A method for constructing a stem high-cadmium grain low-cadmium rice

Abstract

The application provides a method for constructing stem high-cadmium grain low-cadmium rice, and belongs to the technical field of genetic engineering. The method is that a DNA structure for driving expression of an OsHMA3 gene by a green tissue-specific promoter is introduced into a rice material in which an endogenous OsHMA3 gene is inactivated, so that a stem high-cadmium grain low-cadmium rice material is obtained. The rice material constructed by the method can be used for producing safe rice and repairing cadmium contaminated soil, and has the advantages of both the existing cadmium hyperaccumulating rice with high cadmium in the whole plant and the cadmium low-accumulating rice with low cadmium in the whole plant, and has more utilization value than the two kinds of rice.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a method for constructing rice with high cadmium stalks and low cadmium grains. Background Technology

[0002] The primary cause of excessive cadmium levels in rice is cadmium pollution in the soil. Current remediation strategies mainly fall into two categories: safe utilization and soil remediation. At present, safe utilization strategies are primarily employed, such as flood irrigation, application of cadmium conditioners, and planting low-accumulation rice varieties. However, these methods only reduce cadmium content in crops and cannot effectively remove cadmium from the soil, thus the pollution problem persists. Traditional soil remediation methods, such as soil replacement and physicochemical remediation, while capable of completely removing pollutants, are too costly for large-scale implementation. Phytoremediation technology, particularly phytoextraction remediation, offers a potential solution. This method involves planting hyperaccumulating or medium-accumulation high-biomass plants to absorb and transport cadmium from the soil to the aboveground parts, followed by harmless treatment of the aboveground parts, thereby achieving permanent remediation. However, most hyperaccumulating plants currently used for phytoremediation have small biomass and are mostly wild species, facing challenges in cultivation and management techniques when applied on a large scale. Furthermore, these plants typically have low economic value, resulting in a lack of income for farmers during the remediation process. Therefore, there is an urgent need to explore a new type of plant that can achieve low-cost remediation.

[0003] Rice is a plant that is relatively easy to accumulate cadmium. In the rice germplasm resource bank, there are also cadmium hyperaccumulating rice varieties with a cadmium accumulation capacity that is 5 to 10 times higher than that of ordinary varieties, such as Jarjan, Anjana Dhan, Cho-ko-koku [Uraguchi S, Mori S, Kuramata M, et al. J Exp Bot, 2009, 60(9): 2677-2688] and BG367 [Sui F, Zhao D, Zhu H, et al. J Exp Bot, 2019, 70(10): 2857-2871]. These cadmium hyperaccumulating rice varieties have been proven to have excellent cadmium-contaminated soil remediation capabilities. For example, Murakami et al. found that after planting Cho-ko-koku for only two years, the cadmium content in the soil decreased from 1.63 mg / kg to 1.01 mg / kg, a reduction of 38% [Murakami M, Nakagawa F, Ae N, et al. Environ Sci Technol, 2009, 43(15): 5878-5883]; Ibaraki et al. also verified the cadmium soil remediation capacity of Cho-ko-koku [Ibaraki T, Fujitomi Si, Ishitsuka A, et al. Soil Science and Plant Nutrition, 2014, 60(2):266-275], planting Cho-ko-koku for two years reduced soil cadmium content by 32% (from 1.01 mg / kg to 0.68 mg / kg); Wang Peng et al. reported that the cadmium hyperaccumulating rice variety BG367-4 had a stable extraction rate of 10-15% of soil cadmium per season (patent CN202310161701.2). Japanese researchers have also used these cadmium hyperaccumulating germplasm resources to cultivate new varieties with better agronomic traits [Takahashi R, Ito M, Kawamoto T. Plants (Basel, Switzerland), 2021, 10:1926]. Compared with other cadmium hyperaccumulating plants, cadmium hyperaccumulating rice not only has the advantages of fast growth and large biomass, but also has an existing planting and harvesting technology system, thus it has good application prospects in soil remediation. However, because cadmium hyperaccumulating rice also accumulates cadmium in its grains, it suffers from the same problem as other soil remediation plants—a lack of economic benefits—making its widespread adoption difficult. If a rice variety (especially a high-biomass variety) could be developed that maintains cadmium hyperaccumulation in its straw while keeping the cadmium content in its grains or polished rice within acceptable limits when grown in cadmium-contaminated soil, then planting such rice could achieve both food safety and soil remediation. In other words, using such rice for low-cost remediation of cadmium-contaminated soil would become feasible.However, to date, no reports have been found of the successful development of this type of rice material with practical application value.

[0004] Studies have shown that all rice varieties currently identified as having cadmium hyperaccumulation are caused by inactivation or weakening mutations in the OsHMA3 (Os07g0232900) gene [Yan J, Wang P, Wang P, et al. Plant Cell Environ, 2016, 39(9): 1941-1954; Zhao J, Yang W, Zhang S, et al. Rice (NY), 2018, 11(1): 61; Ueno D, Yamaji N, Kono I, et al. Proc Natl Acad Sci USA, 2010, 107(38): 16500-16505; Miyadate H, Adachi S, Hiraizumi A, et al. New Phytol, 2011, 189(1): 190-199]. OsHMA3 encodes a heavy metal ion transporter located on the vacuolar membrane and is mainly expressed in the roots. In normal varieties, the OsHMA3 protein is responsible for retaining cadmium ions in the root vacuoles, thereby preventing the toxic cadmium ions from being transported to the aboveground parts and causing harm, and playing a detoxification role. In cadmium hyperaccumulation varieties, the OsHMA3 protein loses its function or its function is weakened, and cadmium ions cannot be effectively retained in the vacuoles of root cells, thus being transported to the aboveground parts in large quantities, resulting in cadmium hyperaccumulation [Ueno D, Yamaji N, Kono I, et al. Proc Natl Acad Sci USA, 2010, 107(38): 16500-16505]. In common varieties, constitutive overexpression of OsHMA3 can significantly reduce the cadmium content in the aboveground parts, including the grains [Shao JF, Xia J, Yamaji N, et al. J Exp Bot, 2018, 69(10): 2743-2752; Sasaki A, Yamaji N, Ma J F. J Exp Bot, 2014, 65(20): 6013-6021]. This is also a result of OsHMA3 retaining cadmium in the roots. The elucidation of the function of the OsHMA3 gene lays the foundation for further genetic engineering to create rice with high cadmium in straw and low cadmium in grains. Summary of the Invention

[0005] The purpose of this invention is to provide a method for constructing rice with high cadmium stalks and low cadmium grains, so as to achieve both soil remediation and safe rice production.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides a method for constructing rice with high cadmium stems and low cadmium grains. The method involves introducing a DNA structure that drives the expression of the OsHMA3 gene using a green tissue-specific promoter into rice material inactivated by endogenous OsHMA3 gene, thereby obtaining rice material with high cadmium stems and low cadmium grains.

[0008] The internationally recognized gene identification symbol for the OsHMA3 gene is any one of Os07g0232900 (Rice Annotation Project database, abbreviated as RAP), LOC4342783 (NCBI-Gene database), or LOC_Os07g12900 (RiceGenome Annotation Project database, abbreviated as RGAP).

[0009] Preferably, the green tissue-specific promoter is a promoter that can drive gene expression in green tissues of rice but not expressed or expressed at low levels in non-green tissues; the green tissues include one or more of stems, leaves and leaf sheaths, and the non-green tissues include roots.

[0010] Preferably, the green tissue-specific promoter includes the promoters of the OsRbcS2, OsRbcS3, or OsD540 genes. The promoter of the OsRbcS2 gene contains the nucleotide sequence shown in SEQ ID NO.1, the promoter of the OsRbcS3 gene contains the nucleotide sequence shown in SEQ ID NO.2, and the promoter of the OsD540 gene contains the nucleotide sequence shown in SEQ ID NO.3. Each of the three sequences is a 500 bp fragment upstream of the translation start codon of its respective gene.

[0011] Preferably, the DNA structure for driving OsHMA3 gene expression by the green tissue-specific promoter includes a gene expression cassette as shown in any one of the DNA sequences SEQ ID NO.4, SEQ ID NO.5, or SEQ ID NO.6.

[0012] Preferably, the rice material with inactivated endogenous OsHMA3 gene is a rice material with inactivated endogenous OsHMA3 gene due to natural mutation existing in existing rice germplasm resources, or a rice material with inactivated endogenous OsHMA3 gene constructed de novo through artificial gene mutation.

[0013] Preferably, the rice material in the existing rice germplasm resources that has undergone natural mutation and loss of function of the endogenous OsHMA3 gene includes BG367 rice. BG367 rice is an indica red rice variety from Bangladesh, as reported in the following literature: Sui F, Zhao D, Zhu H, et al. J Exp Bot, 2019, 70(10): 2857-2871.

[0014] Preferably, the artificial gene mutation method includes any one of targeted gene knockout (CRISPR / Cas9 targeted gene knockout technology) and TILLING technology (Targeting Induced Local Mutations in Genomes).

[0015] Preferably, the OsHMA3 gene is a DNA sequence encoding a polypeptide as shown in SEQ ID NO.7 or encoding a polypeptide with a sequence similarity of more than 95% to SEQ ID NO.7.

[0016] Preferably, the OsHMA3 gene is an OsHMA3 gene cDNA sequence containing the complete gene coding region as shown in SEQ ID NO.8.

[0017] Preferably, the method for introducing the DNA structure that drives the expression of the OsHMA3 gene by a green tissue-specific promoter into rice materials inactivated by endogenous OsHMA3 gene includes the following steps:

[0018] (1) Obtain rice materials with inactivated endogenous OsHMA3 gene function;

[0019] (2) Using rice materials with inactivated endogenous OsHMA3 gene function as the genetic background for genetic engineering operations, a DNA structure that drives normal OsHMA3 expression was introduced into their genome through transgenic technology via a green tissue promoter.

[0020] (3) The cadmium accumulation capacity of the obtained transgenic plant offspring was identified, and strains with high cadmium in stems and low cadmium in grains were screened.

[0021] Preferably, step (2) includes the following steps: obtaining the designed green tissue promoter and OsHMA3 gene DNA fragments through genetic engineering methods commonly used in the art, such as PCR and gene synthesis; introducing the obtained DNA fragments into any binary Ti plasmid vector through vector construction methods commonly used in the art, so as to form a functional module for green tissue promoter to drive OsHMA3 gene expression; genetically transforming endogenous OsHMA3 gene-inactivated rice materials through Agrobacterium-mediated transformation, a method commonly used in the art, and introducing a binary Ti plasmid vector T-DNA fragment containing a functional module for green tissue promoter to drive normal OsHMA3 gene expression into the genome of the recipient variety; and identifying the obtained transgenic plants according to methods commonly used in the art to confirm successful transgenic acquisition.

[0022] Preferably, step (3) includes the following steps: identifying whether individual seeds produced from T0 generation transgenic plants or T1 generation seedlings obtained after germination contain transgenic components using methods commonly used in the art; preliminarily estimating the copy number based on the segregation ratio of transgenic and non-transgenic plants; preliminarily screening transgenic lines and individual plants; specifically, propagating transgenic positive plants in cadmium-contaminated soil with a total cadmium concentration greater than 0.5 mg / kg (the propagation environment for subsequent generations to be tested for cadmium accumulation is the same); identifying whether individual seeds harvested from T1 generation plants or T2 generation seedlings obtained from seed germination contain transgenic components using methods commonly used in the art; selecting 1-3 plants from each line whose seeds or seedlings obtained after seed germination do not contain non-transgenic individuals for cadmium content testing, and comparing them with wild-type controls planted in the same environment. The cadmium content of harvested seeds was compared. For each transgenic line, one seed from a single plant with a significantly reduced brown rice cadmium content compared to the control (approximately 0.2 mg / kg) was selected for further propagation (or, cadmium content was not measured in the T1 generation of the transgenic line; instead, one to two seeds from each line with non-segregating seed resistance were selected for further propagation, and cadmium content was measured in the seeds harvested from the T2 or higher generations). The cadmium content of stems, leaves, and brown rice of the transgenic positive plants from the further propagation was measured. Single plants with stem cadmium content similar to or higher than the control, but brown rice cadmium content lower than the national limit, were selected for further propagation. The cadmium content of stems, leaves, and brown rice of the further propagated plants was measured to assess the stability of the transgene. Lines exhibiting high cadmium stems and low cadmium grains after two or more generations were selected for further utilization.

[0023] This invention provides an application of rice materials with high cadmium stalks and low cadmium grains obtained by the method described above in the remediation of cadmium-contaminated soil and the production of safe-to-eat rice.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] This invention provides a method for constructing rice with high cadmium in stems and low cadmium in grains by genetically modifying the function of the OsHMA3 gene. The technical principle is as follows: the inactivation of the endogenous OsHMA3 gene prevents the rice roots from effectively retaining cadmium, resulting in cadmium accumulation in the aboveground parts. However, the specific expression of OsHMA3 in the green photosynthetic tissues allows cadmium to be retained in the aboveground green tissues, thereby limiting the transfer of cadmium from the stems and leaves to the grains, resulting in low cadmium accumulation in the grains, ultimately achieving high cadmium in the rice stems and low cadmium in the grains.

[0026] The rice material constructed by the method of this invention can be used to produce safe rice for consumption and to remediate cadmium-contaminated soil. It combines the advantages of existing cadmium hyperaccumulating rice with high cadmium content throughout the plant and cadmium low-accumulating rice with low cadmium content throughout the plant, and is more valuable than the aforementioned two types of rice. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0028] Figure 1 The results of cadmium content detection in different organs of transgenic plants and control plants driven by the OsRbcS2 promoter to express OsHMA3 are shown. * indicates statistically significant difference (p value < 0.05), and ** indicates extremely significant difference (p value < 0.01). The significance was detected by t test. The dashed line in the figure represents the cadmium content limit standard of brown rice (0.2 mg / kg). The legend shows the wild-type control and the number of different transgenic lines.

[0029] Figure 2 The figure shows the cadmium content detection results in different organs of transgenic plants and control plants driven by the OsRbcS3 promoter to express OsHMA3. * indicates statistically significant difference (p value < 0.05), and ** indicates extremely significant difference (p value < 0.01). The significance was detected by t test. The dashed line in the figure represents the cadmium content limit standard of brown rice (0.2 mg / kg). The legend shows the wild-type control and the number of different transgenic lines. Detailed Implementation

[0030] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0031] Example 1: Construction and identification of cadmium accumulation characteristics of transgenic plants driven by OsRbcS2 promoter to express OsHMA3.

[0032] The OsRbcS2 gene has been shown to be specifically expressed only in the green tissues of rice, and its promoter can be used as a green tissue-specific promoter in genetic engineering (Huang Haiqun, Lin Yongjun. Journal of Agricultural Biotechnology, 2007, 15(3):451-458; Morita K, Hatanaka T, Misoo S, et al. Plant Physiol, 2014, 164:69-79). Therefore, it was selected as the promoter to drive the specific expression of OsHMA3 in green tissues in this embodiment.

[0033] 1. Carrier Construction

[0034] 1.1OsRbcS2 promoter (P OsRbcS2 Cloning of fragments

[0035] Considering that target genes are generally cloned and expressed in cDNA form, and that the first intron of a gene often enhances gene expression, therefore, when designing P... OsRbcS2 The first intron of the OsRbcS2 gene was introduced into the fragment. To avoid interference from ATG in the exons with the expression of the target gene when the intron was introduced, all ATG in the exons adjacent to the intron fragment were mutated. The final fragment containing the first intron was P. OsRbcS2 The sequence is as follows (SEQ ID NO.9):

[0036]

[0037] The above sequence has HindⅢ and KpnI restriction endonuclease sites added at both ends for vector construction. The promoter contains a 5′UTR region (inferred from the full-length mRNA), introns, and a truncated segment of the coding region of the adjacent exon (containing mutant bases). The full-length sequence is 2036 bp, with lowercase underscores indicating the 5′UTR and double underscores indicating introns. The above sequence truncates the coding segment of the first exon of the gene in the original sequence and modifies the bases of the remaining sequence.

[0038] It should be noted that, when implementing this invention, the promoter design does not necessarily have to include an intron as in this embodiment. Generally, in genetic engineering, a DNA fragment at least 500 bp upstream of the translation start site is typically used as the promoter.

[0039] The above sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd., and the fragment was cloned into the EcoRV restriction site of the plasmid vector PUC57 for later use.

[0040] Cloning of the 1.2 OsHMA3 cDNA fragment

[0041] Expression was performed using the OsHMA3 cDNA fragment, and gene cloning was carried out artificially. During fragment design, some codons in the sequence were optimized to remove some unwanted restriction sites, and restriction sites were added to both ends (Kpn I upstream and Spe I downstream) to facilitate vector construction. The designed gene sequence (SEQ ID NO.10) was synthesized by Beijing Qingke Biotechnology Co., Ltd., and the fragment was cloned into the EcoRV restriction site of the plasmid vector PUC57 for later use.

[0042]

[0043] 1.3 Construction of Ti binary plasmid vector

[0044] In this embodiment, the Agrobacterium-mediated transformation Ti binary plasmid vector backbone was pCAMBIA1390. During construction, the binary vector pCUbi1390 [constructed by adding the maize Ubiquitin 3 promoter to the pCAMBIA1390 backbone; reference: Peng H, Zhang Q, Li Y, Lei C, et al. Planta, 2009, 230(2):377-385] was used as the starting plasmid. The maize Ubiquitin 3 promoter was cut off through HindIII and Kpn I restriction sites and replaced with the promoter P. OsRbcS2 .

[0045] Specifically, the pCUbi1390 plasmid vector and P... OsRbcS2 The fragment cloning vector was digested with restriction endonucleases HindIII (Takara, catalog number 1615) and Kpn I (Takara, catalog number 1618). The digestion system consisted of 10 μL of 10×QuickCut Green Buffer, 1 μL each of HindIII and Kpn I, 40–60 μL of plasmid (approximately 10 μg), and water to a final volume of 100 μL. The digestion temperature was 37°C, and the digestion time was 3 hours. After digestion, the fragments were separated by agarose gel electrophoresis and the target fragment was recovered. Agarose gel fragment recovery was performed using the Rapid Agarose Gel Recovery Kit (catalog number 19101ES70) from Yisheng Biotechnology (Shanghai) Co., Ltd., and the procedure was performed strictly according to the manufacturer's instructions.

[0046] After purification and recovery of the vector and promoter fragment, ligation was performed using Takara's T4 ligase (catalog number 2011A). The ligation system consisted of 1 μL of 10×T4 DNALigase Buffer, 1 μL of T4 ligase, 4 μL of vector fragment (approximately 300 ng), and 4 μL of promoter fragment (approximately 300 ng), for a total volume of 10 μL. The system was incubated overnight at 16°C. Following ligation, *E. coli* transformation was performed using DH5α *E. coli* competent cells (catalog number CC96102) from Shanghai Tolobio Biotechnology Co., Ltd., following the manufacturer's instructions. Transformed and revived competent cells were plated on LB solid medium to obtain single colonies. These single colonies were then picked, cultured in LB liquid medium, and plasmids were extracted. Plasmid extraction was performed using the endotoxin-free plasmid mini-extraction kit (catalog number 19021ES50) from Yisheng Biotechnology (Shanghai) Co., Ltd., following the manufacturer's instructions. After obtaining the plasmid, the vector was identified by restriction endonuclease BamHI (Takara, catalog number 1605; one restriction site is in the promoter fragment, and the other is in the vector multiple cloning site) (according to the enzyme preparation instructions). A positive clone should be able to cut a 1460 bp promoter fragment. The restriction products were identified by agarose gel electrophoresis, and a positive clone was successfully obtained and named pC1390-RbcS2pro.

[0047] The OsHMA3 gene fragment was further cloned into the pC1390-RbcS2pro vector using Kpn I and Spe I restriction endonuclease sites. Specifically, the pC1390-RbcS2pro binary plasmid vector and the OsHMA3 fragment cloning plasmid vector were digested with Kpn I (Takara, catalog number 1618) and Spe I (Takara, catalog number 1631). The digestion system was as follows: 10 μL of 10×QuickCut Green Buffer, 1 μL each of Takara rapid-digesting restriction endonucleases Kpn I and Spe I, 40–60 μL of plasmid (approximately 10 μg), and water to a final volume of 100 μL. The digestion temperature was 37°C, and the digestion time was 3 hours. After digestion, fragment recovery, ligation transformation, and plasmid extraction were performed, following the same methods as for insertion P. OsRbcS2 As described in the construction section of the binary vector, the resulting plasmid was prepared using BamHI (Takara, catalog number 1605; restriction site at P...). OsRbcS2 Double digestion with Spe I (Takara, catalog number 1631; restriction site at the 3′ end of the OsHMA3 gene) was performed (refer to the enzyme preparation instructions). The digestion products were detected by agarose gel electrophoresis. A positive plasmid should yield a 4504 bp fragment, thus obtaining plasmids with simultaneous insertion of P... OsRbcS2The Ti binary plasmid vector containing the OsHMA3 gene is named pC1390-RbcS2pro-HMA3, and its core P OsRbcS2 The complete sequence of the -OsHMA3-NosT expression cassette is shown in SEQ ID NO.4.

[0048] 2. Genetic transformation

[0049] The plasmid pC1390-RbcS2pro-HMA3 was transformed into Agrobacterium tumefaciens EHA105 (contracted to Wuhan Boyuan Biotechnology Co., Ltd.) for genetic transformation of rice. The transformation recipient was BG367 (a Bangladeshi local variety with red seed coat and lack of endogenous OsHMA3 function; reference: Sui F, Zhao D, Zhu H, et al. J Exp Bot, 2019, 70(10): 2857-2871). The processes of rice seed callus induction, Agrobacterium tumefaciens infection, positive cell screening, and plant regeneration were entrusted to Wuhan Boyuan Biotechnology Co., Ltd., a professional company, and 26 transgenic regenerated seedlings were obtained.

[0050] 3. Identification of T-DNA insertion in transgenic plants

[0051] The insertion of the target fragment into the receptor genome was detected using two methods: PCR and leaf segment hygromycin resistance detection.

[0052] First, the transgenic contemporary plants were tested using the leaf segment hygromycin resistance test (Liu Qiaoquan, Chen Xiuhua, Wang Xingwen, et al. Journal of Agricultural Biotechnology, 2001, 9(03):264-268), and all plants were found to be resistant to hygromycin. Then, PCR was used for further testing. The PCR primer pair used was GCAAAAAGAATGTGTTGCACTTGT (S2HMA3-F, SEQ ID NO.11) and CTTTGTGCAGGCCAGCGTC (S2HMA3-R, SEQ ID NO.12); the amplified fragment length was 1499 bp; the amplification system was as follows: 10 μL of PCR Master Mix (With Dye) (Yisheng Biotechnology, 10102ES08), 0.8 μL each of forward and reverse primers (10 pmol / μL), 2 μL of genomic DNA, and water were added to a final volume of 20 μL. The amplification temperature program was as follows: pre-denaturation 98℃ for 30 s; denaturation 98℃ for 10 s, annealing 57℃ for 5 s, extension 72℃ for 10 s, amplification for 35 cycles; final extension 72℃ for 1 min. PCR products were detected by agarose gel electrophoresis. The genomic DNA used for PCR detection was extracted from leaves using a magnetic bead method (method referenced in patent application No. 201210131323.5, "Reagent Kit and Extraction Method for Extracting Plant DNA from Plant Leaves Based on Magnetic Bead Method"). PCR detection was performed on 21 T0 generation lines, and the target fragment was detected in all of them, with a positive rate of 100%.

[0053] 4. Screening of transgenic single-copy lines and homozygous single plants

[0054] Because T0 generation plants produce fewer seeds, the copy number in this embodiment is estimated by the hygromycin resistance of seeds produced by T1 plants (i.e., T2 generation resistance). Specifically, the offspring of T0 generation transgenic positive plants (i.e., T1 generation plants) are planted in a netted experimental field with isolation conditions. Seeds from 12 T1 generation plants are harvested from each line. After dormancy is broken by treatment in a 50℃ oven for 7 days, the seeds are germinated in MS mineral nutrient solution containing 50 mg / L hygromycin (a nutrient solution containing macro- and micro-elements of MS medium; the germination rate of transgenic seeds is lower than that of the control when germinated in water, but can recover to normal when germinated in nutrient solution) to test hygromycin resistance. 50 seeds are germinated from each plant. After soaking in water for one week, the hygromycin resistance is determined by whether healthy seed roots grow during the germination process. Resistant seeds can generally grow roots and shoots normally, while non-resistant seeds may grow green shoots (or may grow and then rot and die), but the seed roots are difficult to grow or will rot after growing. If none of the 12 T1 plants of a certain line exhibit a completely non-resistant phenotype (i.e., no non-transgenic single plants segregate in the T1 generation), the line is determined to be a multiple-copy insertion; if more than one seed exhibits completely non-resistant phenotype (i.e., non-transgenic single plants segregate in the T1 generation), the line is identified as a single-copy candidate. From the single-copy candidate lines, T1 generation single plants with almost all seeds exhibiting hygromycin resistance are selected, and their progeny are used for further testing.

[0055] 5. Identification of Cadmium Accumulation Capacity in Transgenic Plants

[0056] For green tissue promoter P OsRbcS2The cadmium accumulation capacity of homozygous single-copy candidate plants of the transgenic lines T2 or T3 driving OsHMA3 expression was preliminarily identified and compared with wild-type controls. The identification was conducted in a cement tank with uniformly cadmium soil (total cadmium content 5.85 mg / kg). The plants were kept submerged after heading and water was withheld one week before harvest. After rice maturity, cadmium content was measured in the stems, leaves (including leaf sheaths), rachis, and brown rice samples. The measurement process included sample preparation and cadmium content determination.

[0057] The sample processing method is as follows: After the plant matures, it is cut off from the base of the stem. After harvesting the rice, the rice straw and rice are dried. The dried rice straw stems, leaves and panicle rachis (including branches) are separated. The same tissues in a single plant are mixed and placed in a paper bag and dried at 101℃ for 24 hours. The rice tissues are crushed and sieved using a crusher (60 mesh for stems and leaves, 100 mesh for brown rice). Finally, the crushed tissues are packed into plastic resealable bags for later use.

[0058] The cadmium content was determined as follows: It was determined by solid-sample electrothermal evaporation atomic absorption spectrometry using a fully automatic cadmium analyzer (model AA2288) from Changsha Kaiyuan Hongsheng Technology Co., Ltd. Rice tissue analysis was performed according to the standard "T / CAIA / SH014-2021 Rapid Determination of Cadmium in Grains - Solid Direct Sample Electrothermal Evaporation Atomic Absorption Spectrometry". Soil analysis was performed according to the standard "T / CAIA / SH015-2021 Rapid Determination of Cadmium in Soil - Solid Direct Sample Electrothermal Evaporation Atomic Absorption Spectrometry".

[0059] Results of cadmium content determination in different tissues of the sample as follows Figure 1 As shown. Figure 1The study showed the changes in cadmium content in various tissues of 10 transgenic plant lines grown in cement ponds relative to the wild-type control. It can be seen that, overall, compared with the control, the cadmium content in the leaves, rachis, and brown rice of all lines decreased to varying degrees, while the cadmium content in the stems decreased, increased, or remained unchanged. The data also showed that the higher the cadmium content in the stems of the transgenic plants, the lower the cadmium content in the brown rice. Among them, the cadmium content in brown rice of strains T46, T41, T48, and T26 was lower than the national limit (0.2 mg / kg), with specific values ​​of 0.13, 0.12, 0.11, and 0.10 mg / kg, respectively. The cadmium content in brown rice of strain T32 slightly exceeded the national limit, with a specific value of 0.21 mg / kg. The average cadmium content in the stems of these five strains increased to varying degrees compared with the control (the increase ranged from 23.2% to 86.1%, but only strain T48 reached a statistically significant difference). The cadmium content in brown rice of the remaining strains was higher than the national limit, while the cadmium content in the stems decreased to varying degrees (the decrease ranged from 2.5% to 43.7%) or increased slightly (the increase ranged from 15.6%) compared with the control. Strains T46, T41, T48, and T26 are the types desired in this invention, exhibiting hyperaccumulation of cadmium in the stems and low accumulation in the grains. These strains can be used for cadmium-contaminated soil remediation and for producing rice with cadmium content below the national limit. Data from this embodiment shows that cadmium can be obtained from P... OsRbcS2 Transgenic lines driving OsHMA3 expression were screened to produce lines with high cadmium in stems and low cadmium in grains, thus validating P. OsRbcS2 The practicality of a method for constructing rice with high cadmium stems and low cadmium grains by driving OsHMA3 expression.

[0060] P OsRbcS2 The differences in cadmium content among different lines of transgenic materials driving OsHMA3 expression may be related to differences in expression caused by different insertion sites of the transgene in the chromosome. In some lines, the transgene may leak expression in the roots, leading to a decrease in cadmium content in the stems. In lines that meet the predetermined target of cadmium hyperaccumulation in stems and low cadmium accumulation in grains, cadmium is mainly retained in the stems, thus preventing rice from exceeding the cadmium limit.

[0061] Example 2: Construction of transgenic plants expressing OsHMA3 driven by the OsRbcS3 promoter and identification of cadmium accumulation characteristics.

[0062] 1. Carrier Construction

[0063] 1.1OsRbcS3 promoter (P OsRbcS3 Cloning of fragments

[0064] The OsRbcS3 gene has been shown to be specifically expressed in green tissues (Morita K, Hatanaka T, Misoo S, et al. Plant Physiol, 2014, 164:69-79), and was therefore selected in this embodiment.

[0065] The OsRbcS3 promoter was processed in a similar manner to that described in Example 1, resulting in a P containing the first intron. OsRbcS3 The sequence is as follows (SEQ ID NO.13):

[0066]

[0067] The above sequence has HindⅢ and Kpn I restriction endonuclease sites added at both ends for vector construction. The promoter contains a 5′UTR region, introns, and adjacent exon fragments. The full-length sequence is 2018 bp, with lowercase underscores indicating the 5′UTR and double underscores indicating introns. The above sequence includes base substitutions in the ATG region of the first exon coding region of the original gene to avoid affecting transgenic translation.

[0068] The above sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd., and the fragment was cloned into the EcoRV restriction site of the plasmid vector PUC57 for later use.

[0069] Cloning of the 1.2 OsHMA3 cDNA fragment

[0070] Same as Example 1.

[0071] 1.3 Construction of Ti binary plasmid vector

[0072] The vector construction process is the same as the process and method described in "Construction of Ti binary plasmid vector" in Example 1, and is briefly described as follows: P is constructed by double digestion with HindIII and KpnI and ligation. OsRbcS3 The fragment was cloned into the pCUbi1390 plasmid vector. The correctness of the cloned fragment was verified by restriction endonuclease Sal I (Takara, catalog number 1636; one restriction site is located in the promoter, and the other is located in the multiple cloning site). A correct vector should yield a 1140 bp fragment. The obtained vector was named pC1390-RbcS3pro. Further, the OsHMA3 gene fragment was cloned into the pC1390-RbcS3pro vector using Kpn I and Spe I restriction endonuclease sites. The correctness of the vector was verified by double digestion with Nco I (Takara, catalog number 1620; restriction site is located on the OsRbcS3 promoter) and Spe I (Takara, catalog number 1631; restriction site is located at the 3′ end of the OsHMA3 gene). A correct plasmid should yield a 3473 bp fragment. The obtained vector was named pC1390-RbcS3pro-HMA3, and its core P... OsRbcS3 The complete sequence of the -OsHMA3-NosT expression cassette is shown in SEQ ID NO.5.

[0073] 2. Genetic transformation

[0074] The plasmid pC1390-RbcS3pro-HMA3 was transformed into Agrobacterium tumefaciens EHA105, followed by genetic transformation of rice (commissioned to Wuhan Boyuan Biotechnology Co., Ltd.). The recipient was BG367. Twenty-three transgenic regenerated seedlings were obtained.

[0075] 3. Identification of T-DNA insertion in transgenic plants

[0076] Whether the target fragment was inserted into the recipient genome was detected using two methods: PCR and leaf segment hygromycin resistance assay (the methods were the same as in Example 1). The PCR primer pair was AAGGGGTTACATCCTTTTTAGTTG (S3HMA3-F, SEQ ID NO. 14) and CAGCGTCTCGAGCCATTCT (S3HMA3-R, SEQ ID NO. 15); the amplified fragment length was 1373 bp. The amplification system and procedure were the same as in Example 1. Eighteen T0 lines were tested, and all 18 seedlings were positive, with a positive rate of 100%.

[0077] 4. Screening of transgenic single-copy lines and homozygous single plants

[0078] The screening process and methods are the same as in Example 1.

[0079] 5. Identification of Cadmium Accumulation Capacity in Transgenic Plants

[0080] For green tissue promoter P OsRbcS3 The cadmium accumulation capacity of homozygous single-copy candidate plants from some transgenic lines T2 or T3 driving OsHMA3 expression was preliminarily identified and compared with wild-type controls. The identification method was the same as in Example 1. The cadmium content determination results in different tissues of the samples are as follows: Figure 2 As shown in the figure, it can be seen that, except for the lines where the cadmium content in the stems was not detected to be lower than that in the control, the changes in different tissue parts of the transgenic material relative to the control were similar to those in Example 1, that is, the cadmium content in the stems remained unchanged or increased, while the cadmium content in other tissues decreased to varying degrees. Among them, the cadmium content in brown rice of lines T79, T63, and T73 was lower than the national limit standard, with specific values ​​of 0.19, 0.16, and 0.13 mg / kg, respectively. The cadmium content in brown rice of line T83 slightly exceeded the national limit standard, with a specific value of 0.24 mg / kg. The average cadmium content in the stems of these four lines increased to varying degrees compared with the control (the increase ranged from 28.9% to 56.4%, and all except line T83 showed significant differences compared with the control). The cadmium content in brown rice of the remaining lines, namely T85, T65, and T61, was higher than the national limit standard, while the cadmium content in the stems remained basically unchanged or significantly increased (the increase was 47.2%) compared with the control. Lines T79, T63, and T73 are the types desired in this invention. The data in this example show that, from P OsRbcS3Transgenic lines driving OsHMA3 expression were screened to produce lines with high cadmium in stems and low cadmium in grains, thus validating P. OsRbcS3 The practicality of a method for constructing rice with high cadmium stems and low cadmium grains by driving OsHMA3 expression.

[0081] Example 3: Construction of transgenic plants expressing OsHMA3 driven by the D540 promoter and identification of cadmium accumulation characteristics.

[0082] 1. Carrier Construction

[0083] 1.1D540 promoter (P D540 Cloning of fragments

[0084] The D540 gene has been shown to be specifically expressed in the green tissues of rice (Cai M, Wei J, Li X, et al. Plant Biotechnol J, 2007, 5: 664-674), therefore its promoter was selected in this embodiment.

[0085] The D540 promoter was processed in a similar manner to that described in Example 1, resulting in a P promoter containing the first intron. D540 The sequence is as follows (SEQ ID NO.16):

[0086]

[0087] The above sequence has HindIII and KpnI restriction endonuclease sites added at both ends for vector construction. The promoter contains a 5′UTR region, introns, and adjacent exon fragments. The full-length sequence is 2088 bp, with lowercase underscores indicating the 5′UTR and double underscores indicating introns. Base substitutions were made to the ATG region of the first exon coding region and one Spe I restriction endonuclease site in the promoter of the original sequence.

[0088] The above sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd., and the fragment was cloned into the EcoR V restriction site of plasmid vector PUC57 for later use.

[0089] Cloning of the 1.2 OsHMA3 cDNA fragment

[0090] Same as Example 1.

[0091] 1.3 Construction of Ti binary plasmid vector

[0092] The vector construction process is the same as the process and method described in "Construction of Ti binary plasmid vector" in Example 1, and is briefly described as follows: P is constructed by double digestion with Hind III and Kpn I and ligation. D540The fragment was cloned into the pCUbi1390 plasmid vector. The correctness of the cloned fragment was verified by restriction endonuclease Nco I (Takara, catalog number 1620; one restriction site is located in the promoter, and the other is located in the multiple cloning site). A correct vector should yield a 1136 bp fragment. The obtained vector was named pC1390-D540pro. Further, the OsHMA3 gene fragment was cloned into the pC1390-D540pro vector using Kpn I and Spe I restriction endonuclease sites. The correctness of the vector was verified by double digestion with Nco I (Takara, catalog number 1620; restriction site is located on the D540 promoter) and Spe I (Takara, catalog number 1631; restriction site is located at the 3′ end of the OsHMA3 gene). A correct plasmid should yield a 4145 bp fragment. The obtained vector was named pC1390-D540pro-HMA3, with its core P... OsD540 The complete sequence of the -OsHMA3-NosT expression cassette is shown in SEQ ID NO.6.

[0093] 2. Genetic transformation

[0094] After transforming plasmid pC1390-D540pro-HMA3 into Agrobacterium tumefaciens EHA105, genetic transformation of rice was carried out (commissioned to Wuhan Boyuan Biotechnology Co., Ltd.). The transformation recipient was BG367, and 24 transgenic regenerated seedlings were obtained.

[0095] 3. Identification of T-DNA insertion in transgenic plants

[0096] The insertion of the target fragment into the recipient genome was detected using two methods: PCR and leaf segment hygromycin resistance assay (the methods were the same as in Example 1). PCR primers were: TGGTGCACCCTGGCATTATC (D540HMA3-F, SEQ ID NO. 17) and GGGAAGAGCCACTCGAAGAA (D540HMA3-R, SEQ ID NO. 18); the amplified fragment length was 1906 bp. The amplification system was the same as in Example 1, except that the PCR program was set to 56℃ for annealing and 20s for extension. Twenty T0 lines were tested, and all 20 were positive, resulting in a 100% positive rate.

[0097] 4. Screening of transgenic single-copy lines and homozygous single plants

[0098] The screening process and methods are the same as in Example 1.

[0099] 5. Preliminary identification of cadmium accumulation capacity in transgenic plants

[0100] Green organization promoter P D540Transgenic lines T1 plants driving OsHMA3 expression and wild-type controls were planted in soil with an average cadmium pollution concentration of 1.03 mg / kg. Water was withheld for more than 15 days before harvest. Two plants (only one plant in some lines) with non-segregated seed hygromycin resistance were selected from the control and each transgenic line for the determination of cadmium content in brown rice (the method for determining cadmium content in brown rice is the same as in Example 1). The results are shown in Table 1.

[0101] Table 1P D540 Cadmium content in brown rice of T1 generation transgenic plants driving OsHMA3 expression

[0102]

[0103] Table 1 shows that the cadmium content in the wild-type control brown rice was severely excessive. Most transgenic lines (15 out of 19 lines, accounting for 79%) had cadmium content in brown rice below the national limit, while a small number of lines exceeded the limit to varying degrees. In this example, the cadmium content in the stems of wild-type plants was tested, and the average value was found to be as high as 8.9 mg / kg. However, the cadmium content in the stems of transgenic plants was not tested, therefore the change in cadmium content in the stems of transgenic plants relative to the control is unclear. Based on the results of Examples 1 and 2, it is speculated that among the lines in this example with cadmium content in brown rice below the national limit, there may be lines with cadmium content in stems not lower than the control. Further verification is needed to confirm this.

[0104] This embodiment provides a method for constructing a green tissue promoter P. D540 This paper presents a specific method for driving OsHMA3 expression in transgenic lines and preliminarily verifies the potential of this transgenic method for breeding rice with high cadmium stems and low cadmium grains.

[0105] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for constructing rice with high cadmium stalks and low cadmium grains, characterized in that, The DNA structure that drives the expression of the OsHMA3 gene by the green tissue-specific promoter was introduced into rice materials inactivated by endogenous OsHMA3 gene to obtain rice materials with high cadmium in the stem and low cadmium in the grain. The green tissue-specific promoter is the promoter of the OsRbcS2, OsRbcS3, or OsD540 gene. The promoter of the OsRbcS2 gene has the nucleotide sequence shown in SEQ ID NO.1, the promoter of the OsRbcS3 gene has the nucleotide sequence shown in SEQ ID NO.2, and the promoter of the OsD540 gene has the nucleotide sequence shown in SEQ ID NO.

3.

2. The method as described in claim 1, characterized in that, The green tissue-specific promoter is a promoter that can drive gene expression in green tissues of rice but not expressed or expressed at low levels in non-green tissues; the green tissues are selected from one or more of the stem, leaf, and leaf sheath, and the non-green tissues include the root.

3. The method as described in claim 2, characterized in that, The DNA structure for driving OsHMA3 gene expression via the green tissue-specific promoter is selected from the gene expression cassette shown in any one of the DNA sequences of SEQ ID NO.4, SEQ ID NO.5, or SEQ ID NO.

6.

4. The method as described in claim 1, characterized in that, The rice material with inactivated endogenous OsHMA3 gene is either a rice material with inactivated endogenous OsHMA3 gene due to natural mutation existing in existing rice germplasm resources, or a rice material with inactivated endogenous OsHMA3 gene constructed de novo through artificial gene mutation.

5. The method as described in claim 4, characterized in that, The rice materials in the existing rice germplasm resources that have undergone natural mutations in the endogenous OsHMA3 gene and have lost their function include BG367 rice.

6. The method as described in claim 4, characterized in that, The artificial gene mutation method includes any one of targeted gene knockout or directed induction of local genome mutation technology.

7. The method according to any one of claims 1 to 6, characterized in that, The OsHMA3 gene is a DNA sequence encoding a polypeptide as shown in SEQ ID NO.

7.

8. The application of a rice material with high cadmium stalks and low cadmium grains, constructed by the method according to any one of claims 1 to 7, in the remediation of cadmium-contaminated soil and the production of safe-to-eat rice.

Images