Primer pair for detecting large t gene of avian polyomavirus and application thereof
By designing primer pairs for the large T gene of avian polyomavirus and using real-time fluorescence RPA technology, the problems of expensive equipment and long detection time in existing detection methods have been solved, achieving rapid and accurate detection of avian polyomavirus, which is suitable for field applications.
Patent Information
- Application Number
- CN202511536320.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-27
- Publication Date
- 2026-02-17
- Estimated Expiration
- 2045-10-27
AI Technical Summary
Existing methods for detecting avian polyomavirus require bulky or expensive instruments and equipment, have long testing times, demand high skill levels from testing personnel, and are only suitable for laboratory use, making them unsuitable for widespread application.
A primer pair for detecting the large T gene of avian polyomavirus was designed and its application was explored. Combined with real-time fluorescence RPA technology, a simple kit was used for rapid detection, including specific primer pairs and modified probes, to achieve rapid and accurate virus detection.
It enables the detection of avian polyomavirus within 30 minutes, with high sensitivity, low cost and low false positive rate. It is suitable for on-site detection, has high specificity and is not affected by other viral nucleic acids.
Smart Images

Figure CN121006422B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of biological detection, and particularly relates to a primer pair for detecting large T gene of avian polyomavirus and application thereof. BACKGROUND
[0002] Budgerigar fledgling disease (BFD) is caused by budgerigar fledgling disease virus (BFDV), which is one of the most serious infectious diseases affecting parrots, also known as avian polyomavirus (APV), because APV can infect a variety of avian hosts, and it is considered to be a non-mammalian polyomavirus, which is classified as a unique avian polyomavirus subgenus under the polyomavirus genus. APV is a non-enveloped icosahedral DNA virus. The genome consists of double-stranded circular DNA, about 5000 nucleotides in size, which can be divided into early and late regions. Parrot birds of all age groups should be considered susceptible birds. The disease is an important immunosuppressive disease in parrot birds. Infected fledglings will have severe clinical symptoms, including abdominal swelling, slow feather growth, crop congestion, severe hepatitis, pericardial effusion, ascites and sudden death, with a mortality rate of up to 100%.
[0003] In recent years, there have been cases of parrot infection with APV in China, resulting in death, but there are very few relevant research reports in China, and it is urgent to establish a detection method for rapid diagnosis of APV. At present, the detection methods for avian polyomavirus include conventional PCR, real-time fluorescent quantitative PCR and ELISA, but the above three detection methods all need cumbersome or expensive instruments and equipment, the detection time is long, the requirements for the detection personnel are high, professional training is needed, and in fact, only laboratory auxiliary diagnosis can be used, and it cannot be popularized and applied. SUMMARY
[0004] In order to solve the above technical problems, the purpose of the present application is to provide a primer pair for detecting large T gene of avian polyomavirus and application thereof, so as to solve the problems that the existing detection methods for avian polyomavirus all need cumbersome or expensive instruments and equipment, the detection time is long, the requirements for the detection personnel are high, professional training is needed, only laboratory auxiliary diagnosis can be used, and it cannot be popularized and applied.
[0005] The technical scheme for solving the above technical problems of the present application is as follows:
[0006] In a first aspect of the present application, a primer pair for detecting large T gene of avian polyomavirus is provided, and the nucleotide sequences of the forward primer and the reverse primer of the primer pair are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.
[0007] SEQ ID NO. 1: ACTGGACCTTTAAATATATAGTATCGCCG;
[0008] SEQ ID NO. 2: TGAGGCAATTGATGATTTTGTAACAGCTATA.
[0009] The application has the beneficial effects that the application provides a primer pair for detecting avian polyomavirus large T gene, the primer pair can specifically amplify avian polyomavirus, and has no cross reaction with nucleic acids of H9N2 avian influenza virus, Newcastle disease virus, psittacine beak and feather disease virus and chicken infectious bronchitis virus, has strong specificity, and can realize rapid and accurate detection of avian polyomavirus.
[0010] In a second aspect, the application provides application of the primer pair for detecting avian polyomavirus large T gene in preparation of a reagent or kit for detecting avian polyomavirus.
[0011] In a third aspect, the application provides a kit for detecting avian polyomavirus, comprising the primer pair for detecting avian polyomavirus large T gene.
[0012] Further, the kit further comprises a probe, real-time fluorescent RPA reaction dry powder, rehydration buffer, magnesium acetate, positive control and negative control.
[0013] Further, the nucleotide sequence of the probe is shown in SEQ ID NO. 3.
[0014] SEQ ID NO. 3: 5'-TGTCTGCAATATATCAACAATCACATCAACATCTGGAAATAACATATTG-3'.
[0015] Further, the probe is modified as follows: the 32nd base at the 5' end is labeled with a FAM fluorescent group, the 33rd base is connected with a dealkylation site tetrahydrofuran (THF), the 34th T base is labeled with a BHQ1 quenching group, and the 3' end is blocked and modified with a C3-spacer.
[0016] The modified probe is shown as follows: SEQ ID NO. 3: 5'-TGTCTGCAATATATCAACAATCACATCAACA[FAM-dT][THF][BHQ-dT]GGAAATAACATATTG-[C3Spacer]-3', wherein [FAM-dT] is a T base labeled with a FAM fluorescent group, [THF] is a recognition site tetrahydrofuran of a recombinase, [BHQ-dT] is a T base labeled with a BHQ1 quenching group, and [C3-spacer] is a biological blocker.
[0017] Further, the positive control nucleic acid sequence is shown in SEQ ID NO. 4.
[0018] SEQ ID NO. 4: CGAACAGAACCATGAACTGATCGATAGCGCATCCTAGTTCGAATTGCAGTCGATCAGGGGTGCCATTTACATTCAGGGATGCCCCTGTACACAGTGCCAGTATGGCAGCAGCCACGGTGGTCTTACCCGTATTCACTGGACCTTTAAATATATAGTATCGCCGCTTCGGTGGGTTTTTCACCATTGTCTGCAATATATCAACAATCACATCAACATCTGGAAATAACATATTGAACAACAGTATAGCTGTTACAAAATCATCAATTGCCTCAGTTTCACCATCTAAGAGTTCCTGAATGTTACGTAGCACAGTCCGGAAGCGTTCTTTGAGACGCTCATCCCTTGTCATGGTCGCTGACCGGAAACGTTTTTCTGCAAGCACAGCATCCACAGCACATTGGCATAGGCGTTTTTGATCCTTGATGTGCAGAAATAGTGAGGCGTTGTG.
[0019] The beneficial effects of the further technical solutions are that the modified probe is not recognized by exonuclease in a free state, and when the probe and the target gene are recognized and begin to combine, the exonuclease removes the THF and releases the C3-spacer biological blocking agent, so that the FAM group and the BHQ1 group are separated to emit fluorescence which is detected by the instrument, and then the amplification product is detected.
[0020] Further, the positive control includes an avian polyomavirus large T gene, and the nucleotide sequence is shown as SEQ ID NO. 4.
[0021] The real-time fluorescent RPA reaction dry powder includes a recombinant enzyme, a single-strand binding protein, a polymerase, ATP and dNTP Mix.
[0022] The negative control includes ddH2O.
[0023] The beneficial effects of the further technical solutions are that the present application does not have special requirements for the source of the real-time fluorescent RPA universal reagent, and commercially available goods familiar to those skilled in the art can be used, the reagent requirement is low, and the source is extensive.
[0024] In a fourth aspect, the application provides application of the primer pair for detecting the avian polyomavirus large T gene or the kit for detecting the avian polyomavirus in detection of the avian polyomavirus.
[0025] In a fifth aspect, the present application provides a method for detecting avian polyomavirus for non-diagnostic purposes, using the above-mentioned kit for detecting avian polyomavirus, specifically comprising the following steps:
[0026] S1: extracting DNA from the sample to be tested;
[0027] S2: using the DNA obtained in S1 as a template, performing real-time fluorescent RPA reaction using the reagents in the kit, and collecting the fluorescence signal;
[0028] S3: if the peak time is ≤20 min or the Ct value is ≤38, the sample to be tested is positive for avian polyomavirus; if the peak time is >20 min or the Ct value is >38, the sample to be tested is negative for avian polyomavirus.
[0029] Further, in the reaction system of the real-time fluorescent RPA reaction: the mass / volume ratio of the real-time fluorescent RPA reaction dry powder, the rehydration buffer, the magnesium acetate, the forward primer, the reverse primer, the probe, the DNA template and the ddH2O is 15 mg:29.5 μL:2.5 μL:1.2 μL:1.2 μL:0.6 μL:2 μL:13 μL.
[0030] Further, the concentration of the forward primer and the reverse primer is 5-20 μmol / L; and the concentration of the probe is 5-20 μmol / L.
[0031] Further, the reaction procedure of the real-time fluorescent RPA reaction is: 41℃ for 60 s; 41℃ for 30 s, 40 cycles.
[0032] The present application has the following advantages:
[0033] (1) The present application provides a primer pair capable of specifically amplifying the large T gene of avian polyomavirus, which has no cross reaction with the nucleic acids of H9N2 avian influenza virus, Newcastle disease virus, psittacine beak and feather disease virus and chicken infectious bronchitis virus, and has strong specificity.
[0034] (2) The present application provides a method for detecting avian polyomavirus based on the primer pair, which can complete the detection within 30 min, can detect low copy number of avian polyomavirus nucleic acid, and has the advantages of simple operation, low cost, high sensitivity and low false positive rate. BRIEF DESCRIPTION OF DRAWINGS
[0035] Figure 1 Figure for the results of real-time fluorescent RPA detection of 16 groups of primer pairs and probes in Example 1;
[0036] Figure 2Figure showing the results of agarose electrophoresis of the PCR amplification product for the detection of the large T gene of avian polyomavirus in Example 2;
[0037] Figure 3 Figure showing the results of amplification for the positive control and the negative control in Example 3;
[0038] Figure 4 Figure showing the results of the sensitivity test for the method for detecting avian polyomavirus in Test Example 2;
[0039] Figure 5 Figure showing the results of the specificity test for the method for detecting avian polyomavirus in Test Example 3. DETAILED DESCRIPTION
[0040] The principles and features of the present application are described below in conjunction with the accompanying drawings, in which the examples are used to explain the present application and are not intended to limit the scope of the present application. Unless otherwise specified, the specific conditions in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, the reagents or instruments used are conventional products that can be obtained by commercial purchase.
[0041] Example 1: Design and screening of primers
[0042] I. Design of primers and probes
[0043] Based on the APV-large T gene sequences in the NCBI database (GenBank Accession Nos. AF241168.1, MG148345.1, NC004764.2, MH643735.1, KT203769.1, KT203768.1, KT203767.1, KT203766.1, KT203765.1, KT203764.1, KT203763.1, KT203762.1, GU452537.1, AF118150.1, AF241170.1, AF241169.1, AY672646.1, M20775.1, AB477106.1, AB453166.1, AB453165.1, AB453164.1, AB453163.1, AB453162.1, and AB453161.1), the conserved regions were analyzed according to the gene alignment, and the primer and probe (P) sequences were designed after homology analysis as follows:
[0044] Primer sequence:
[0045] F1: ACTGGACCTTTAAATATATAGTATCGCCG (SEQ ID NO. 1);
[0046] F2: TCTTACCCGTATTCACTGGACCTTTAAATA (SEQ ID NO.5);
[0047] F3: CAGCAGCCACGGTGGTCTTACCCGTATTCA (SEQ ID NO.6);
[0048] F4: ATGCCCCTGTACACAGTGCCAGTATGG (SEQ ID NO.7);
[0049] R1: TGAGGCAATTGATGATTTTGTAACAGCTATA (SEQ ID NO.2);
[0050] R2: CTTAGATGGTGAAACTGAGGCAATTGATGA (SEQ ID NO.8);
[0051] R3: AACATTCAGGAACTCTTAGATGGTGAAACT (SEQ ID NO.9);
[0052] R4: CGTCTCAAAGAACGCTTCCGGACTGTGCTAC (SEQ ID NO.10).
[0053] Probe sequence:
[0054] P: TGTCTGCAATATATCAACAATCACATCAACATCTGGAAATAACATATTG (SEQ ID NO.3), and P is modified, specifically including: the 32nd base at the 5' end is labeled with a FAM fluorescent group, a tetrahydrofuran (THF) is connected after the 33rd base, the 34th T base is labeled with a BHQ1 quenching group, and the 3' end is blocked with a C3-spacer modification.
[0055] The sequence of the modified probe is: TGTCTGCAATATATCAACAATCACATCAACA[FAM-dT][THF][BHQ-dT]GGAAATAACATATTG-[C3Spacer].
[0056] II. Primer screening
[0057] First, divide primers F1-F4 and R1-R4 into 16 groups, namely: F1R1, F1R2, F1R3, F1R4, F2R1, F2R2, F2R3, F2R4, F3R1, F3R2, F3R3, F3R4, F4R1, F4R2, F4R3 and F4R4.
[0058] Then, using avian polyomavirus nucleic acid (SEQ ID NO.4) as a template and ddH2O as a negative control, real-time fluorescent RPA reactions were performed using the above 16 primer pairs. The real-time fluorescent RPA reaction program was: 41℃ for 60 s; 41℃ for 30 s, for 40 cycles. The results are as follows: Figure 1 As shown.
[0059] Depend on Figure 1 It can be seen that, under the same primer and probe concentration, the primer pair with a smaller Ct value and a larger amplification product is F1R1, which is the primer pair for detecting the large T gene of avian polyomavirus in this invention.
[0060] Example 2: Validation of primer pairs for real-time fluorescent RPA detection of avian polyomavirus large T gene
[0061] PCR was performed using the APV-large T gene positive standard plasmid (GenBank accession number AF241168) as a template.
[0062] The reaction system consisted of 1.0 μL each of forward primer F1 (10 μmol / L) and reverse primer R1 (10 μmol / L), 6.0 μL of ddH2O, 10.0 μL of 2× Es Taq MasterMix, and 2 μL of template.
[0063] The reaction program was as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 15 s, for 35 cycles; extension at 72℃ for 2 min.
[0064] Finally, the PCR products were analyzed by 1% agarose gel electrophoresis. The experimental results are as follows: Figure 2 As shown, lanes M, P, and N, from left to right, represent the marker, the APV-large T gene plasmid, and the ddH2O negative control, respectively.
[0065] Depend on Figure 2 It can be seen that the PCR amplification fragment of primer pair F1R1 obtained by the present invention is consistent with the expected result, with a size of 138 bp, indicating that primer pair F1R1 can accurately amplify the large T gene of avian polyomavirus.
[0066] Example 3:
[0067] A kit for detecting avian polyomavirus, comprising a forward primer and a reverse primer as shown in SEQ ID NO. 1 and SEQ ID NO. 2, and further comprising a probe, a real-time fluorescent RPA reaction dry powder, a rehydration buffer, magnesium acetate, a positive control and a negative control.
[0068] In the kit, the nucleotide sequence of the probe is as follows:
[0069] 5'-TGTCTGCAATATATCAACAATCACATCAACA[FAM-dT][THF][BHQ-dT]GGAAATAACATATTG-[C3Spacer]-3';
[0070] Wherein, [FAM-dT] is a T base labeled with FAM fluorescent group, [THF] is a recognition site tetrahydrofuran of recombinase, [BHQ-dT] is a T base labeled with BHQ1 quenching group, and [C3-spacer] is a biological blocker.
[0071] In the kit, the real-time fluorescent RPA reaction dry powder comprises a recombinase, a single-stranded binding protein, a polymerase, ATP and dNTP Mix.
[0072] In the kit, the real-time fluorescent RPA reaction dry powder, the rehydration buffer and the magnesium acetate are all components of the real-time fluorescent RPA nucleic acid amplification reagent purchased from Hangzhou Zhongce Biological Technology Co., Ltd.
[0073] In the kit, the positive control comprises avian polyomavirus nucleic acid, and the nucleotide sequence thereof is shown in SEQ ID NO. 4; and the negative control is ddH2O.
[0074] In the kit, the molar ratio of the forward primer, the reverse primer and the probe is 1:1:1.
[0075] Example 4: Method for detecting avian polyomavirus
[0076] A method for detecting avian polyomavirus for non-diagnostic purposes, the method of the embodiment is carried out using the kit in Example 3, and specifically comprising the following steps:
[0077] (1) According to the instruction manual of AxyPrep body fluid virus DNA / RNA small amount extraction kit (purchased from Guangzhou Suyan Biological Technology Co., Ltd.), extract the genomic DNA of the sample to be tested as a DNA template.
[0078] (2) Prepare the reaction system. Each sample to be tested corresponds to one real-time fluorescent RPA reaction powder tube. The reaction system in each real-time fluorescent RPA reaction tube is 50 μL, including 15 mg of real-time fluorescent RPA reaction powder, 29.5 μL of rehydration buffer, 2.5 μL of magnesium acetate, 1.2 μL each of forward and reverse primers (concentration of 10 μmol / L), 0.6 μL of probe (concentration of 10 μmol / L), 13 μL of ddH2O and 2 μL of DNA template.
[0079] The avian polyomavirus nucleic acid shown in SEQ ID NO.4 was used as a positive control, and ddH2O was used as a negative control. The reaction tube of the prepared real-time fluorescent RPA reaction system was inverted several times to mix thoroughly, and centrifuged at 800 rpm for 10 s to ensure that all the reaction solution was collected at the bottom of the tube.
[0080] (3) Place the reaction tube in the fluorescence quantitative instrument, 41℃ for 60 s; 41℃ for 30 s, for 40 cycles, and collect the fluorescence signal.
[0081] (4) After amplification, the results of the test sample are determined based on the peak time or Ct value. The judgment criteria are as follows:
[0082] Positive control: The appearance of an amplification curve, or the peak time ≤20 min or the Ct value ≤38, indicates a valid result;
[0083] Negative control: No amplification curve appears, or the peak time is >20 min or the Ct value is >38, which is a valid result;
[0084] For the sample to be tested: if the elution time is ≤20 min or the Ct value is ≤38, the sample can be judged to be positive for avian polyomavirus; if the elution time is >20 min or the Ct value is >38, the sample can be judged to be negative for avian polyomavirus.
[0085] The total experimental time was 21 min. When the peak appeared within 20 min, the Ct value was ≤38. When the peak appeared after 20 min, the Ct value was >38. The specific judgment index was determined based on the horizontal axis of the fluorescence spectrum of the real-time fluorescence RPA.
[0086] The amplification results of the positive and negative controls of this invention are as follows: Figure 3 As shown, from top to bottom are the positive control, baseline, and negative control.
[0087] Depend on Figure 3 It is evident that both the positive and negative controls of this invention yield valid results. The negative control design effectively verifies whether the reagents used are contaminated, avoiding false positives, while the positive control design effectively verifies the effectiveness of the reagents used, avoiding false negatives.
[0088] Test Example 1: detection accuracy verification
[0089] 26 tissue samples suspected to be infected with avian polyoma virus provided by a parrot farm were used as test samples, and the samples were detected by qPCR using the public primers APV-F / R (SEQ ID NO. 11 and SEQ ID NO. 12) and the real-time fluorescent RPA method of Example 4 of the present application, respectively, and the results were compared.
[0090] SEQ ID NO. 11: 5'-CTACAAGGCCCGACTAGATAAG-3';
[0091] SEQ ID NO. 12: 5'-ACCTGTGAGGTTGCCATAATA-3'.
[0092] The qPCR detection method specifically includes the following steps:
[0093] The genomic DNA of the test sample was extracted according to the instructions of the animal tissue total DNA / RNA extraction kit (DP431) (Guangzhou Sijia Biological Technology Co., Ltd.), and then qPCR detection was performed.
[0094] The reaction program of qPCR is: 95℃ for 30 s; 95℃ denaturation for 5 s, 55℃ annealing for 30 s, 60℃ extension for 34 s, 40 cycles.
[0095] The reaction system of qPCR is: APV-F (10 µmol / L) 1 µL, APV-R (10 µmol / L) 1 µL, ddH2O 10.5 µL, Premix Ex Taq 10 µL, BFDV-MGB probe 0.5 µL, template 2 μL.
[0096] The qPCR and real-time fluorescent RPA detection results are shown in Table 1.
[0097] Table 1: sample detection results
[0098]
[0099] As shown in Table 1, the real-time fluorescent RPA detection results and the qPCR detection results are highly consistent, indicating that the method of the present application has good specificity and stability, and the method of the present application can complete the detection within 30 min, has the characteristics of simple operation and low cost, is more suitable for on-site mobile detection, and has the advantages that the qPCR detection method does not have.
[0100] Test Example 2: detection sensitivity verification
[0101] The positive standard plasmid of avian polyomavirus large T gene was constructed by Shengong, and the positive standard plasmid was diluted by 10 times, and the positive standard plasmid with 5 concentrations of 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 copies / μL was used as a template, and ddH2O was used as a negative control, 2 μL was taken as a reaction template, and the nucleic acid amplification was carried out according to the steps described in Example 4, and the sensitivity of the method for detecting avian polyomavirus was detected, and the detection results are shown in Figure 4
[0102] As can be seen from Figure 4 , the detection results of the positive standard plasmid with 5 concentration gradients are Ct≤38, which can be judged as positive for avian polyomavirus, and the results show that the primer pair and the probe of the application can detect the lowest concentration of 10 copies / μL of the template, and the detection sensitivity is high.
[0103] Test Example 3: Detection of specificity verification
[0104] The nucleic acid of H9N2 avian influenza virus, Newcastle disease virus, psittacine beak feather disease virus and chicken infectious bronchitis virus was detected with avian polyomavirus nucleic acid (SEQ ID NO. 4) as a positive control and ddH2O as a negative control, and the nucleic acid amplification was carried out according to the steps described in Example 4, and the specificity of the method for detecting avian polyomavirus was detected, and the detection results are shown in Figure 5
[0105] As can be seen from Figure 5 , only the test group corresponding to the positive control template of avian polyomavirus appeared a normal fluorescence detection curve, and the amplification curve appeared in the test groups of other viruses and the negative control group. The results show that the primer pair and the probe of the application can realize the specific detection of avian polyomavirus, and there is no cross reaction with the nucleic acid of H9N2 avian influenza virus, Newcastle disease virus, psittacine beak feather disease virus and chicken infectious bronchitis virus.
[0106] In summary, the primer pair and the kit provided by the application can realize the rapid, convenient, efficient and specific detection of avian polyomavirus in the sample, and can assist in diagnosing whether it is infected with avian polyomavirus, and is suitable for differential detection, animal disease detection and purification in clinic.
[0107] The above merely describes the preferred embodiments of the present application, and is not used to limit the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A RPA primer pair and a probe for detecting a large T gene of avian polyomavirus, characterized by, The nucleotide sequences of the primer pair forward primer and reverse primer are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively, and the nucleotide sequence of the probe is shown in SEQ ID NO.
3.
2. Use of the RPA primer pair and probe for detecting the large T gene of avian polyomavirus in the preparation of a reagent or kit for detecting avian polyomavirus according to claim 1.
3. A kit for detecting avian polyomavirus, characterized by, The RPA primer pair and probe for detecting the large T gene of avian polyomavirus according to claim 1.
4. The kit for detecting avian polyomavirus according to claim 3, characterized by, It also includes real-time fluorescent RPA reaction dry powder, rehydration buffer, magnesium acetate, positive control and negative control.
5. The kit for detecting avian polyomavirus according to claim 4, wherein the positive control comprises the large T gene of avian polyomavirus, and the nucleotide sequence is shown in SEQ ID NO. 4; the real-time fluorescent RPA reaction dry powder comprises recombinase, single-strand binding protein, polymerase, ATP and dNTP Mix; and the negative control comprises ddH2O.
5. The kit for detecting avian polyomavirus according to claim 4, wherein the positive control comprises the large T gene of avian polyomavirus, and the nucleotide sequence is shown in SEQ ID NO. 4; the real-time fluorescent RPA reaction dry powder comprises recombinase, single-strand binding protein, polymerase, ATP and dNTP Mix; and the negative control comprises ddH2O. The kit for detecting avian polyomavirus according to any one of claims 3-5 comprises the following steps: S1: extracting DNA from the sample to be tested; 6. A method for detecting avian polyomavirus for non-diagnostic purposes, characterized in that S2: using the reagents in the kit to perform real-time fluorescent RPA reaction with the DNA obtained in S1 as the template, and collecting the fluorescent signal; S3: if the peak time is ≤20 min or the Ct value is ≤38, the sample to be tested is positive for avian polyomavirus; if the peak time is >20 min or the Ct value is >38, the sample to be tested is negative for avian polyomavirus. In the reaction system of the real-time fluorescent RPA reaction, the mass / volume ratio of the real-time fluorescent RPA reaction dry powder, rehydration buffer, magnesium acetate, forward primer, reverse primer, probe, DNA template and ddH2O is 15 mg:29.5 μL:2.5 μL:1.2 μL:1.2 μL:0.6 μL:2 μL:13 μL. The concentration of the forward primer and the reverse primer is 5-20 μmol / L, and the concentration of the probe is 5-20 μmol / L.
7. A method of detecting avian polyomavirus for non-diagnostic purposes according to claim 6, characterised in that, The reaction procedure of the real-time fluorescent RPA reaction is: 41℃ for 60 s; 41℃ for 30 s, 40 cycles.
8. The method of detecting avian polyomavirus for non-diagnostic purposes according to claim 7, characterized in that, 9. The method of detecting avian polyomavirus for non-diagnostic purposes according to claim 6, characterized in that,
Citation Information
Patent Citations
Primer pair for detecting type 4 parrot Borna virus N gene and application of primer pair
CN118028544A