Molecular marker of qsgc.a2-1 significantly associated with brassica napus seed glucosinolate content and application thereof

Abstract

The application belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker of a site significantly related to Brassica napus seed glucosinolate and application qSGC.A2-1 The site significantly related to the content of Brassica napus seed glucosinolate qSGC.A2-1 And a peak SNP marker Bn-A02-p26214379 thereof is located at the 23,890,732th base of the A02 chromosome of the Brassica napus DarmorV4.1 reference genome, has an average additive effect of-23.9 mu mol / g, and can explain 8.5% of the phenotypic variance. The PARMS marker designed by using the SNP is used for detecting Brassica napus germplasm resources, and it is found that the operation is simple, the typing is clear, the average glucosinolate content of the AA genotype is lower than that of the CC genotype material seed, and therefore the Brassica napus seed glucosinolate has a good selection effect.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and genetic breeding technology, specifically relating to a molecular marker qSGC.A2-1, a site significantly associated with glucosinolate content in rapeseed seeds, and its application. Background Technology

[0002] Currently, the main goals of rapeseed breeding include resistance, yield, and quality. These traits are complex quantitative traits, regulated by numerous genes and easily influenced by environmental conditions. Traditional breeding methods and techniques struggle to achieve precise improvement of these traits. However, the rapid advancement of molecular marker technology and the widespread application of emerging biotechnologies such as gene editing have made molecular modification of these traits possible.

[0003] The quality traits of rapeseed mainly include the oil content, erucic acid, and glucosinolate (thioglucosinolate) content of rapeseed seeds. Glucosinolates are a class of sulfur-containing secondary metabolites, with a core structure consisting of a β-thioglucosyl group, a sulfonyl oxime group, and a side chain R group derived from different amino acids. Glucosinolates are mainly found in cruciferous plants, such as rapeseed, broccoli, and cauliflower. Glucosinolates have various positive effects in human cancer prevention, plant disease and pest control, and imparting special flavors to vegetables (Xie Zhaoqi, 2023). However, glucosinolates in rapeseed meal are toxic to livestock, so the glucosinolate content in rapeseed grains determines the value of rapeseed meal as animal feed.

[0004] Using linkage and / or association mapping methods, a number of QTLs controlling glucosinolate content in rapeseed seeds have been identified (Chao et al., 2022; Zhang et al., 2024), mostly distributed on chromosomes A9, C2, C7, and C9, primarily corresponding to genes such as GTR2 and MYB28 (Zhang et al., 2024). However, these QTLs are insufficient to explain the variation in glucosinolate content in rapeseed germplasm resources, indicating that new glucosinolate content regulatory sites still need to be discovered.

[0005] This invention utilizes high-density SNP genotype data from a core associated population of rapeseed and seed glucosinolate content phenotypic data from eight environments to conduct genome-wide association analysis, aiming to find new and stable association sites and develop practical, high-throughput, low-cost molecular markers for molecular improvement of glucosinolate content in rapeseed seeds. Summary of the Invention

[0006] The purpose of this invention is to provide a reagent for detecting the 23,890,732nd base on chromosome A02 of Brassica napus and its application in the screening and breeding of glucosinolate content in Brassica napus seeds.

[0007] Another objective of this invention is to provide the application of primers for detecting bases at positions 23,890,732 on chromosome A02 of Brassica napus in the screening and breeding of glucosinolate content in Brassica napus seeds.

[0008] The final objective of this invention is to provide a method for screening and breeding rapeseed seeds for glucosinolate content.

[0009] To achieve the above objectives, the present invention adopts the following technical measures:

[0010] The glucosinolate content in rapeseed seeds was significantly associated with the acquisition of PARMS markers:

[0011] (1) Total DNA was extracted from 331 materials of the core associated population of Brassica napus (Li et al., 2020) constructed by our team, and genotyping was performed on each sample using the Brassica napus 60K SNP chip (Clarke et al., 2016).

[0012] (2) The heterozygous rate, missing rate, and minor allele frequency of the population materials at each locus were calculated using Illumina BeadStudio genotyping software (http: / / www.illumina.com / ). Markers with no polymorphism, high deletion rate, no homozygous genotype, low allele frequency, high heterozygous genotype frequency, uncertain location, and multiple copy markers were removed, resulting in 24,508 high-quality SNP markers for subsequent analysis.

[0013] (3) The 331 materials of the core association population of Brassica napus constructed by our team were planted in eight environments (Nanchang 2014, Wuhan 2012-2016, Zhengzhou 2013-2014) (codes N14, W12, W13, W14, W15, W16, Z13, Z14). At maturity, 10 plants were harvested from each plot, dried and threshed, and the glucosinolate content was determined by near-infrared spectroscopy (Qiu et al., 2006).

[0014] (4) Based on the SNP genotypes, seed glucosinolate content phenotypes, population structure, and phylogenetic data of the core associated population, association analysis was performed using TASSEL 5.0 software (Bradbury et al., 2007). Finally, the locus qSGC.A2-1, significantly associated with multiple glucosinolates, was obtained on chromosome A02 of the rapeseed DarmorV4 reference genome. Its peak SNP marker, Bn-A02-p26214379, is located at bases 23,890, and 732 (bases A or C), and can be repeatedly detected in three environments.

[0015] (5) Extract 100 bp sequences upstream and downstream of the 23rd, 890th, and 732nd bases on the A02 chromosome of rapeseed, and obtain PARMS detection primer sequences according to primer design principles: qSGC.A2-1Fa: gaaggtgaccaagttcatgct GGCTGTGCTAATCGCTGCA; qSGC.A2-1Fc: gaaggtcggagtcaacggatt GGCTGTGCTAATCGCTGCC; qSGC.A2-1R: ACCAAAATACTCCTAGTATGTTGTATATATACG.

[0016] The scope of protection of this invention includes:

[0017] Application of reagents for detecting bases at positions 23,890,732 on chromosome A02 of Brassica napus in screening and breeding of glucosinolate content in Brassica napus seeds.

[0018] Application of reagents for detecting bases at positions 23,890,732 on chromosome A02 of Brassica napus in the preparation of a screening kit for glucosinolate content in Brassica napus seeds.

[0019] If the base at position 23,890,732 on chromosome A02 of the Brassica napus variety is detected as C, it indicates that the seeds of this variety have a high glucosinolate content.

[0020] If the base at position 23,890,732 on chromosome A02 of Brassica napus is detected as A, it indicates that the glucosinolate content in the seeds of this variety is low.

[0021] The reagents described above are preferably primers.

[0022] The primers described above are preferably PARMS detection primers.

[0023] The primers described above are more preferably the primers provided by the present invention: qSGC.A2-1Fa: gaaggtgaccaagttcatgctGGCTGTGCTAATCGCTGCA, qSGC.A2-1Fc: gaaggtcggagtcaacggatt GGCTGTGCTAATCGCTGCC, and qSGC.A2-1R: ACCAAAATACTCCTAGTATGTTGTATATATACG.

[0024] A method for screening and breeding of glucosinolate content in rapeseed seeds includes detecting base position 23,890,732 on chromosome A02 of rapeseed using conventional methods in the art. The conventional methods include, but are not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry.

[0025] The preferred method described above is PCR detection, using the following primers: qSGC.A2-1Fa: gaaggtgaccaag ttcatgct GGCTGTGCTAATCGCTGCA, qSGC.A2-1Fc: gaaggtcggagtcaacggattGGCTGTGCT AATCGCTGCC, and qSGC.A2-1R: ACCAAAATACTCCTAGTATGTTGTATATATACG.

[0026] The version number of the Brassica napus genome used in this invention is B. napus Darmor-bzh referencegenome sequence assembly (version 4.1) (Chalhoub et al., 2014).

[0027] Compared with the prior art, the present invention has the following advantages:

[0028] (1) The present invention obtained the site qSGC.A2-1, which is significantly associated with the glucosinolate content of rapeseed seeds and can be repeatedly detected. The average additive effect is -23.9 μmol / g, which can explain 8.5% of the phenotypic variance on average. It can be effectively applied to the genetic improvement of glucosinolate content in rapeseed seeds.

[0029] (2) The present invention obtains PARMS markers that are significantly associated with the glucosinolate content in rapeseed seeds. The detection method is simple and low cost, and can perform high-throughput screening of the genomic haplotype region of glucosinolates in rapeseed, thereby improving selection efficiency and accuracy. Detailed Implementation

[0030] Unless otherwise specified, the technical solutions described in this invention are all conventional techniques in the field; the reagents or materials described, unless otherwise specified, are all from commercial sources. The version number of the Brassica napus genome used in this invention is B. napusDa rmor-bzh reference genome sequence assembly (version 4.1) (Chalhoub et al., 2014). Most of the materials tested in the embodiments of this application are high-generation inbred lines; unless otherwise specified, there is no data on heterozygous genotypes. Example 1: Obtaining SNP markers that significantly correlate with glucosinolate content in rapeseed seeds.

[0031] (1) 1063 rapeseed inbred lines from various countries around the world were collected (Li et al., 2015), and 331 materials were selected from them to construct a core associated population (Li et al., 2020) based on their genotype and phenotypic data. Single leaves of each line in the associated population were collected, and total DNA was extracted using the CTAB method. Genotyping of each sample was performed using a rapeseed 60K SNP chip (Clarke et al., 2016).

[0032] (2) The heterozygosity rate, missing rate, and minor allele frequency of the population materials at each locus were calculated using Illumina BeadStudio genotyping software (http: / / www.illumina.com / ). Phylogenetic relationships among 331 Brassica napus accessions were calculated using SPAGeDi software (Hardy and Vekemans, 2002). SNP markers were filtered based on criteria including a missing rate ≤0.2, a heterozygosity rate ≤0.2, a minor allele frequency >0.05, and a unique match of the SNP marker in the Brassica napus genome. A total of 24,508 high-quality SNP markers were obtained for genome-wide association analysis.

[0033] (3) 331 strains of the core related population were planted in eight environments (Nanchang 2014, Wuhan 2012-2016, Zhengzhou 2013-2014) (codes: N14, W12, W13, W14, W15, W16, Z13, Z14). At maturity, 10 representative single plants from each plot were harvested, dried, threshed, and their glucosinolate content was determined by near-infrared spectroscopy (Qiu et al., 2006).

[0034] (4) Genome-wide association analysis was performed using TASSEL 5.0 software, combining genotypic data from the associated populations and phenotypic data of glucosinolates. By integrating significant association SNP markers detected in different environments and models, the locus qSGC.A2-1, which is significantly associated with glucosinolates and has good reproducibility, was obtained on chromosome A02. It can be repeatedly detected in three environments. Its peak SNP marker Bn-A02-p26214379 is located at bases 23,890,732 (A or C) of the Darmor V4.1 reference genome, with an average additive effect of -23.9 μmol / g and an average contribution rate of 8.5%.

[0035] Table 1. Information on the qSGC.A2-1 site associated with glucosinolate content in rapeseed seeds.

[0036] Example 2:

[0037] A method for developing and using PARMS markers that are significantly correlated with rapeseed glucosinolate content:

[0038] The association markers obtained in Example 1 were derived from SNP chips and only contained probe sequence information for molecular hybridization. While rapeseed SNP chips can detect tens of thousands of sites at a time, their operation is cumbersome and requires specialized equipment. Furthermore, using rapeseed SNP chips to detect large quantities of intermediate breeding materials is expensive. Therefore, it is necessary to convert them into a simpler and cheaper PCR amplification-based detection method, such as PARMS (Penta-primer Amplification Refractory Mutation System). This marker system includes a pair of universal fluorescent primers (FAM and HEX as reporter fluorescence), a pair of SNP allele-specific primers, and a reverse common primer, enabling rapid and simple SNP allele detection.

[0039] (1) For the peak SNP marker Bn-A02-p26214379 associated with qSGC.A2-1, 100 bp sequences were extracted upstream and downstream of chromosomes A02 of the rapeseed DarmorV4.1 reference genome at positions 23,890, and 732. The PARMS marker detection primer sequences obtained according to the primer design principles are as follows: qSGC.A2-1Fa: gaaggtgaccaagttcatgctGGCTGTGCTAAT CGCTGCA; qSGC.A2-1Fc: gaaggtcggagtcaacggatt GGCTGTGCTAATCGCTGCC; qSGC.A2-1R: ACCAAAATACTCCTAGTATGTTGTATATATACG.

[0040] The lowercase letters in the primers are fluorescent linkers.

[0041] (2) Using the genomic DNA of the rapeseed-related population as a template, the above primers were used to perform real-time PCR amplification. The FAM and HEX signals were scanned using a Tecan F200 and the results were output. Finally, the results were converted into genotypes.

[0042] Using the primers described above, the sequence amplified in the rapeseed variety Shuang 11 is as follows: GGCTGTGCTAATCGCTGC A CTTGGGTCTTAGGAGATGGCATGGTGTGTTCCACTAGTATTTAAGTAAA CGTATATATA CAACATACTAGGAGTATTTTGGT

[0043] Using the primers described above, the sequence amplified in the rapeseed variety Darmor is as follows: GGCTGTGCTAATCGCTGCC CTTGGCTCTTAGGAGATGGCATGGTGTGTTCCACTAGTATTTAAGTAAA CGTATATATAC AACATACTAGGAGTATTTTGGT .

[0044] The determination method is:

[0045] If the AA genotype is detected, it indicates that the glucosinolate content in the seeds of this variety is low; if the CC genotype is detected, it indicates that the glucosinolate content in the seeds of this variety is high.

[0046] Example 3: Application of PARMS labeling in the selection of rapeseed glucosinolates

[0047] From 732 materials in non-core related populations (i.e., 1063 rapeseed inbred lines in Example 1 excluding 331 core related populations), 96 materials were randomly selected (for convenient PCR amplification). Using the PARMS marker qSG C.A2-1 provided in Example 2, 91 materials were identified as having the genotype AA, and 5 materials were identified as having the genotype CC. The glucosinolate content in the seeds of the two genotypes showed significant differences in all seven environments, with an average difference of -71.7 μmol / g.

[0048] The following glucosinolates were detected by near-infrared spectroscopy, and the content unit is μmol / g (Qiu et al., 2006).

[0049] Table 2. Comparison of glucosinolate content in seeds of Brassica napus by two PARMS marker qSGC.A2-1 genotypes.

[0050]

[0051]

[0052] The above results are sufficient to demonstrate that the PARMS molecular marker qSGC.A2-1 we prepared is highly correlated with the glucosinolate content of rapeseed seeds and has a good selection effect.

Claims

1. The application of reagents for detecting bases at positions 23,890,732 on chromosome A02 of Brassica napus in screening breeding for glucosinolate content in Brassica napus seeds. The determination method in the application process is as follows: if the genotype of base 23,890,732 on chromosome A02 of Brassica napus is detected as CC, it indicates that the glucosinolate content of the Brassica napus seed is high; if the genotype of base 23,890,732 on chromosome A02 of Brassica napus is detected as AA, it indicates that the glucosinolate content of the Brassica napus seed is low. The version number of the Brassica napus genome used is B. napus Darmor-bzh reference genome sequenceassembly version 4.

1.

2. The application of reagents for detecting bases at positions 23,890,732 on chromosome A02 of *Brassica napus* in the preparation of a screening kit for glucosinolate content in *Brassica napus* seeds. The determination method in the application process is as follows: if the genotype of base 23,890,732 on chromosome A02 of *Brassica napus* is detected as CC, it indicates that the glucosinolate content in the *Brassica napus* seeds is high; if the genotype of base 23,890,732 on chromosome A02 of *Brassica napus* is detected as AA, it indicates that the glucosinolate content in the *Brassica napus* seeds is low. The version number of the *Brassica napus* genome used is *B. napus Darmor-bzh reference genomesequence assembly version 4.1*.

3. The application according to claim 1 or 2, wherein the reagent is a primer.

4. The application according to claim 3, wherein the primer is a PARMS detection primer.

5. According to claim 4, the pair of SNP allele-specific primers and one reverse common primer in the PARMS detection primers are: qSGC.A2-1Fa: gaaggtgaccaagttcatgct GGCTGTGCTAATCGCTGCA, qSGC.A2-1Fc: gaaggtcggagtcaacggatt GGCTGTGCTAATCGCTGCC, and qSGC.A2-1R: ACCAAAATACTCCTAGTATGTTGTATATATACG.

6. A method for screening and breeding rapeseed seeds for glucosinolate content, comprising detecting bases at positions 23,890,732 on chromosome A02 of rapeseed. The detection method includes sequencing, TaqMan probe assay, AS-PCR, molecular beacon assay, high-resolution melting curve assay, CAPS assay, SNaPshot assay, KASP assay, PARMS assay, gene chip assay, or mass spectrometry. The determination method is as follows: if base 23,890,732 on chromosome A02 of rapeseed is of the CC genotype, it indicates that the rapeseed seed has a high glucosinolate content; if base 23,890,732 on chromosome A02 of rapeseed is of the AA genotype, it indicates that the rapeseed seed has a low glucosinolate content. The rapeseed genome version used is B. napus Darmor-bzh reference genome sequence assembly version 4.

1.

7. The method according to claim 6, wherein the detection method is the PARMS method, and the pair of SNP allele-specific primers and one reverse common primer used are: qSGC.A2-1Fa: gaaggtgaccaagttcatgctGGCTGTGCTAATCGCTGCA; qSGC.A2-1Fc: gaaggtcggagtcaacggatt GGCTGTGCTAATCGCTGCC; qSGC.A2-1R: ACCAAAATACTCCTAGTATGTTGTATATATACG.

Images