Soybean ACS-CSL double-enzyme inactivation point mutant
By inserting bases into the soybean GmAH3 and GmAH4 genomes to form GmAH3209L and GmAH4209V mutants, the problem of unknown ACS and CSL activities in soybeans was solved, and the stress resistance and growth regulation of soybeans were improved.
Patent Information
- Application Number
- CN202511196216.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-26
- Publication Date
- 2025-11-21
AI Technical Summary
Currently, the identification of key active sites and domains of soybean 1-aminocyclopropane-1-carboxylic acid synthase protein (ACS and CSL), its mechanism of action, and its regulation have not been fully studied, which affects soybean variety improvement and the enhancement of its stress resistance.
By inserting specific bases into the GmAH3 and GmAH4 genomes of soybean, site-directed mutagenesis was performed to form GmAH3209L and GmAH4209V mutants, which lost both ACS and CSL activities, thus obtaining dual-enzyme inactivation mutants and providing new gene resources and targets.
Complete inactivation of ACS and CSL activities in soybeans was achieved, providing novel targets and gene resources for stress resistance modification, and enhancing the stress resistance and growth and development regulation capabilities of soybeans.
Smart Images
Figure CN120989026A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to soybean ACS-CSL double enzyme inactivation site mutants. Background Technology
[0002] The plant hormone ethylene plays a crucial role in various stages of plant growth and development, including seed germination, cell elongation, root development, flowering, and fruit ripening. Ethylene also plays a vital role in plant responses to various biotic and abiotic stresses. In seed plants, ethylene biosynthesis follows the ACC-dependent pathway, also known as the Yang cycle. The rate-limiting step in this pathway is the catalysis of S-adenosylmethionine (SAM) by 1-aminocyclopropane-1-carboxylate synthase (ACS) to produce the direct ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC).
[0003] In recent years, the inventors' team discovered that 1-aminocyclopropane-1-carboxylic acid synthase in seed plants, in addition to its traditionally recognized ACS activity, can also catalyze the production of ammonium ions, pyruvate, and thiocysteine using cysteine as a substrate, indicating that it also possesses CS lyase (CSL) activity. Pyruvate is the end product of glycolysis and an energy substrate for the mitochondrial tricarboxylic acid cycle, while thiocysteine can further generate hydrogen sulfide. Pyruvate and hydrogen sulfide play important roles in plant growth, development, and resistance to various abiotic stresses. The discovery of the dual-enzyme activity of 1-aminocyclopropane-1-carboxylic acid synthase in higher plants makes it a key intersection of two different but closely related life processes: promoting plant development and fruit ripening, and resisting abiotic stresses. Balancing and regulating its dual-enzyme activity is an important target for crop modification using biotechnology. In-depth analysis of the key structural domains and key sites of the 1-aminocyclopropane-1-carboxylic acid synthase dual enzyme activity in higher plants will not only open up new perspectives for elucidating the biological functions of this unique dual enzyme, but also provide important genetic resources for the creation of high-yielding and stress-resistant new varieties, which has important theoretical value and practical significance.
[0004] Soybeans Glycine max Soybean is an important crop used for both grain and oilseed production in my country, holding a significant strategic position in national economic development. The plant hormone ethylene and the gaseous signaling molecule hydrogen sulfide both play crucial roles in soybean growth, development, and responses to abiotic stress. However, to date, further research is needed to identify the key active sites and domains of soybean 1-aminocyclopropane-1-carboxylic acid synthase (ACS) and CSL, as well as their mechanisms of action, regulation, and utilization. SUMMARY
[0005] The embodiment of the present application aims to provide a soybean ACS-CSL double enzyme inactivation point mutant, which aims to solve the problems in the background art.
[0006] The embodiment of the present application is achieved by a soybean ACS-CSL double enzyme inactivation point mutant, which comprises GmAH3 209L and GmAH4 209V . The amino acid sequence of the GmAH3 209L is shown in SEQ ID NO. 1, and the amino acid sequence of the GmAH4 209V is shown in SEQ ID NO. 2.
[0007] In a further technical solution, the GmAH3 209L is a functionally unreported 1-aminocyclopropane-1-carboxylate synthase homologous gene located at 15273601-15275841 bases of the Gm07 chromosome of soybean, which is temporarily named as GmAH3 (Glycine max 1-aminocyclopropane-1-carboxylate synthase homologous protein 3), three bases C, C and T are inserted between 15274763 and 15274764 in the genome thereof, or three bases C, C and U are inserted between 722 and 723 in the corresponding mRNA sequence thereof, or three bases C, C and T are inserted between 623 and 624 in the corresponding CDS sequence thereof, so that a leucine (Leu, L) is inserted between the original 208 and 209 of the GmAH3 protein encoded thereby, and the ACS activity and the CSL activity of the mutated GmAH3 protein are lost.
[0008] In a further technical solution, the GmAH4 209V is a GmAH4 (Glycine max 1-aminocyclopropane-1-carboxylate synthase homologue 4) gene located in the position interval of 460822-463208 of the Gm01 chromosome of soybean, three bases G, T and A are inserted between 462037 and 462038 in the genome thereof, or three bases G, U and A are inserted between 729 and 730 in the corresponding mRNA sequence thereof, or three bases G, T and A are inserted between 624 and 625 in the corresponding cDNA sequence thereof, so that a valine (Val, V) is inserted between the original 208 and 209 amino acids of the GmAH4 protein, and the mutated protein is named as GmAH4209V which both ACS and CSL activities are lost.
[0009] The soybean ACS-CSL double-enzyme inactivation point mutant provided by the embodiment of the present application uses the functional site modification technology of the key enzyme of soybean ethylene synthesis 1-aminocyclopropane-1-carboxylic acid synthase, and obtains the double-enzyme inactivation mutant with all ACS and CSL activities lost by inserting specific bases, thereby providing a new target and gene resource for creating soybean stress-resistant varieties, and having a broad application prospect and important economic value in the molecular breeding of stress-resistant soybean. BRIEF DESCRIPTION OF DRAWINGS
[0010] Figure 1 GmAH3 209L dual-enzyme activity determination results; Figure 2 GmAH4 209V dual-enzyme activity determination results. DETAILED DESCRIPTION
[0011] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application is further described in detail below in combination with the drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application, and are not used to limit the present application.
[0012] The specific implementation of the present application is described in detail below in combination with specific embodiments.
[0013] The soybean ACS-CSL double-enzyme inactivation point mutant provided by one embodiment of the present application comprises GmAH3 209L and GmAH4 209V . The amino acid sequence of the GmAH3 209L is shown in SEQ ID NO. 1, and the amino acid sequence of the GmAH4 209V is shown in SEQ ID NO. 2.
[0014] As a preferred embodiment of the present application, the GmAH3 209LThe function-unreported 1-aminocyclopropane-1-carboxylate synthase homologous gene located at 15273601-15275841 bases of the Gm07 chromosome of soybean is temporarily named as GmAH3 (Glycine max 1-aminocyclopropane-1-carboxylate synthase homologous protein 3), three bases C, C and T are inserted between 15274763 and 15274764 in the genome of the GmAH3, or three bases C, C and U are inserted between 722 and 723 in the corresponding mRNA sequence of the GmAH3, or three bases C, C and T are inserted between 623 and 624 in the corresponding CDS sequence of the GmAH3, so that the soybean GmAH3 protein encoded by the GmAH3 has a leucine (Leu, L) inserted between the original 208 and 209, and the ACS activity and the CSL activity of the GmAH3 protein after mutation are lost.
[0015] As a preferred embodiment of the application, the GmAH4 209V The GmAH4 (Glycine max 1-aminocyclopropane-1-carboxylate synthase homologue 4) gene located at the position interval of 460822-463208 of the Gm01 chromosome of soybean has three bases G, T and A inserted between 462037 and 462038 in the genome of the GmAH4, or three bases G, U and A are inserted between 729 and 730 in the corresponding mRNA sequence of the GmAH4, or three bases G, T and A are inserted between 624 and 625 in the corresponding cDNA sequence of the GmAH4, so that the GmAH4 protein has a valine (Val, V) inserted between the original 208 and 209 amino acids, and the protein after mutation is named as GmAH4 209V , and the ACS and CSL activities of the GmAH4
[0016] As a preferred embodiment of the application, the GmAH3 209L The obtaining method of the sequence is as follows: 1. Design primers; (1) Design primers at the front and the end of the gene.
[0017] 07G-F: CAGCAAATGGGTCGCGGATCCATGGGTATTGAGATGGAGCAACCTTGTGT 07G-R: TGGTGGTGCTCGAGTGCGGCCGCCTAAACGCTTTCTGTCCTTATTCGTTC (2) Design primers at the position where bases are missing, and take about 15 bp above and below, about 30 bp in total 07G-209L-F: ACCCTTCCCTAAACCCATTAGGT 07G-209L-R: GGTTTAGGGAAGGGTTTGTGATT 2. PCR amplification experiment; A fragment amplification primer: 07G-F: CAGCAAATGGGTCGCGGATCCATGGGTATTGAGATGGAGCAACCTTGTGT 07G-209L-R: GGTTTAGGGAAGGGTTTGTGATT 652bp B fragment amplification primer: 07G-209L-F: ACCCTTCCCTAAACCCATTAGGT 07G-R: TGGTGGTGCTCGAGTGCGGCCGCCTAAACGCTTTCTGTCCTTATTCGTTC 751bp In a 50 μl reaction system, the plasmid containing the wild type GmAH3 gene is used as a template, 10 μM of the primer is 1 μl, and HiFi Hot Start is used as a DNA polymerase; the amplification conditions are: 95℃ for 5 min; 98℃ for 20 s; 58℃ for 15 s; 72℃ for 1 min; 72℃ for 10 min; a total of 25 cycles.
[0018] 3. AB fragment fusion (1388bp); The reaction system for amplification is: in a 50 μl reaction system, according to the concentration and length of A and B fragments, the volume of A and B fragments to be added is calculated according to the principle of total volume 15 μl, and HiFi Hot Start is used as a DNA polymerase; the amplification conditions are: 95℃ for 5 min; 98℃ for 20 s; 58℃ for 15 s; 72℃ for 2 min; 72℃ for 10 min; a total of 11 cycles, then, the purified product obtained in this step is used as a template, HiFi Hot Start is used as a DNA polymerase, and GmAH3 upstream and downstream 07G-F and 07G-R are used as primers to obtain the target product GmAH3 by fusion PCR. 209L .
[0019] In the embodiment of the application, GmAH3 209L The in vitro expression and purification method of the protein is as follows: After purification, the PCR product was ligated into pGEX6p-1 vector by enzyme digestion and ligation method using BamH I and Not I. After sequencing verification, the correct GmAH3 209L Expression vector of nucleotide sequence. The correct vector was verified by sequencing, 20 ng of which was transformed into BL21 competent cells, which were inoculated on LB plates containing ampicillin and incubated at 37°C overnight. The next day, single colonies were picked and cultured. The transformed cells were collected and purified according to the instructions of GST Sep Glutathione Agarose Resin (YASEN, item number 20507ES). 209L .
[0020] GmAH3 209L Protein activity determination method is as follows: The determination method of ACS activity is as follows: the purified mutant protein GmAH3 209L or the corresponding positive and negative controls (transformed GmAH4, the same process protein extract of the empty vector pGEX6p-1 strain), ACS reaction buffer (50 mM EPPS, pH 8.5, 10 μM PLP, 2 mM DTT) and S-adenosyl methionine (SAM) were incubated, the reaction was terminated with 100 mM HgCl2, then fresh ACC assay solution [saturated NaOH: sodium hypochlorite = 2:1 (v:v)] was added to convert the generated ACC into ethylene, and the amount of ethylene generated was analyzed and calculated using a gas chromatograph (Agilent 7890A).
[0021] The basic reaction system for determining the activity of CSL is as follows: the purified mutant protein GmAH3 209L or the positive and negative controls, the substrate such as L-cystine, 0.1M potassium phosphate buffer pH7.8, 10 mM PLP and 2 mM DTT were incubated, and chloroform was added to extract the protein after the reaction was completed. For the determination of the reaction product pyruvic acid, the amount of pyruvic acid-2,4-dinitrophenylhydrazone generated by the reaction of pyruvic acid with 2,4-dinitrophenylhydrazine was detected by spectrophotometry.
[0022] GmAH3 209L The results of protein activity determination are shown in Figure 1 , wherein, Figure 1 A is the ACS activity determination result of GmAH3 209L , and pGEX6p-1 empty vector and GmAH3 are used as negative and positive controls, respectively. Figure 1 B is the CSL activity determination result of GmAH3 209L , Figure 1 The picture in B is GmAH3209L pyruvate color reaction, the column chart is the quantification of CSL activity of GmAH3 520 according to the OD value of the mixed solution after reaction. pGEX6p-1 empty vector and GmAH3 were used as negative and positive controls respectively. 209L
[0023] As a preferred embodiment of the present application, GmAH4 209V The method for obtaining the sequence is as follows: 1. Design primers; (1) Design primers at the front and the end of the gene, and use seamless cloning primers.
[0024] 01G-F: CAGCAAATGGGTCGCGGATCCATGGGTATTGAGATGGAGCAACCCTGTGT 01G-R: TGGTGGTGCTCGAGTGCGGCCGCTCAAAAAAAGACGTTTTGTGTCCTTAT (2) Design primers at the position where bases are missing, and take about 15 bp above and below, about 30 bp in total 01G-209V-F: CCCTTCAGTAAACCCATTAGGT 01G-209V-R: TTTACTGAAGGGTTTGTGATT 2. PCR amplification experiment; A fragment amplification primer: 01G-F: CAGCAAATGGGTCGCGGATCCATGGGTATTGAGATGGAGCAACCCTGTGT 01G-208V-R: TTTACTGAAGGGTTTGTGATT 650 bp B fragment amplification primer: 01G-208V-F: CCCTTCAGTAAACCCATTAGGT 01G-R: TGGTGGTGCTCGAGTGCGGCCGCTCAAAAAAAGACGTTTTGTGTCCTTAT 750 bp In a 50 μl reaction system, the plasmid containing the wild type GmAH4 gene is used as a template, 10 μM of each primer is 1 μl, and HiFi Hot Start is used as a DNA polymerase; the amplification conditions are: 95℃ 5 min; 98℃ 20 s; 58℃ 15 s; 72℃ 1 min; 72℃ 10 min; a total of 25 cycles.
[0025] 3. AB fragment fusion (1388 bp) The reaction system for amplification is: in a 50 μl reaction system, according to the concentration and length of the A and B fragments, the volume of A and B fragments to be added is calculated according to the principle of total volume 15 μl, and HiFi Hot Start is used as a DNA polymerase; the amplification conditions are: 95℃ 5 min; 98℃ 20 s; 58℃ 15 s; 72℃ 2 min; 72℃ 10 min; a total of 11 cycles, then, the purified product obtained in this step is used as a template, HiFi Hot Start is used as a DNA polymerase, and 01G-F and 01G-R are used as primers to obtain the target product GmAH4 209V .
[0026] In the embodiment of the application, GmAH4 209V The in vitro expression process of the protein is as follows: After the PCR product is purified, the product is connected to the pMD_18-T vector according to the pMD_18-T Vector Cloning Kit kit. After the correct sequence is verified, the pMD_18-T vector and the expression vector pET28a are double-digested with BamH I and Not I, the target fragment is connected to the pET28a, and the GmAH4 209V nucleotide sequence expression vector. The correct expression vector is verified by sequencing, 20 ng of which is transformed into BL21 competent cells, which are cultured on LB plates containing kanamycin at 37℃ overnight. The single colony identified as positive is picked and placed in 5 ml of LB liquid medium containing kanamycin, and cultured at 37℃, 210 rpm overnight. The next day, 100 μl of bacterial solution is added to 10 ml of LB liquid medium containing kanamycin, and cultured at 37℃, 210 rpm to an OD 600 of about 0.6-0.8. The inducer IPTG is added to the bacterial solution to a final concentration of 0.6 mM, and induced at 16℃, 210 rpm overnight.
[0027] GmAH4 209V The double enzyme activity determination method is as follows: ACS activity assay: The induced bacteria were centrifuged at 12,000 rpm for 5 min, and the supernatant was transferred to a 5 ml EP tube and stored at 4°C. The supernatant or the corresponding positive and negative controls (GmAH4, the same extract of the same procedure of the strain transformed with empty vector pET28a), ACS reaction buffer (50 mM EPPS, pH 8.5, 10 μΜ PLP, 2 mM DTT) and S-adenosyl methionine (SAM) were incubated, and the reaction was terminated with 100 mM HgCl2. Then, fresh ACC assay solution [saturated NaOH: sodium hypochlorite = 2: 1 (v:v)] was added to convert the generated ACC into ethylene, and the amount of ACC generated was calculated by gas chromatography (Agilent 7890A).
[0028] CSL activity assay: The induced bacteria were centrifuged at 4°C, 6000 rpm for 6 min, and the supernatant was discarded. Then, 3 ml of 20 mM imidazole was added to suspend the bacteria, and PMSF was added to a final concentration of 1 mM, and the mixture was placed on ice. The bacteria were broken by ultrasonic instrument for 20 times, each time for 2 s, with an interval of 5 s. The broken bacteria were centrifuged at 4°C, 12000 rpm for 20 min, and the supernatant was collected and added with PMSF to a final concentration of 1 mM, and the mixture was placed on ice. 100 μg of the crude protein extract or the corresponding positive and negative controls (GmAH4, the same extract of the same procedure of the strain transformed with empty vector pET28a), substrate such as L-cystine, 0.1 M potassium phosphate buffer pH 7.8, 10 mM PLP and 2 mM DTT were incubated, and chloroform was added to extract the protein after the reaction. For the determination of the reaction product pyruvate, the amount of pyruvate-2,4-dinitrophenylhydrazone generated by the reaction of pyruvate and 2,4-dinitrophenylhydrazine was detected by spectrophotometry.
[0029] GmAH4 209V The results of the double enzyme activity assay are shown in Figure 2 , wherein, Figure 2 A is the ACS activity assay result of GmAH4 209V , and pET28a empty vector and GmAH4 are used as negative and positive controls, respectively. Figure 2 B is the CSL activity assay result of GmAH4 209V , Figure 2 The picture in B is the pyruvate color reaction of GmAH4 209V , and the column chart is the quantification of the CSL activity of GmAH4 520 based on the OD 209V value of the mixture after the reaction. pET28a empty vector and GmAH4 are used as negative and positive controls, respectively.
[0030] The above description is only the preferred embodiment of the present application, and is not intended to limit the present application. Any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A soybean ACS-CSL double enzyme inactivation point mutant characterized in that, The soybean ACS-CSL double enzyme inactivation point mutant includes GmAH3 209L and GmAH4 209V ; The amino acid sequence of the GmAH3 209L The amino acid sequence of the GmAH4 209V The amino acid sequence of the GmAH4