A streptococcus suis bacteriophage chimeric lytic enzyme, a preparation method and application thereof

Abstract

The present application is suitable for the technical field of genetic engineering, and provides a bacteriophage chimeric lytic enzyme for killing Streptococcus suis, a nucleotide sequence of which is shown as SEQ ID NO. 1, and an amino acid sequence of which is shown as SEQ ID NO. 2. The present application also provides a preparation method of the bacteriophage chimeric lytic enzyme, comprising the following steps: recombinant expression of bacteriophage chimeric lytic enzyme ClyU, construction of a vector; transformation of an expression vector pET-15b-ClyU; expression and purification of the bacteriophage chimeric lytic enzyme ClyU. The present application also provides an application of the bacteriophage chimeric lytic enzyme in inhibiting and killing Streptococcus suis. The present application also provides an application of the bacteriophage chimeric lytic enzyme in preparing a pharmaceutical composition for killing Streptococcus suis. The present application constructs a bacteriophage chimeric lytic enzyme for efficiently killing Streptococcus suis through gene splicing technology, and the bacteriophage chimeric lytic enzyme has strong lytic activity and a wide lytic spectrum for Streptococcus suis, and can effectively kill Streptococcus suis.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to a phage chimeric lyase for killing Streptococcus suis, its preparation method, and its application. Background Technology

[0002] Streptococcus suis is a zoonotic pathogen. Based on the antigenicity of its capsular polysaccharide (CPS), Streptococcus suis can be classified into 33 serotypes, among which serotypes 2, 9, 3, 1 / 2, and 7 are the most prevalent. Serotype 2 is the most widespread and harmful globally, causing diseases such as sepsis, meningitis, endocarditis, pneumonia, and arthritis, with a very high mortality rate. The overuse of antibiotics has exacerbated the drug resistance situation of Streptococcus suis, and the emergence of drug-resistant and multidrug-resistant strains makes antibiotic prevention and control more difficult. Therefore, there is an urgent need to find a novel antibacterial agent that is effective against Streptococcus suis and does not easily induce drug resistance.

[0003] Bacteriophage lyases are a class of hydrolytic enzymes encoded by the bacteriophage genome that act on the peptidoglycan of bacterial cell walls. They exhibit highly efficient bactericidal activity against Gram-positive bacteria and possess a typical modular structure, meaning that a phage lyase consists of at least two distinct functional domains (modules). The structure of Gram-positive bacterial phage lyases typically includes a catalytic domain (EAD) at the N-terminus and a cell wall-binding domain (CBD) at the C-terminus. Since the EAD and CBD of the lyase are independent, chimeric lyases with superior performance compared to parental lyases can be constructed by combining EADs and CBDs from different sources, thereby enhancing their bactericidal activity and broadening their bactericidal spectrum. Therefore, chimeric phage lyases have great potential for clinical application in the treatment of drug-resistant and multidrug-resistant Streptococcus suis infections.

[0004] Currently, the number of reported Streptococcus suis phage lyases is small, their specificity is too high, and they can only kill a few serotypes of Streptococcus suis. Furthermore, their lysing activity needs to be further improved. Therefore, it is of great significance to develop and modify phage chimeric lyases with better performance. Summary of the Invention

[0005] The purpose of this invention is to provide a phage chimeric lyase for killing Streptococcus suis, thereby addressing the problems existing in the background art.

[0006] The present invention is implemented as follows: a bacteriophage chimeric lyase for killing Streptococcus suis, the nucleotide sequence of which is shown in SEQ ID NO.1 and the amino acid sequence of which is shown in SEQ ID NO.2.

[0007] Another objective of this invention is to provide a method for preparing the above-mentioned phage chimeric lysin, comprising the following steps:

[0008] (1) Recombinant expression of phage chimeric lyase ClyU and construction of the vector: The catalytic domain of phage lyase Ply1228 and the cell wall binding domain of phage lyase Ply30 were seamlessly cloned into the pET-15b vector to construct the expression vector pET-15b-ClyU.

[0009] (2) Transformation of expression vector pET-15b-ClyU: The expression vector pET-15b-ClyU was transformed into engineered Escherichia coli BL21(DE3), and high expression strains were screened after transformants appeared;

[0010] (3) Expression and purification of phage chimeric lyase ClyU: single colonies of high-expression strains were picked and inoculated into culture medium for induction culture. The induced cells were collected and subjected to ultrasonic disruption, affinity chromatography purification, and SDS-PAGE identification to obtain the phage chimeric lyase that kills Streptococcus suis.

[0011] Preferably, the step of seamlessly cloning the catalytic domain of phage lyase Ply1228 and the cell wall binding domain of phage lyase Ply30 into the pET-15b vector includes: using primers 1228EAD'-F (GGCAGCCATATGCCCATGATAATCAATCTTGA) and 1228EAD'-R.

[0012] (TCCTCCGCTTCCTCCTCCTCCGCTTCCTCCTCCTCCTGATTTGCCGGACG GTA) Amplified the catalytic domain 1228EAD gene of the parental phage lyase Ply1228; Amplified the binding domain 30CBD gene of the parental phage lyase Ply30 using primers 30CBD-F (AGCGGAGGAGGAGGAAGCGGAGGAGGAAGCCAGGCAAGC AGTGGCAA) and primers 30CBD-R (TCGGGCTTTGTTAGCAGCCGCTATTTAAACGTACCATAAG).

[0013] Another objective of this invention is to provide the application of the above-mentioned phage chimeric lyase in inhibiting and killing Streptococcus suis.

[0014] Another objective of this invention is to provide the application of the above-mentioned bacteriophage chimeric lyase in the preparation of a pharmaceutical composition for killing Streptococcus suis.

[0015] Preferably, the pharmaceutical composition is a liquid formulation, a lyophilized formulation, or an oral solid formulation.

[0016] This invention utilizes gene splicing technology to construct a phage chimeric lyase capable of efficiently killing Streptococcus suis. It can be used alone or in combination with other substances, or prepared into an enzyme preparation. It exhibits strong lytic activity and a broad lytic spectrum against Streptococcus suis, effectively killing the bacteria and providing a new approach for preparing drugs to prevent and treat diseases caused by Streptococcus suis infection. Attached Figure Description

[0017] Figure 1 This is an SDS-PAGE electrophoresis analysis image provided in Embodiment 1 of the present invention;

[0018] Figure 2 The results of the plate lysis activity assay of the phage chimeric lyase ClyU provided in Example 2 of this invention;

[0019] Figure 3 The results of in vitro liquid environment bactericidal activity assays of different concentrations of phage chimeric lyase ClyU provided in Example 3 of the present invention;

[0020] Figure 4 The results of the cleavage spectrum determination of the phage chimeric lyase ClyU provided in Example 4 of the present invention. Detailed Implementation

[0021] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0022] The specific implementation of the present invention will be described in detail below with reference to specific embodiments.

[0023] Example 1: Expression and purification of a phage chimeric lyase ClyU:

[0024] (1) The phage chimeric lyase ClyU is derived by combining the catalytic domain of phage lyase Ply1228 (GenBank: MW582537.1) with the cell wall binding domain of phage lyase Ply30 (gene phi30c_0011, GenBank: KC348599.1) using gene splicing technology.

[0025] Use primers 1228EAD'-F (GGCAGCCATATGCCCATGATAATCAATCTTGA) (as shown in SEQ ID NO.3) and primers 1228EAD'-R (TCCTCCGCTTCCTCCTCCTCCGCTTCCTCCTCCTCCTGATTTG CCGGACGGTA) (as shown in SEQ ID NO.4);

[0026] The catalytic domain 1228EAD gene of the parental phage lyase Ply1228 was amplified, and the binding domain 30CBD gene of the parental phage lyase Ply30 was amplified using primers 30CBD-F (AGCGGAGGAGGAGGAAGCGGAGGAGGAAGCCAGGCAAGC AGTGGCAA) (as shown in SEQ ID NO.5) and primers 30CBD-R (TCGGGCTTTGTTAGCAGCCGCTATTTAAACGTACCATAAG) (as shown in SEQ ID NO.6).

[0027] (2) According to the Seamless Cloning Kit (Beyotime, Shanghai) instructions, the 1228EAD fragment, 30CBD fragment, vector pET-15b digested by BamHI and XhoI enzymes and 2×Seamless Cloning Mix were mixed and incubated at 50℃ for 15 min. The ligation product was transformed into DH5α competent cells by heat shock method, and the correctly identified recombinant plasmid was transformed into BL21(DE3) competent cells.

[0028] (3) 500.0 mL of pET-15b-ClyU glycerol bacteria were cultured to the logarithmic growth phase (OD600 = 0.6-0.8), 1 mM IPTG was added, and the bacteria were induced at 16℃ in a shaker for 18 h. The induced bacterial solution was collected (4℃, 8000×g, 5 min) and resuspended with an appropriate amount of Tris-Cl buffer (pH = 7.5). The bacterial cells were then sonicated and centrifuged (4℃, 10000×g, 20min) to collect the supernatant. Next, the protein was purified by affinity chromatography using Ni-NTA. The collected supernatant was added to a nickel column and loaded three times. Then, 20mM and 50mM imidazole were added to elute the impurities, and finally 500mM imidazole was added to elute the target protein. The protein was then concentrated, and 500mM of the target protein elution buffer was added to an ultrafiltration tube. The tube was centrifuged (4℃, 3500×g, 40min). The liquid in the ultrafiltration tube was then flash-frozen in liquid nitrogen and stored at -80℃. The concentration of the purified phage chimeric lyase ClyU was determined using a BCA protein quantification kit. The pre-induction sample, whole bacteria, supernatant, and purified protein sample were analyzed by SDS-PAGE electrophoresis.

[0029] The results are as follows Figure 1 As shown, wells 1, 2, 3, and 4 represent the bacterial culture before induction of the phage chimeric lyase ClyU, the whole culture, the supernatant, and the purified sample, respectively. The purified phage chimeric lyase ClyU has a very high purity.

[0030] The SDS-PAGE adhesive formulation is as follows:

[0031] SDS-PAGE separating gel (12%):

[0032]

[0033] SDS-PAGE stacking gel:

[0034]

[0035]

[0036] Example 2: Determination of the lysis activity of the phage chimeric lyase ClyU on plate:

[0037] Streptococcus suis strain SC295 was cultured to the stationary phase. The bacterial suspension was then evenly spread onto solid BHI agar plates using a spreader. 10.0 μL of purified phage chimeric lysin ClyU (100 μg / mL) was added dropwise to the plate, with 10.0 μL of Tris-NaCl buffer added as a control. After the plates were dried, they were incubated upside down at 37°C for 20 hours. The lysis of the plates was observed, and the results are as follows: Figure 2 As shown, according to Figure 2 The presence of clear empty spots at the arrow indicates that the phage chimeric lyase ClyU has strong lytic activity against Streptococcus suis SC295.

[0038] Example 3: Determination of the bactericidal activity of the phage chimeric lyase ClyU in an in vitro liquid environment:

[0039] Strain SC295 was cultured to the logarithmic growth phase (OD600 = 0.6–0.8), washed three times with sterile Tris-NaCl buffer, and ClyU protein was added to the bacterial culture at final concentrations of 50 μg / mL, 100 μg / mL, and 200 μg / mL, respectively. An equal volume of sterile Tris-NaCl buffer was added to the negative control group. The cultures were incubated in a 37°C water bath for 1 hour, with samples taken every 10 minutes. Bacterial concentration was determined using a serial dilution method. This experiment was repeated three times, and the results are shown below. Figure 3 As shown, according to Figure 3 It can be seen that the phage chimeric lyase ClyU exhibits highly efficient bactericidal activity against Streptococcus suis, and this activity increases with increasing concentration.

[0040] Example 4: Determination of the cleavage profile of the phage chimeric lyase ClyU:

[0041] Thirty strains of Streptococcus suis, ten strains of Staphylococcus aureus, ten strains of Escherichia coli, ten strains of Salmonella, ten strains of Bacillus subtilis, ten strains of Serratia marcescens, and ten strains of Klebsiella pneumoniae were cultured to the logarithmic growth phase (OD600 = 0.6-0.8), then washed three times with sterile Tris-Cl buffer. The initial bacterial concentration was determined by serial dilution. Bacteriophage chimeric lyase ClyU (100 μg / mL) was added to the bacterial suspension, and the mixture was incubated at 37°C for 60 min. The bacterial concentration after treatment with bacteriophage chimeric lyase was determined again by serial dilution. The reduction in bacteria after incubation compared with the initial concentration was calculated as a negative control. An equal volume of PBS buffer was added to the bacterial suspension for co-incubation. This experiment was repeated three times.

[0042] The results are as follows Figure 4 As shown, according to Figure 4 It can be seen that the phage chimeric lyase ClyU exhibits highly efficient lytic activity against Streptococcus suis, with 3 strains showing a reduction of 6-7 Logs, 12 strains showing a reduction of 5-6 Logs, 6 strains showing a reduction of 4-5 Logs, 5 strains showing a reduction of 3-4 Logs, 2 strains showing a reduction of 2-3 Logs, and 2 strains showing a reduction of 1-2 Logs. Meanwhile, the phage chimeric lyase ClyU does not exhibit lytic activity against Staphylococcus aureus, Escherichia coli, Salmonella, Bacillus subtilis, Serratia marcescens, and Klebsiella pneumoniae.

[0043] In summary, the phage chimeric lyase ClyU modified by gene splicing technology in this embodiment of the invention exhibits strong bactericidal activity and a broad bactericidal spectrum against Streptococcus suis. ClyU has a size of 30 kDa and can form clear inhibition plaques on BHI solid plates coated with Streptococcus suis SC295. ClyU can lyse 30 tested Streptococcus suis strains. Therefore, this phage chimeric lyase can be used to prepare drugs for the prevention and treatment of diseases caused by Streptococcus suis infection.

[0044] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A phage chimeric lyase for killing Streptococcus suis, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.

2.

2. The use of the bacteriophage chimeric lyase as described in claim 1 in the preparation of a pharmaceutical composition for killing Streptococcus suis.

3. The application according to claim 2, characterized in that, The pharmaceutical composition is a liquid formulation or a lyophilized formulation.

Images