°C in 10 mM CaCl2 to obtain the SPA [PEG (AgNP)] complex;

[0060] Furthermore, the detection of the SPA [PEG(AgNP)] complex includes: (1) dynamic light scattering (DLS), (40 nm ≤ average particle size ≤ 50 nm); (2) zeta potential, (the zeta potential of the SPA [PEG(AgNP)] complex is lower than that of AgNP-PEG).

[0061] Furthermore, the dynamic light scattering (DLS) results of the SPA [PEG(AgNP)] are shown below. Figure 4 The zeta potential results for SPA [PEG(AgNP)] are shown in [link to table]. Figure 5 The characterization results of SPA [PEG(AgNP)] are shown in Table 4.

[0062] Table 4 Characterization results of SPA [PEG(AgNP)]

[0063]

[0064] Furthermore, the antibody conjugation is prepared by the following steps: An equimolar amount of antibody against the target analyte is mixed with SPA [PEG(AgNP)] at 2-8°C and incubated overnight (12-18 h) in the dark. This yields SPA [PEG(AgNP)]-Ab.

[0065] Furthermore, the working nanoparticles are purified by the following steps: 30KD ultrafiltration purification and washing, followed by filtration through a 0.45μm filter membrane.

[0066] Furthermore, the product identification is performed by the following steps: molecular sieve detection. The product is run through a molecular sieve, and the peak time is used to determine whether the SPA [PEG(AgNP)] complex binds to the antibody.

[0067] Furthermore, the peak times of the SPA[PEG(AgNP)]-antigastrin 17 antibody, SPA[PEG(AgNP)], and antigastrin 17 antibody molecular sieves are shown in [the table below]. Figure 7Because the molecular weights of antibodies corresponding to different tumor markers are relatively constant, the elution times of other tumor marker antibodies and their binding with the SPA [PEG(AgNP)] complex after passing through the molecular sieve are basically consistent with the elution times of antigastrin 17 antibody and SPA [PEG(AgNP)]-antigastrin 17 antibody.

[0068] The preparation of the SPA [PEG(AgNP)]-Ab reagent includes blocking, washing and purification, reconstitution and storage, and is obtained by the following steps:

[0069] Furthermore, the blocking of the SPA[PEG(AgNP)]-Ab is obtained by the following steps: Take the blocking solution and add it to the purified working nanoparticles SPA[PEG(AgNP)]-Ab, and stir at room temperature for 4-5 hours. Centrifuge the above solution at 2-8℃ and 8000-10000×g for 30-40 minutes, and discard the supernatant.

[0070] Further, the SPA[PEG(AgNP)]-Ab is purified by the following steps: the precipitate is redissolved in glycine washing and purification buffer, and ultrasonically dispersed for 3-5 minutes until the SPA[PEG(AgNP)]-Ab nanoparticles are uniformly dispersed. The solution is then centrifuged at 2-8°C and 8000-10000×g for 30-40 minutes, and the supernatant is discarded.

[0071] Furthermore, the reconstitution and preservation of the SPA[PEG(AgNP)]-Ab is obtained by the following steps: the above precipitate is reconstituted with preservation solution, and ultrasonically dispersed for 3-5 minutes using an ultrasonic homogenizer until the SPA[PEG(AgNP)]-Ab nanoparticles are uniformly dispersed. The volume is then adjusted with preservation solution. The solution is filtered through a 0.45μm filter membrane and then dispensed.

[0072] The solution used in the preparation of the SPA [PEG(AgNP)]-Ab reagent is prepared by the following steps:

[0073] Furthermore, the sealing solution is prepared by the following steps: 800 mL of purified water is measured using a graduated cylinder and placed into a clean beaker. 0.75 g of glycine, 1.00 g of sodium azide, and 200.00 g of BSA are weighed and added to the beaker, and stirred until completely dissolved. The pH of the solution is adjusted to 7.4 ± 0.1, and purified water is added to bring the volume to 1000 mL. The solution is then filtered through a 0.45 μm filter membrane.

[0074] Furthermore, the glycine washing and purification buffer is prepared by the following steps: 800 mL of purified water is measured using a graduated cylinder and placed in a clean beaker. 0.75 g of glycine is weighed and added to the beaker, and stirred until completely dissolved. The pH of the solution is adjusted to 7.4 ± 0.1, and purified water is added to bring the volume to 1000 mL. The solution is then filtered through a 0.45 μm filter membrane.

[0075] Furthermore, the preservation solution is prepared by the following steps: 800 mL of purified water is measured using a graduated cylinder and placed into a clean beaker. 15.01 g of glycine, 50.00 g of sucrose, 50.00 g of mannitol, 40.00 g of trehalose, and 50.00 g of glycerol are weighed and added to the beaker, and stirred until completely dissolved. The pH of the solution is adjusted to 8.2 ± 0.1, and purified water is added to bring the volume to 1000 mL. The solution is then filtered through a 0.45 μm filter membrane.

[0076] Furthermore, when applying the method for detecting trace amounts of tumor markers on a biochemical detection platform based on the biosynthetic nanomaterial SPA[PEG(AgNP)]-Ab, reagents containing SPA[PEG(AgNP)]-Ab are used, along with matching calibrators and quality control samples, for detection on a fully automated biochemical analyzer.

[0077] Furthermore, the method for detecting trace amounts of tumor markers on a biochemical detection platform based on the biosynthetic nanomaterial SPA[PEG(AgNP)]-Ab utilizes reagents containing SPA[PEG(AgNP)]-Ab. This method leverages the localized surface plasmon resonance (LSPR) effect of silver nanoparticles (AgNPs) to enhance the detected light signal, significantly improving detection sensitivity. The limit of quantitation for detecting trace amounts of tumor markers in human samples reaches ng / mL, consistent with chemiluminescence methods. This biodetection method based on the biosynthetic nanomaterial SPA[PEG(AgNP)]-Ab is a revolutionary biodetection technology that can transfer the detection of trace amounts of tumor markers in human samples from chemiluminescence detection platforms to biochemical detection platforms, enabling these methods to be more rapidly adopted in primary healthcare institutions.

[0078] Example 1: A method for detecting gastrin-17 based on biosynthetic nanomaterials

[0079] 1) The preparation method of SPA [PEG(AgNP)]-antigastrin 17 antibody reagent is as follows:

[0080] An equimolar amount of antigastrin 17 antibody and SPA [PEG(AgNP)] were mixed at 4℃ and incubated overnight (16 h) in the dark to obtain working nanoparticles SPA [PEG(AgNP)]-antigastrin 17 antibody. The mixture was purified by 30 kDa ultrafiltration, washed, and filtered through a 0.45 μm membrane.

[0081] Take the blocking buffer and add it to the purified working nanoparticles SPA[PEG(AgNP)]-antigastrin 17 antibody. Stir at room temperature for 4.5 hours. Centrifuge the above solution at 4℃, 9000×g for 35 min, discard the supernatant, wash the precipitate with glycine and purification buffer to reconstitute it, and sonicate for 4 minutes until the SPA[PEG(AgNP)]-antigastrin 17 antibody nanoparticles are evenly dispersed. Centrifuge the above solution at 4℃, 9000×g for 35 min, discard the supernatant, reconstitute the precipitate with preservation buffer, and sonicate for 4 minutes until the SPA[PEG(AgNP)]-antigastrin 17 antibody nanoparticles are evenly dispersed. Make up the volume with preservation buffer. Filter the above solution through a 0.45 μm filter membrane and aliquot after filtration.

[0082] The prepared SPA [PEG(AgNP)]-antigastrin 17 antibody reagent, along with the matching calibrators and quality control samples, was tested on a fully automated biochemical analyzer.

[0083] 2) Validation of the limit of quantitation of gastrin-17

[0084] Experimental Method: Five samples with quantitation limit concentrations were tested using reagents. Each sample was tested three times, and the tests were conducted over three days. The allowable error range for the test values ​​was set at ±25% of the quantitation limit. The number of test results for each sample falling within the allowable error range was calculated. The percentage of all sample measurements that met the acceptable target criteria of the LoQ statement was then calculated and compared with the lower limit value in the table below. If the percentage was greater than or equal to the corresponding result in the table below, the validation was considered successful.

[0085]

[0086] The experimental data and results are shown in Table 5.

[0087] Table 5. Quantitative Limit Validation Data Analysis Table

[0088]

[0089] The experimental results show that the percentage of reagents that detect gastrin-17 that meet the accuracy target is greater than 95% through limit of quantitation verification. Compared with the minimum percentage (88%) required for a sample size of 45 in the consensus, the LoQ verification is greater than the minimum required percentage.

[0090] 3) Validation of the linear interval of gastrin-17

[0091] Experimental Method: High-value samples close to the upper limit of the linear range were diluted to at least five concentrations, with low-value samples close to the lower limit of the linear range. Following the kit instructions, each concentration was tested three times, and the average value was calculated. A regression analysis was performed between the measured average concentration (y) and the corresponding theoretical concentration or dilution factor (x) to determine the linear regression equation and calculate the linear correlation coefficient r. The result should be within the range of [1.5, 500] pmol / L, with a linear correlation coefficient (r) greater than 0.99. The relative bias between each measured value and the theoretical concentration value was calculated, and the relative bias should be within ±10%.

[0092] The experimental data and results are shown in Table 6.

[0093] Table 6. Analysis of Linear Interval Validation Data

[0094]

[0095] The experimental results show that, through linearity interval verification of the reagent for detecting gastrin 17 prepared by the above method, the linear correlation coefficient (r) is ≥0.9998 within the range of [1.5, 500] pmol / L, and the relative deviation of linearity does not exceed ±10%. This meets the clinical requirements for the linearity of gastrin 17.

[0096] Example 2: Ferritin Detection Method Based on Biosynthetic Nanomaterials

[0097] 1) The preparation method of SPA [PEG(AgNP)]-antiferritin antibody reagent is as follows:

[0098] An equimolar amount of antiferritin antibody and SPA [PEG(AgNP)] were mixed at 4℃ and incubated overnight (16 h) in the dark to obtain working nanoparticles SPA [PEG(AgNP)]-antiferritin antibody. The mixture was purified by 30KD ultrafiltration, washed, and filtered through a 0.45μm filter membrane.

[0099] Take the blocking buffer and add it to the purified working nanoparticles SPA[PEG(AgNP)]-antiferritin antibody. Stir at room temperature for 4.5 hours. Centrifuge the above solution at 4℃, 9000×g for 35 min, discard the supernatant, wash the precipitate with glycine and purification buffer to reconstitute, and sonicate for 4 minutes until the SPA[PEG(AgNP)]-antiferritin antibody nanoparticles are evenly dispersed. Centrifuge the above solution at 4℃, 9000×g for 35 min, discard the supernatant, reconstitute the precipitate with preservation buffer, and sonicate for 4 minutes until the SPA[PEG(AgNP)]-antiferritin antibody nanoparticles are evenly dispersed. Make up to volume with preservation buffer. Filter the above solution through a 0.45 μm filter membrane and aliquot.

[0100] The prepared SPA [PEG(AgNP)]-antiferritin antibody reagent, along with the matching calibrators and quality control samples, was tested on a fully automated biochemical analyzer.

[0101] 2) Validation of the limit of quantification for ferritin

[0102] Experimental Method: Five samples with quantitation limit concentrations were tested using reagents. Each sample was tested three times, and the tests were conducted over three days. The allowable error range for the test values ​​was set at ±25% of the quantitation limit. The number of test results for each sample falling within the allowable error range was calculated. The percentage of all sample measurements that met the acceptable target criteria of the LoQ statement was then calculated and compared with the lower limit value in the table below. If the percentage was greater than or equal to the corresponding result in the table below, the validation was considered successful.

[0103]

[0104] The experimental data and results are shown in Table 7.

[0105] Table 7. Quantitative Limit Validation Data Analysis Table

[0106]

[0107] The experimental results show that the percentage of reagents that can detect ferritin that meet the accuracy target is greater than 97.8% through quantitation limit verification. Compared with the minimum percentage (88%) required for a sample size of 45 in the consensus, the LoQ verification is greater than the minimum required percentage.

[0108] 3) Validation of the linear interval of ferritin

[0109] Experimental Method: High-value samples close to the upper limit of the linear range were diluted to at least five concentrations, with low-value samples close to the lower limit of the linear range. The procedure was followed according to the kit instructions. Each concentration was tested three times, and the average value was calculated. Regression analysis was performed on the average measured concentration (y) and the corresponding theoretical concentration or dilution factor (x) to determine the linear regression equation and calculate the linear correlation coefficient r. The result should be within the range of [1, 1500] ng / mL, with a linear correlation coefficient (r) greater than 0.99. The relative bias between each measured value and the theoretical concentration value was calculated, and the relative bias should be within ±10%.

[0110] The experimental data and results are shown in Table 8.

[0111] Table 8. Analysis of Linear Interval Validation Data

[0112]

[0113] The experimental results show that, through linear range verification of the reagent for detecting ferritin prepared by the above method, the linear correlation coefficient (r) is ≥0.9962 within the range of [1, 1500] ng / mL, and the relative deviation of linearity does not exceed ±10%. This meets the clinical requirements for the linearity of ferritin.

[0114] Example 3: A method for detecting carcinoembryonic antigen based on biosynthetic nanomaterials

[0115] 1) The preparation method of SPA [PEG(AgNP)]-anticarcinoembryonic antigen antibody reagent is as follows:

[0116] An equimolar amount of anti-carcinoembryonic antigen antibody and SPA [PEG(AgNP)] were mixed at 4℃ and incubated overnight (16 h) in the dark to obtain working nanoparticles SPA [PEG(AgNP)]-anti-carcinoembryonic antigen antibody. The mixture was purified by 30KD ultrafiltration, washed, and filtered through a 0.45μm filter membrane.

[0117] Take the blocking buffer and add it to the purified working nanoparticles SPA[PEG(AgNP)]-anti-carcinoembryonic antigen antibody. Stir at room temperature for 4.5 hours. Centrifuge the above solution at 4℃, 9000×g for 35 min, discard the supernatant, wash the precipitate with glycine and purification buffer, and sonicate for 4 minutes until the SPA[PEG(AgNP)]-anti-carcinoembryonic antigen antibody nanoparticles are evenly dispersed. Centrifuge the above solution at 4℃, 9000×g for 35 min, discard the supernatant, reconstitute the precipitate with preservation buffer, and sonicate for 4 minutes until the SPA[PEG(AgNP)]-anti-carcinoembryonic antigen antibody nanoparticles are evenly dispersed. Make up to volume with preservation buffer. Filter the above solution through a 0.45 μm filter membrane and aliquot after filtration.

[0118] The prepared SPA [PEG(AgNP)]-anticarcinoembryonic antigen antibody reagent, along with the matching calibrators and quality control samples, was tested on a fully automated biochemical analyzer.

[0119] 2) Validation of the limit of quantification for carcinoembryonic antigen (CEA)

[0120] Experimental Method: Five samples with quantitation limit concentrations were tested using reagents. Each sample was tested three times, and the tests were conducted over three days. The allowable error range for the test values ​​was set at ±25% of the quantitation limit. The number of test results for each sample falling within the allowable error range was calculated. The percentage of all sample measurements that met the acceptable target criteria of the LoQ statement was then calculated and compared with the lower limit value in the table below. If the percentage was greater than or equal to the corresponding result in the table below, the validation was considered successful.

[0121]

[0122] The experimental data and results are shown in Table 9.

[0123] Table 9. Quantitative Limit Validation Data Analysis Table

[0124]

[0125] The experimental results show that the reagent for detecting carcinoembryonic antigen (CEA) meets the accuracy target of 95.6% through limit of quantitation (LOQ) validation. This is greater than the minimum percentage (88%) required for a sample size of 45 in the consensus, and the LoQ validation is successful.

[0126] 3) Validation of the linear interval of carcinoembryonic antigen (CEA)

[0127] Experimental Method: High-value samples close to the upper limit of the linear range were diluted to at least five concentrations, with low-value samples close to the lower limit of the linear range. Following the kit instructions, each concentration was tested three times, and the average value was calculated. A regression analysis was performed between the measured average concentration (y) and the corresponding theoretical concentration or dilution factor (x) to determine the linear regression equation and calculate the linear correlation coefficient r. The result should be within the range of [0.2, 600] ng / mL, with a linear correlation coefficient (r) greater than 0.99. The relative bias between each measured value and the theoretical concentration value was calculated, and the relative bias should be within ±10%.

[0128] The experimental data and results are shown in Table 10.

[0129] Table 10 Analysis of Linear Interval Validation Data

[0130]

[0131] The experimental results show that, through linearity interval verification of the carcinoembryonic antigen reagent prepared by the above method, the linear correlation coefficient (r) is ≥0.9976 within the range of [0.2, 600] ng / mL, and the relative deviation of linearity does not exceed ±10%. This meets the clinical requirements for the linearity of carcinoembryonic antigen.

[0132] Example 4: A method for detecting alpha-fetoprotein based on biosynthetic nanomaterials

[0133] 1) The preparation method of SPA [PEG(AgNP)]-anti-alpha-fetoprotein antibody reagent is as follows:

[0134] An equimolar amount of anti-AFP antibody and SPA [PEG(AgNP)] were mixed at 4℃ and incubated overnight (16 h) in the dark to obtain working nanoparticles SPA [PEG(AgNP)]-anti-AFP antibody. The mixture was purified by 30KD ultrafiltration, washed, and filtered through a 0.45μm filter membrane.

[0135] Take the blocking buffer and add it to the purified working nanoparticles SPA[PEG(AgNP)]-Ab. Stir at room temperature for 4.5 hours. Centrifuge the above solution at 9000×g for 35 min at 4℃, discard the supernatant, wash the precipitate with glycine and purification buffer to reconstitute it, and sonicate for 4 min to homogenize the SPA[PEG(AgNP)]-anti-alpha-fetoprotein antibody nanoparticles. Centrifuge the above solution at 9000×g for 30-40 min at 4℃, discard the supernatant, reconstitute the precipitate with preservation buffer, and sonicate for 4 min to homogenize the SPA[PEG(AgNP)]-anti-alpha-fetoprotein antibody nanoparticles. Make up the volume with preservation buffer. Filter the above solution through a 0.45 μm filter membrane and aliquot after filtration.

[0136] The prepared SPA [PEG(AgNP)]-anti-alpha-fetoprotein antibody reagent, along with the matching calibrators and quality control samples, was tested on a fully automated biochemical analyzer.

[0137] 2) Validation of the limit of quantification for alpha-fetoprotein

[0138] Experimental Method: Five samples with quantitation limit concentrations were tested using reagents. Each sample was tested three times, and the tests were conducted over three days. The allowable error range for the test values ​​was set at ±25% of the quantitation limit. The number of test results for each sample falling within the allowable error range was calculated. The percentage of all sample measurements that met the acceptable target criteria of the LoQ statement was then calculated and compared with the lower limit value in the table below. If the percentage was greater than or equal to the corresponding result in the table below, the validation was considered successful.

[0139]

[0140] The experimental data and results are shown in Table 11.

[0141] Table 11 Quantitative Limit Validation Data Analysis Table

[0142]

[0143] The experimental results show that the reagent for detecting alpha-fetoprotein meets the accuracy target of 100% through limit of quantitation verification. Compared with the minimum percentage (88%) required for a sample size of 45 in the consensus, it is greater than the minimum required percentage, and the LoQ verification is passed.

[0144] 3) Validation of the linear interval of alpha-fetoprotein

[0145] Experimental Method: High-value samples close to the upper limit of the linear range were diluted to at least five concentrations, with low-value samples close to the lower limit of the linear range. The procedure was followed according to the kit instructions. Each concentration was tested three times, and the average value was calculated. Regression analysis was performed on the average measured concentration (y) and the corresponding theoretical concentration or dilution factor (x) to determine the linear regression equation and calculate the linear correlation coefficient r. The result should be within the range of [1, 1500] ng / mL, with a linear correlation coefficient (r) greater than 0.99. The relative bias between each measured value and the theoretical concentration value was calculated, and the relative bias should be within ±10%.

[0146] The experimental data and results are shown in Table 12.

[0147] Table 12 Analysis of Linear Interval Validation Data

[0148]

[0149] The experimental results show that, through linearity interval verification of the reagent for detecting alpha-fetoprotein prepared by the above method, the linear correlation coefficient (r) is ≥0.9966 within the range of [1, 1500] ng / mL, and the relative deviation of linearity does not exceed ±10%. This meets the clinical requirements for the linearity of alpha-fetoprotein.

[0150] Example 5: A method for detecting total prostate-specific antigen based on biosynthetic nanomaterials

[0151] 1) The preparation method of SPA [PEG(AgNP)]-anti-prostate specific antigen antibody reagent is as follows:

[0152] An equimolar amount of anti-prostate-specific antigen antibody and SPA [PEG(AgNP)] were mixed at 2–8 °C and incubated overnight (12–18 h) in the dark to obtain working nanoparticles SPA [PEG(AgNP)]-anti-prostate-specific antigen antibody. The mixture was purified by 30 kDa ultrafiltration, washed, and filtered through a 0.45 μm membrane.

[0153] Take the blocking buffer and add it to the purified working nanoparticles SPA[PEG(AgNP)]-anti-prostate specific antigen antibody. Stir at room temperature for 4.5 hours. Centrifuge the above solution at 4℃, 9000×g for 35 min, discard the supernatant, wash the precipitate with glycine and purification buffer, and sonicate for 4 minutes until the SPA[PEG(AgNP)]-anti-prostate specific antigen antibody nanoparticles are evenly dispersed. Centrifuge the above solution at 4℃, 9000×g for 35 min, discard the supernatant, reconstitute the precipitate with preservation buffer, and sonicate for 3-5 minutes until the SPA[PEG(AgNP)]-anti-prostate specific antigen antibody nanoparticles are evenly dispersed. Make up to volume with preservation buffer. Filter the above solution through a 0.45 μm filter membrane and aliquot.

[0154] The prepared SPA [PEG(AgNP)]-anti-prostate specific antigen antibody reagent, along with the matching calibrators and quality control samples, was tested on a fully automated biochemical analyzer.

[0155] 2) Validation of the limit of quantification for total prostate-specific antigen

[0156] Experimental Method: Five samples with quantitation limit concentrations were tested using reagents. Each sample was tested three times, and the tests were conducted over three days. The allowable error range for the test values ​​was set at ±25% of the quantitation limit. The number of test results for each sample falling within the allowable error range was calculated. The percentage of all sample measurements that met the acceptable target criteria of the LoQ statement was then calculated and compared with the lower limit value in the table below. If the percentage was greater than or equal to the corresponding result in the table below, the validation was considered successful.

[0157]

[0158] The experimental data and results are shown in Table 13.

[0159] Table 13 Analysis of Limit of Quantitation Validation Data

[0160]

[0161] The experimental results show that the reagent for detecting total prostate-specific antigen (PSA) meets the accuracy target of 97.8% by performing quantitation limit validation. This is greater than the minimum percentage (88%) required for a sample size of 45 in the consensus, and the LoQ validation is successful.

[0162] 3) Validation of the linear interval of total prostate-specific antigen.

[0163] Experimental Method: High-value samples close to the upper limit of the linear range were diluted to at least five concentrations, with low-value samples close to the lower limit of the linear range. The procedure was followed according to the kit instructions. Each concentration was tested three times, and the average value was calculated. Regression analysis was performed on the average measured concentration (y) and the corresponding theoretical concentration or dilution factor (x) to determine the linear regression equation and calculate the linear correlation coefficient r. The result should be within the range of [0.01, 80] ng / mL, with a linear correlation coefficient (r) greater than 0.99. The relative bias between each measured value and the theoretical concentration value was calculated, and the relative bias should be within ±10%.

[0164] The experimental data and results are shown in Table 14.

[0165] Table 14 Analysis of Linear Interval Validation Data

[0166]

[0167] The experimental results show that, through linearity interval verification of the total prostate-specific antigen reagent prepared by the above method, the linear correlation coefficient (r) is ≥0.9979 within the range of [0.01, 80] ng / mL, and the relative deviation of linearity does not exceed ±10%. This meets the clinical requirements for the linearity of total prostate-specific antigen.

[0168] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A method for detecting tumor markers for non-diagnostic purposes based on biosynthetic nanomaterials, characterized in that, include: The biosynthetic nanomaterial SPA [PEG (AgNP)]-Ab was mixed and incubated with the sample to be tested to allow the biosynthetic nanomaterial to specifically bind to the target tumor marker in the sample to be tested, thereby obtaining a mixed system. The visible light absorption signal of the mixture at 600-650 nm was detected using a fully automated biochemical analyzer. The content of tumor markers in the sample to be tested is determined based on the intensity of the visible light absorption signal. The SPA[PEG (AgNP)]-Ab is obtained by conjugating the SPA[PEG (AgNP)] complex with an antibody Ab corresponding to a tumor marker. The coupling steps of the SPA [PEG (AgNP)]-Ab are as follows: An equimolar amount of antibody against the target tumor marker was mixed with SPA [PEG (AgNP)] complex at 2-8℃ and mixed in the dark for 12-18h to obtain SPA [PEG (AgNP)]-Ab; The SPA [PEG (AgNP)] complex is formed by the self-assembly of fusion protein linkers SPA on the surface of PEG (AgNP) particles; The self-assembly step of the SPA [PEG (AgNP)] complex is as follows: Equimolar amounts of PEG (AgNP) particles and SPA protein were taken at 2-8℃ and assembled overnight at 2-8℃ under 10mM CaCl2 conditions to obtain the SPA [PEG (AgNP)] complex; The tumor markers include ferritin, carcinoembryonic antigen, alpha-fetoprotein, free prostate-specific antigen, total prostate-specific antigen, carbohydrate antigen 72-4, neuron-specific enolase, pepsinogen I, pepsinogen II, gastrin 17, human epididymal protein 4, squamous cell carcinoma antigen, gastrin-releasing peptide precursor, carbohydrate antigen 153, carbohydrate antigen 19-9, carbohydrate antigen 50, carbohydrate antigen 242, tumor-associated antigen CA125, cytokeratin 19 fragment, neuron-specific protein S100-β, thyroglobulin, β2-microglobulin, abnormal prothrombin, calcitonin, human epidermal growth factor receptor 2, malignant tumor-specific growth factor, tumor necrosis factor, and prostatic acid phosphatase.

2. The method for detecting tumor markers for non-diagnostic purposes based on biosynthetic nanomaterials according to claim 1, characterized in that, The fusion protein linker SPA is constructed by fusing S-layer proteins with Protein A; the S-layer proteins include SbpA, SbsB, and EA1; The construction steps of the fusion protein linker SPA include: The S-layer protein DNA sequence was extracted from E. coli strains containing the S-layer protein sequence, and the nucleotide sequence of the corresponding fusion peptide was added to the S-layer protein ORF. The fusion plasmid was transfected into E. coli, and expression and purification were performed to obtain the fusion protein linker SPA.

3. The method for detecting tumor markers for non-diagnostic purposes based on biosynthetic nanomaterials according to claim 1, characterized in that, The PEG (AgNP) particles are prepared by encapsulating bio-silver nanoparticles AgNPs with PEG. The preparation steps of the PEG (AgNP) particles include: The filtrate of Fusarium oxysporum strain was mixed with AgNO3 solution and reacted with shaking in the dark at pH 8.0, 30℃, and 100 rpm for 24-48 h to purify AgNPs. AgNPs were mixed with HS-PEG(2000-10000)-NH2 at a molar ratio of 1:200 and reacted for 2 h at 2-8 °C in an inert gas environment with pH 8.0 to obtain PEG (AgNP) particles after purification.

4. A biosynthetic nanomaterial SPA [PEG (AgNP)]-Ab, characterized in that, The biosynthetic nanomaterial SPA[PEG(AgNP)]-Ab is obtained by conjugating the SPA[PEG(AgNP)] complex with an antibody Ab, a tumor marker; the SPA[PEG(AgNP)] complex is self-assembled by a fusion protein linker SPA on the surface of PEG(AgNP) particles; the PEG(AgNP) particles are biosynthetic silver nanoparticles AgNPs encapsulated in PEG; the fusion protein linker SPA is constructed by fusing S-layer protein with Protein A.

5. A biochemical detection reagent for tumor markers, characterized in that, The tumor marker biochemical detection reagent is obtained by blocking, washing, purifying, and reconstituted the biosynthetic nanomaterial SPA [PEG (AgNP)]-Ab as described in claim 4.

6. The tumor marker biochemical detection reagent according to claim 5, characterized in that, The preparation method of the tumor marker biochemical detection reagent includes: Take the blocking solution and add it to the purified biosynthetic nanomaterial SPA [PEG (AgNP)]-Ab. Stir at room temperature for 4-5 hours and centrifuge at 2-8℃ to obtain the first precipitate. The first precipitate was redissolved in the purification buffer by washing with glycine, and then sonicated to ensure uniform dispersion of SPA [PEG(AgNP)]-Ab nanoparticles. The precipitate was then centrifuged at 2-8°C to obtain the second precipitate. The second precipitate was redissolved with the preservation solution, and ultrasonically treated to ensure uniform dispersion of SPA [PEG(AgNP)]-Ab nanoparticles. The volume was then adjusted with the preservation solution, and the mixture was filtered to obtain the final product.

7. The tumor marker biochemical detection reagent according to claim 6, characterized in that, The blocking solution comprises 0.75 g / L glycine, 200 g / L BSA, and 1 g / L sodium azide, with a pH of 7.4 ± 0.

1. The preservation solution comprises 15.01 g / L glycine, 50 g / L sucrose, 50 g / L mannitol, 40 g / L trehalose, and 50 g / L glycerol, with a pH of 8.2 ± 0.1.

Citation Information

Patent Citations

  • Method for predicting the response of subject suffering from viral infection of the liver to antiviral therapy

    CN101821629A

  • Preparation method of immunoagglutination detection reagent of SPA-labeled PEGylated fluorescent nanoprobe

    CN116413424A