High-performance carbonyl reductase mutant and application thereof in synthesis of series of chiral alcohols

Abstract

The invention discloses a high-performance carbonyl reductase mutant and application thereof in synthesis of a series of chiral alcohols. The high-performance carbonyl reductase mutant is obtained by performing the following mutations on an amino acid sequence as shown in SEQ ID NO.2: the 69th alanine mutates into any one of lysine, leucine, aspartic acid or asparagine, and the 69th alanine mutates into any one of lysine, leucine, aspartic acid or asparagine; and / or the 100th glycine is mutated into any one of glutamic acid, serine, lysine or asparagine. Compared with a wild type enzyme, the thermal stability and the catalytic activity of the obtained mutant are remarkably improved, particularly, single point mutants Mut-A69N, Mut-G100E and Mut-G100N and a combined mutant Mut-A69N-G100N show excellent relative enzyme activity, thermal stability and substrate tolerance. The mutant has high catalytic activity and stability to various chiral alcohols, and the contradiction that the traditional carbonyl reductase is easy to inactivate at high temperature and the catalytic efficiency is difficult to achieve at the same time is solved. The invention provides an efficient and stable enzyme catalysis tool for green biological preparation of chiral drug intermediates.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and particularly relates to a high-activity and thermal-stability carbonyl reductase mutant and its application in synthesis of a series of chiral alcohols. BACKGROUND

[0002] Carbonyl reductase is a very old enzyme family, widely distributed in various animals, microorganisms and plants, which is a kind of oxidoreductase capable of catalyzing the oxidation and dehydrogenation of secondary alcohol to generate corresponding carbonyl compounds or its reversible reaction, often requiring NAD(H) or NADP(H) as a proton carrier. This kind of enzyme is involved in various metabolic processes in the body, including lipid metabolism and drug metabolism, etc. In industrial applications, carbonyl reductase is widely used in the synthesis of chiral alcohols due to its high stereoselectivity and substrate adaptability, especially in the fields of drugs and fragrances. Through biocatalytic technology, carbonyl reductase can realize green chemical synthesis, reduce environmental pollution and production cost. In addition, carbonyl reductase also has potential application value in the fields of biosensors and bioremediation. Therefore, it is of great research significance and industrial value to develop a high-activity and thermal-stability carbonyl reductase for the synthesis of a series of chiral alcohols.

[0003] Chiral alcohol is a chemical synthesis method with stereoselectivity, which selectively generates unequal optical isomer products by interacting with a non-chiral group in the molecule. Chiral alcohol is an important intermediate for the synthesis of chiral drugs, and is widely used in various fields such as drugs, pesticides, cosmetics, etc. Chiral alcohol pharmaceutical intermediates have important applications in the pharmaceutical industry, such as as a synthesis intermediate of duloxetine, atorvastatin and other chiral drugs. Through biocatalytic technology, the synthesis of chiral alcohol has the advantages of green, high efficiency, high selectivity, etc., which can effectively solve the drawbacks of traditional chemical synthesis methods.

[0004] Florfenicol is a chloramphenicol antibiotic drug for veterinary use, which has the advantages of wide antibacterial spectrum, strong antibacterial effect, rapid absorption, wide distribution in the body, no cross-resistance, etc. Its chemical structure is similar to chloramphenicol, which is a monofluoro derivative of thiamphenicol, and has the same antibacterial spectrum, antibacterial effect and indications as chloramphenicol. Florfenicol has strong antibacterial activity against a variety of gram-positive bacteria, gram-negative bacteria and mycoplasma, etc., especially better than gram-positive bacteria against gram-negative bacteria. The key precursor for the synthesis of florfenicol is D-ethyl ester and its analogues, which contain adjacent chiral centers, making the synthesis more difficult. The method of using carbonyl reductase to dynamically reduce and kinetically resolve p-thiamphenyl-α-amino-β-keto ester substrates can effectively make up for the shortcomings of traditional chemical routes. It improves the synthesis efficiency of chiral alcohol, significantly reduces environmental pollution and production cost, and provides a new scheme for the green synthesis of florfenicol.

[0005] Vibegron is a beta3 adrenergic receptor agonist drug used to treat overactive bladder (OAB) and its associated symptoms, including urinary urgency, urinary frequency, and urinary incontinence. It is also indicated for the treatment of overactive bladder in adult men with benign prostatic hyperplasia (BPH). Methyl (2S, 3R)-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropanoate, (2S, 3R)-aminohydroxy ester, is a key chiral intermediate for the synthesis of vibegron. There are studies on the industrial synthesis of vibegron chiral intermediates by biological enzyme method, and the NADPH-dependent carbonyl reductase KRED asymmetric reduction-coenzyme regeneration coupling system is constructed. With glucose as a co-substrate, the substrate (S)-aminoketone ester is asymmetrically reduced to obtain the product (2S, 3R)-aminohydroxy ester. In 30 o Under the condition of C, pH = 7.3-7.7, 85.0 g / L of substrate, 70 g / L of co-substrate glucose, after 4 h of reaction, the yield of the product is about 95.0%, and the e.e. is >99.9%.

[0006] Rosuvastatin is a selective HMG-CoA reductase inhibitor for reducing cholesterol levels, and its key chiral intermediate is (3R, 5S)-6-chloro-3, 5-dihydroxyhexanoic acid tert-butyl ester (tert-Butyl (3R, 5S)-6-chloro-3, 5-dihydroxyhexanoate, abbreviated as (3R, 5S)-CDHH). Atorvastatin is a lipid-lowering drug, and its key chiral intermediate is (3R, 5R)-6-cyano-3, 5-dihydroxyhexanoic acid tert-butyl ester (tert-Butyl (3R, 5R)-6-cyano-3, 5-dihydroxyhexanoate, abbreviated as (3R, 5R)-CNHH). Duloxetine is a 5-hydroxytryptamine and norepinephrine reuptake inhibitor for treating various mental diseases, and its key chiral intermediate is ethyl (S)-3-hydroxy-3-(thiophen-2-yl) propanoate (Ethyl (S)-3-hydroxy-3-(thiophen-2-yl) propanoate, abbreviated as (S)-HEES). Among them, rosuvastatin and atorvastatin as statins play an important role in reducing low-density lipoprotein cholesterol and preventing cardiovascular diseases, and the structural characteristics of the chiral intermediates determine the activity and selectivity of the drugs. Duloxetine regulates neurotransmitter balance by inhibiting the reuptake of 5-hydroxytryptamine and norepinephrine, thereby achieving the effect of treating mental diseases, and the structure of the chiral intermediate is also crucial to its pharmacological effect.

[0007] In the synthesis of a series of chiral alcohol pharmaceutical intermediates, asymmetric synthesis of chiral alcohol catalyzed by carbonyl reductase is a key step. The traditional method is complex and pollutes the environment, while biocatalytic synthesis has the advantages of mildness, high selectivity, environmental protection and the like. However, the enzyme performance and reaction conditions still need to be optimized to improve the yield and reduce the cost, so as to realize more efficient and green drug synthesis process. SUMMARY

[0008] To solve the technical problems of poor stability, low activity and low yield of carbonyl reductase-mediated synthesis of chiral alcohol, the present application provides a high-stability and high-activity carbonyl reductase mutant and its application in enzyme synthesis of a series of chiral alcohols.

[0009] The technical scheme adopted by the present application is as follows:

[0010] A carbonyl reductase mutant is obtained by single-point mutation or multi-point combined mutation of the 69th and 100th positions of the amino acid sequence shown in SEQ ID NO. 2; the amino acid sequence of the carbonyl reductase shown in SEQ ID NO. 2 is derived from Exiguobacterium sp.

[0011] As preferred, the mutation is one or a combination of the following:

[0012] (1) the alanine at position 69 is mutated to any one of lysine, leucine, aspartic acid, asparagine;

[0013] (2) the glycine at position 100 is mutated to any one of glutamic acid, serine, lysine, asparagine.

[0014] Further, the mutant is preferably one of the following:

[0015] (a) the alanine at position 69 in the amino acid sequence shown in SEQ ID NO. 2 is mutated to asparagine (A69N);

[0016] (b) the glycine at position 100 in the amino acid sequence shown in SEQ ID NO. 2 is mutated to asparagine (G100N);

[0017] (c) the alanine at position 69 in the amino acid sequence shown in SEQ ID NO. 2 is mutated to asparagine, and the glycine at position 100 is mutated to asparagine (A69N-G100N).

[0018] More preferably, the carbonyl reductase mutant is obtained by mutating the alanine at position 69 in the amino acid sequence shown in SEQ ID NO. 2 to asparagine, and mutating the glycine at position 100 to asparagine, and is named mutant Mut-A69N-G100N, the nucleotide sequence of which is shown in SEQ ID NO. 3, and the amino acid sequence of which is shown in SEQ ID NO. 4.

[0019] Due to the specificity of the amino acid sequence, any peptide protein fragment or variant thereof, such as a conservative variant, a biologically active fragment or a derivative thereof, containing the amino acid sequence shown in the present application, as long as the peptide protein fragment or peptide protein variant has more than 90% homology with the aforementioned amino acid sequence, is within the scope of protection of the present application. Specifically, the changes include deletion, insertion or substitution of amino acids in the amino acid sequence; wherein the substituted amino acids have similar structure or chemical properties to the original amino acids, and the enzyme variants can also have non-conservative changes.

[0020] The present application also provides a coding gene of the carbonyl reductase mutant.

[0021] Specifically, the nucleotide sequence of the coding gene corresponding to the amino acid sequence shown in SEQ ID NO. 2 is shown in SEQ ID NO. 1.

[0022] Due to the specificity of nucleotide sequence, any variant of the polynucleotide of the present application, as long as it has more than 90% homology with the aforementioned polynucleotide, falls within the protection scope of the present application. The variant of the polynucleotide refers to a polynucleotide sequence with one or more nucleotide changes. The variant of the polynucleotide can be a natural variant or a non-natural variant, including substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide, which can be a substitution, deletion or insertion of a polynucleotide, but does not substantially change the function of the encoded peptide protein.

[0023] The present application also provides a recombinant vector containing the coding gene of the carbonyl reductase mutant. The recombinant vector comprises a polynucleotide operably linked to a control sequence suitable for directing expression in a host cell. Various vectors, such as various plasmids, bacteriophages or viral vectors, etc. in the art, which are linked to the novel carbonyl reductase mutant nucleotide sequence of the present application, should all fall within the protection scope of the present application. The recombinant vector preferably uses plasmid pET28b as an expression vector, and the coding gene of the novel carbonyl reductase mutant is linked to the plasmid pET28b.

[0024] The present application also provides a genetically engineered bacterium containing the coding gene of the carbonyl reductase mutant, which is constructed by using the recombinant vector containing the coding gene of the carbonyl reductase mutant. The recombinant genetically engineered bacterium construction method is generally as follows: the coding gene of the carbonyl reductase mutant is linked to the expression vector pET28b to construct a recombinant vector containing the coding gene of the carbonyl reductase mutant, and the recombinant vector is transformed into a host cell to obtain a genetically engineered bacterium containing the recombinant plasmid. The host cell can be a bacterium, a fungus, a plant cell or an animal cell, and preferably Escherichia coli BL21 (DE3) is used as an expression host.

[0025] The coding gene of the carbonyl reductase mutant is introduced into a host cell by genetic engineering technology to construct a genetically engineered bacterium and perform expression, so as to obtain the carbonyl reductase mutant of the present application.

[0026] The carbonyl reductase mutant can be obtained by the following method:

[0027] A recombinant vector containing the coding gene of the carbonyl reductase mutant is constructed, the recombinant vector is transformed into a host bacterium, and the obtained genetically engineered bacterium is induced to culture. The culture solution is separated to obtain wet bacterium containing the carbonyl reductase mutant. After the wet bacterium is broken, a crude enzyme solution of the carbonyl reductase mutant M6 is obtained, and the crude enzyme solution is purified to obtain a pure enzyme of the carbonyl reductase mutant.

[0028] In the present application, the carbonyl reductase mutant can be used in various forms. For example, resting cells or wet cells expressing the carbonyl reductase mutant of the present application can be used, and various forms such as crude enzyme solution, pure enzyme or crude enzyme powder can also be used, or immobilized enzyme can be used.

[0029] The present application also provides the use of the carbonyl reductase mutant in the synthesis of chiral alcohol. The chiral alcohol is duloxetine intermediate, florfenicol intermediate, rosuvastatin intermediate, atorvastatin intermediate or vibegron intermediate.

[0030] Further, the method for the use is as follows: using wet cells obtained by fermentation culture of genetically engineered bacteria containing the gene encoding the carbonyl reductase mutant, crude enzyme solution after breaking the wet cells or extracted pure enzyme as catalyst, using chiral ketone as substrate, and performing biocatalytic reaction to prepare the corresponding chiral alcohol;

[0031] The chiral ketone is (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropanoic acid methyl ester, 2-acetylamino-3-(4-(methylsulfonyl)phenyl)-3-oxopropanoic acid methyl ester, 3-oxo-3-(2-thienyl)propanoic acid ethyl ester, (S)-6-chloro-5-hydroxy-3-carbonylhexanoic acid tert-butyl ester ((S)-CHOH), 6-cyano-5(R)-hydroxy-3-oxohexanoic acid tert-butyl ester, and the corresponding chiral alcohol is (2S,3R)-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropanoic acid methyl ester (vibegron intermediate), (2S,3R)-2-acetylamino-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propanoic acid methyl ester (florfenicol intermediate), (S)-3-hydroxy-3-(2-thienyl)propanoic acid ethyl ester ((S)-HEES, duloxetine intermediate), (3R,5S)-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester ((3R,5S)-CDHH, rosuvastatin intermediate), (3R,5R)-6-cyano-3,5-dihydroxyhexanoic acid tert-butyl ester (atorvastatin intermediate).

[0032] Further, the method for the use is as follows:

[0033] Using wet cells obtained by fermentation culture of genetically engineered bacteria containing the gene encoding the carbonyl reductase mutant, crude enzyme solution after breaking the wet cells or extracted pure enzyme as catalyst, using chiral ketone as substrate, and adding coenzyme NADPH and glucose dehydrogenase in a buffer solution with pH value of 6.0-8.0 to form a reaction system, and the corresponding chiral alcohol is prepared;

[0034] The temperature of the reaction is preferably 25-40°C; the stirring speed is preferably 200-800 rpm. The reaction time is preferably 1-30 h.

[0035] The buffer solution is preferably 100 mM, pH 6.5-7.0 phosphate buffer solution. The phosphate can be sodium phosphate or potassium phosphate.

[0036] When the catalyst is in the form of wet bacteria, the amount of wet bacteria of the carbonyl reductase mutant is 10-40 g / L of buffer solution based on the weight of the wet bacteria. Since the wet bacteria cells contain coenzyme, there is no need to add NADPH additionally.

[0037] When the catalyst is in the form of crude enzyme solution, the amount of crude enzyme solution of the carbonyl reductase mutant is 10-40 g / L.

[0038] The concentration of the chiral ketone substrate is 50-400 g / L.

[0039] The final concentration of coenzyme NADPH is 1-5 g / L.

[0040] The final concentration of glucose dehydrogenase is 5-15 g / L.

[0041] The final concentration of glucose is 10-200 g / L.

[0042] In some application methods, a cosolvent such as DMSO, n-butyl acetate, isopropyl alcohol, etc. needs to be added to the reaction system.

[0043] The volume of the cosolvent is generally 10-50% of the reaction system.

[0044] The wet bacteria can be prepared as follows: genetically engineered bacteria containing the coding gene of the carbonyl reductase mutant are inoculated into LB liquid medium containing a final concentration of 50 mg / L kanamycin resistance, and cultured at 37 ℃, 200 rpm for 6-8 h, then inoculated into fresh LB liquid medium containing a final concentration of 50 mg / L kanamycin resistance at a volume concentration of 1-5%, and cultured at 37 ℃, 200 rpm for 2 h, then 0.1-0.3 mM IPTG is added, and the culture is induced at 28 ℃, 200 rpm for 12 h, then centrifuged at 4 ℃, 8000 rpm for 15 min, the supernatant is discarded, and the wet bacteria are collected.

[0045] In the present application, coenzyme NADPH and glucose dehydrogenase are added to form an enzyme-enzyme coupled coenzyme regeneration system, and glucose is added as a co-substrate. The carbonyl reductase mutant first combines with coenzyme NADPH to form a whole enzyme, the substrate enters the substrate binding pocket of the enzyme, obtains one [H] reduced by NADPH transmission, at the same time NADPH loses [H] and is oxidized, then the oxidized NADP is separated from the enzyme, the product is released from the active center, and finally the oxidized NADP is reduced to NADPH by chiral substances or enzymes for recycling.

[0046] The application discloses a method for synthesizing chiral alcohol by using an enzyme as a catalyst.

[0047] The application also provides a preparation method of a fluoroquinolone intermediate, wherein a wet bacterium obtained by fermenting genetically engineered bacteria containing a gene encoding the carbonyl reductase mutant, a crude enzyme solution after crushing the wet bacterium or a pure enzyme extracted therefrom is used as a catalyst, and methyl 2-acetylamino-3-(4-(methylsulfonyl)phenyl)-3-oxopropionate is used as a substrate to obtain methyl (2S,3R)-2-acetylamino-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propanoate, i.e. the fluoroquinolone intermediate, through biological catalysis.

[0048] The application also provides a preparation method of a fluoroquinolone intermediate, wherein a wet bacterium obtained by fermenting genetically engineered bacteria containing a gene encoding the carbonyl reductase mutant, a crude enzyme solution after crushing the wet bacterium or a pure enzyme extracted therefrom is used as a catalyst, and methyl 2-acetylamino-3-(4-(methylsulfonyl)phenyl)-3-oxopropionate is used as a substrate to obtain methyl (2S,3R)-2-acetylamino-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propanoate, i.e. the fluoroquinolone intermediate, through biological catalysis.

[0049] The application also provides a preparation method of a fluoroquinolone intermediate, wherein a wet bacterium obtained by fermenting genetically engineered bacteria containing a gene encoding the carbonyl reductase mutant, a crude enzyme solution after crushing the wet bacterium or a pure enzyme extracted therefrom is used as a catalyst, and methyl 2-acetylamino-3-(4-(methylsulfonyl)phenyl)-3-oxopropionate is used as a substrate to obtain methyl (2S,3R)-2-acetylamino-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propanoate, i.e. the fluoroquinolone intermediate, through biological catalysis.

[0050] The application also provides a preparation method of a fluoroquinolone intermediate, wherein a wet bacterium obtained by fermenting genetically engineered bacteria containing a gene encoding the carbonyl reductase mutant, a crude enzyme solution after crushing the wet bacterium or a pure enzyme extracted therefrom is used as a catalyst, and methyl 2-acetylamino-3-(4-(methylsulfonyl)phenyl)-3-oxopropionate is used as a substrate to obtain methyl (2S,3R)-2-acetylamino-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propanoate, i.e. the fluoroquinolone intermediate, through biological catalysis.

[0051] The application also provides a preparation method of a fluoroquinolone intermediate, wherein a wet bacterium obtained by fermenting genetically engineered bacteria containing a gene encoding the carbonyl reductase mutant, a crude enzyme solution after crushing the wet bacterium or a pure enzyme extracted therefrom is used as a catalyst, and methyl 2-acetylamino-3-(4-(methylsulfonyl)phenyl)-3-oxopropionate is used as a substrate to obtain methyl (2S,3R)-2-acetylamino-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propanoate, i.e. the fluoroquinolone intermediate, through biological catalysis.

[0052] The application also provides a preparation method of a vibegron intermediate, wherein a wet bacterial body obtained by fermenting and culturing a genetically engineered bacterium containing a gene encoding a carbonyl reductase mutant, a crude enzyme solution after crushing the wet bacterial body, or a pure enzyme extracted therefrom is used as a catalyst, (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropanoate ((S)-aminoketone ester) is used as a substrate, and (2S,3R)-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropanoate ((2S,3R)-aminohydroxy ester), that is, a drug vibegron intermediate, is prepared by biological catalysis.

[0053] Preferably, butyl acetate is added as a cosolvent in the method, and the volume is 30-50% of the reaction system.

[0054] Compared with the prior art, the application has the following technical effects:

[0055] The carbonyl reductase mutant provided by the application has significantly improved stability and activity compared with the wild-type enzyme, and in particular, the single-point mutants Mut-A69N, Mut-G100E, Mut-G100N and the combined mutant Mut-A69N-G100N exhibit excellent thermal stability, enzyme activity and substrate tolerance. The relative enzyme activity of the mutant Mut-A69N-G100N is nearly 2 times that of the wild type. After incubation at 50 DEG C for 1 h, the relative enzyme activity of the combined mutant Mut-A69N-G100N can be maintained at more than 88%, and after incubation at 55 DEG C for 0.5 h, the relative enzyme activity of the combined mutant Mut-L20I-L55I can be maintained at more than 60%, while the wild-type enzyme has no enzyme activity at this time. The mutant of the application exhibits very excellent enzyme activity and thermal stability.

[0056] The carbonyl reductase mutant has high catalytic efficiency, high thermal stability, strong substrate tolerance and easy fermentation production for various chiral alcohol intermediates, solves the contradiction between high temperature deactivation and difficult catalytic efficiency of traditional carbonyl reductase, and provides an efficient and stable enzyme catalysis tool for green biological manufacturing of chiral drug intermediates. BRIEF DESCRIPTION OF DRAWINGS

[0057] Figure 1 SDS-PAGE diagram of the wild-type carbonyl reductase and the mutant thereof. Figure 1 In the diagram, lane M is a protein molecular weight marker, lane 1 is a pure enzyme of a carbonyl reductase original strain WT, lane 2 is a Mut-A69N pure enzyme, lane 3 is a Mut-G100N pure enzyme, and lane 4 is a Mut-A69N-G100N pure enzyme. DETAILED DESCRIPTION

[0058] The application will be further described in connection with the following examples. Those skilled in the art will be able to implement the application based on the description. In addition, the examples of the application described in the following description are generally only examples of part of the application, not all examples. Therefore, all other examples obtained by those skilled in the art based on the examples in the application without creative labor should be within the scope of protection of the application.

[0059] In the embodiments of the application, the amino acid sequence of the wild-type carbonyl reductase (derived from Exiguobacterium sp.) is shown in SEQ ID NO. 2, and the encoding gene is shown in SEQ ID NO. 1.

[0060] The sequence of SEQ ID NO. 2 is as follows: MKYTVITGAS SGIGYETAKL LAEKGKSLVL VARRTKELES LRDEIKSISP DSDVLIESIDLSYSENVYAL YESLTNLDIE TWINNAGFGD FDLVQDVDLG KIEKMLRLNI EALTVLSSLYVRDYHDVEGAQLLNVSSAGG YRIVPNAVTY CATKFYVSAY TEGLAQELIH NDAKLRAKVL APAATETEFA DRSRDQEGFDYSQNVPKYHT AREMAEFLYQ LLESDQIVGI VNHEDYSFNL RGPIKPYAG

[0061] Example 1: Construction of carbonyl reductase mutant

[0062] (1) The wild-type carbonyl reductase encoding gene (nucleotide sequence shown in SEQ ID NO. 1) is connected with the expression vector pET28b to construct a heterologous expression recombinant plasmid pET28b(+)-WT containing the carbonyl reductase encoding gene. The expression recombinant plasmid is transformed into the host cell E. coli BL21(DE3) competent cell to obtain a recombinant genetically engineered bacterium E. coli BL21(DE3) / pET28b(+)-WT containing the expression recombinant plasmid of the carbonyl reductase, i.e. the carbonyl reductase engineering bacterium.

[0063] After the carbonyl reductase engineering bacteria E. coli BL21(DE3) / pET28b(+)-WT was thawed, the bacterial liquid was streaked on kanamycin-resistant LB plates and incubated at 37°C for 12 h. A single colony was inoculated into 10 mL of LB test tube with a final concentration of 50 mg / L of kanamycin resistance and incubated at 37°C, 200 rpm for 6-8 h. 2 mL of bacterial liquid in the test tube was inoculated into 50 mL of LB flask with a final concentration of 50 mg / L of kanamycin resistance, and incubated at 37°C, 200 rpm for 2 h. 50 μL of 0.1 M IPTG was added, and the culture was incubated at 28°C, 200 rpm for 12 h. The bacterial cells were collected by centrifugation at 4°C, 8000 rpm for 15 min, and stored at -20°C.

[0064] (2) The prepared carrier heterologous expression recombinant plasmid pET28b(+)-WT was used as a template, and the site-directed mutation primers shown in Table 1 were used to introduce mutations by PCR. In Table 1, the underlined mutation sites in the primer sequences are shown. Among them, primers A69-R, A69K-F are used for PCR to mutate the 69th alanine of the wild-type enzyme to lysine, primers A69-R, A69L-F are used for PCR to mutate the 69th alanine of the wild-type enzyme to leucine, primers A69-R, A69D-F are used for PCR to mutate the 69th alanine of the wild-type enzyme to aspartic acid, and primers A69-R, A69N-F are used for PCR to mutate the 69th alanine of the wild-type enzyme to asparagine. Primers G100-R, G100E-F are used for PCR to mutate the 100th glycine of the wild-type enzyme to glutamic acid, primers G100-R, G100S-F are used for PCR to mutate the 100th glycine of the wild-type enzyme to serine, primers G100-R, G100K-F are used for PCR to mutate the 100th glycine of the wild-type enzyme to lysine, and primers G100-R, G100N-F are used for PCR to mutate the 100th glycine of the wild-type enzyme to asparagine.

[0065] Table 1

[0066] Primer Sequence 5'-3' A69K-F AAAATGTTTAC AAG CTGTATGAAAGCCT]]> A69L-F AAAATGTTTAC CTA CTGTATGAAAGCCT]]> A69D-F AAAATGTTTAC GAC CTGTATGAAAGCCT]]> A69N-F AAAATGTTTAC AAC CTGTATGAAAGCCT]]> A69-R GTAAACATTTTCACTATAGCTCAGATCAATGCTT G100E-F ATGTTGACCTG GAG AAAATCGAGAAAATGCTGCGCTTAA]]> G100S-F ATGTTGACCTG AGC AAAATCGAGAAAATGCTGCGCTTAA <!-- 6 -->]]> G100K-F ATGTTGACCTG AAG AAAATCGAGAAAATGCTGCGCTTAA]]> G100N-F ATGTTGACCTG AAC AAAATCGAGAAAATGCTGCGCTTAA]]> G100-R CAGGTCAACATCCTGAACCAGATCAAAAT

[0067] The PCR reaction program for introducing mutations by PCR is as follows: 95°C for 10 min, 95°C for 30 s, 56°C for 30 s, 72°C for 4 min, and 31 cycles of 95°C for 30 s, 56°C for 30 s, 72°C for 4 min; continue to extend at 72°C for 5 min.

[0068] The PCR product is treated with Dpnl at 37°C for 3 hours, and after inactivation, transformed into E. coli BL21 (DE3) recipient bacteria, coated on LB solid plates containing a final concentration of 50 mg / L kanamycin, and cultured at 37°C for 12 hours. Randomly selected single colonies are sequenced and analyzed to confirm that each carbonyl reductase mutant and wet bacteria are obtained.

[0069] Mutant enzyme in which alanine at position 69 of the wild-type enzyme is mutated to lysine is denoted Mut-A69K, mutant enzyme in which alanine at position 69 of the wild-type enzyme is mutated to leucine is denoted Mut-A69L, mutant enzyme in which alanine at position 69 of the wild-type enzyme is mutated to aspartic acid is denoted Mut-A69D, and mutant enzyme in which alanine at position 69 of the wild-type enzyme is mutated to asparagine is denoted Mut-A69N. Mutant enzyme in which glycine at position 100 of the wild-type enzyme is mutated to glutamic acid is denoted Mut-A100E, mutant enzyme in which glycine at position 100 of the wild-type enzyme is mutated to serine is denoted Mut-A100S, mutant enzyme in which glycine at position 100 of the wild-type enzyme is mutated to lysine is denoted Mut-A100K, and mutant enzyme in which glycine at position 100 of the wild-type enzyme is mutated to asparagine is denoted Mut-A100N.

[0070] (3) The plasmid DNA containing the Mut-G100E gene is used as a template to introduce mutations by PCR, and the mutant primers are combined as follows (the positions marked with underlines are mutation sites):

[0071] A69N-G100E-F: 5'-AAAATGTTTAC AAC CTGTATGAAAGCCT-3';

[0072] A69N-G100E-R: 5'-GTAAACATTTTCACTATAGCTCAGATCAATGCTT-3'.

[0073] The PCR reaction program for introducing mutations by PCR is the same as in step (2), and the recombinant carbonyl reductase combination mutant Mut-A69N-G100E and wet bacteria are obtained.

[0074] (4) The plasmid DNA containing the Mut-G100N gene is used as a template to introduce mutations by PCR, and the mutant primers are combined as follows (the positions marked with underlines are mutation sites):

[0075] A69N-G100N-F-F: 5'-AAAATGTTTAC AAC CTGTATGAAAGCCT-3';

[0076] A69N-G100N-F-R: 5'-GTAAACATTTTCACTATAGCTCAGATCAATGCTT-3'.

[0077] The PCR reaction procedure for introducing mutations by PCR was the same as step (2), and a recombinant carbonyl reductase combined mutant Mut-A69N-G100N and its wet bacteria were obtained. The nucleotide sequence of the mutant Mut-A69N-G100N is shown in SEQ ID NO. 3, and the amino acid sequence is shown in SEQ ID NO. 4.

[0078] As shown in Figure 1 , it is the SDS-PAGE diagram of the wild-type carbonyl reductase and its mutants. Figure 1 In the figure, lane M is the protein molecular weight marker, lane 1 is the pure enzyme of the original strain WT of carbonyl reductase, lane 2 is the Mut-A69N pure enzyme, lane 3 is the Mut-G100N pure enzyme, and lane 4 is the Mut-A69N-G100N pure enzyme.

[0079] Example 2: Screening of high-thermal-stability carbonyl reductase mutants

[0080] The remaining enzyme activity of the carbonyl reductase mutants obtained in Example 1 was determined and analyzed, and the remaining enzyme activity was determined after incubation at 50°C for 1 h and at 55°C for 0.5 h, respectively, to establish the optimal mutant. The steps are as follows:

[0081] (1) Preparation of crude enzyme solution: the strain containing the gene encoding the carbonyl reductase mutant obtained in Example 1 was inoculated into LB liquid medium containing a final concentration of 50 mg / L kanamycin resistance, and cultured at 37°C, 200 rpm for 6-8 h, then inoculated into fresh LB liquid medium containing a final concentration of 50 mg / L kanamycin resistance at a volume concentration of 2% inoculation amount, and cultured at 37°C, 200 rpm for 2 h, then 100 µL of 0.1 M IPTG was added, and the culture was induced at 28°C, 200 rpm for 12 h, then centrifuged at 4°C, 8000 rpm for 15 min, and the supernatant was discarded, and the wet bacteria were collected. 125 mg of the wet bacteria of the mutant prepared was weighed, resuspended in 10 mL of potassium phosphate buffer, and sonicated under the condition of 4°C ice bath (220 W, 1 S, 2 S stop), and the broken crude enzyme solution was incubated at 50°C for 1 h and at 55°C for 0.5 h, respectively.

[0082] (2) 500 µL reaction system: 150 µL NADP +, 50 μL glucose, 50 μL of 50℃ incubation for 1 h of crude enzyme solution, 100 μL substrate (S)-amino ketone ester stock solution, complete to 500 μL with potassium phosphate buffer, 1100 rpm shaking, reaction in a shaking reactor at 35℃, sample immediately after 10 min reaction. The concentration of stock substrate (S)-amino ketone ester is 50 g / L (solvent is dimethyl sulfoxide), the concentration of stock co-substrate glucose is 180 g / L (solvent is potassium phosphate buffer), the concentration of stock coenzyme NADP + is 1 g / L (solvent is potassium phosphate buffer). The yield of (2S, 3R)-aminohydroxyl ester is determined by HPLC analysis and the relative enzyme activity is calculated. The initial enzyme activity of each mutant is set as 100%, and the residual enzyme activity after 1 h incubation at 50℃ is shown in Table 2.

[0083] (3) 500 μL reaction system: 150 μL NADP + , 50 μL glucose, 50 μL of 55℃ incubation for 0.5 h of crude enzyme solution, 100 μL substrate (S)-amino ketone ester stock solution, complete to 500 μL with potassium phosphate buffer, 1100 rpm shaking, reaction in a shaking reactor at 35℃, sample immediately after 10 min reaction. The concentration of stock substrate (S)-amino ketone ester is 50 g / L (solvent is dimethyl sulfoxide), the concentration of stock co-substrate glucose is 180 g / L (solvent is potassium phosphate buffer), the concentration of stock coenzyme NADP + is 1 g / L (solvent is potassium phosphate buffer). The yield of (2S, 3R)-aminohydroxyl ester is determined by HPLC analysis and the relative enzyme activity is calculated. The initial enzyme activity of each mutant is set as 100%, and the residual enzyme activity after 0.5 h incubation at 55℃ is shown in Table 2.

[0084] Table 2 residual enzyme activity comparison

[0085] Enzyme Residual enzyme activity (%) after 1 h incubation at 50 °C Residual enzyme activity (%) after 0.5 h incubation at 55 °C Wild type 1.69 - Mut-A69K 9.65 - Mut-A69L 12.36 1.29 Mut-A69D 15.46 1.18 Mut-A69N 28.36 7.66 Mut-G100E 75.36 26.62 Mut-G100S 30.93 21.56 Mut-G100K 58.19 15.65 Mut-G100N 81.99 49.17 Mut-A69N-G100E 77.37 55.14 Mut-A69N-G100N 88.11 66.97

[0086] From the determination results of residual enzyme activity in Table 2, it can be seen that the thermal stability of the carbonyl reductase is improved by the site-directed mutagenesis technology in Example 1, the optimal mutant of the single mutant is Mut-G100N, and the optimal mutant obtained after combination mutation of different mutation sites is Mut-A69N-G100N. In addition, the thermal stability of single mutants Mut-A69N and Mut-G100E is also good.

[0087] From the determination results of residual enzyme activity in Table 2, it can be seen that the thermal stability of the carbonyl reductase mutants Mut-A69N, Mut-G100N and Mut-A69N-G100N is greatly improved.

[0088] Example 3: Determination of the relative enzyme activity of carbonyl reductase mutants

[0089] The relative enzyme activity of the carbonyl reductase mutant obtained in Example 1 was determined. The steps are as follows:

[0090] (1) Preparation of crude enzyme solution: The method is the same as in Example 2.

[0091] (2) 500µL reaction system: 150µL NADP + 50 µL of glucose, 50 µL of crude enzyme solution incubated at 35 °C for 24 h, 100 µL of substrate (S)-amino ketone ester stock solution, and potassium phosphate buffer were added to bring the total volume to 500 µL. The mixture was shaken at 1100 rpm in a shaking reactor at 35 °C, and samples were taken immediately after 10 min of reaction. The concentration of substrate (S)-amino ketone ester in the stock solution was 50 g / L (solvent: dimethyl sulfoxide), the concentration of co-substrate glucose in the stock solution was 180 g / L (solvent: potassium phosphate buffer), and the concentration of coenzyme NADP in the stock solution was... + The concentration was 1 g / L (solvent was potassium phosphate buffer). The yield of (2S,3R)-aminohydroxy ester was determined by HPLC and the relative enzyme activity was calculated. The results are shown in Table 3.

[0092] Table 3 Comparison of relative enzyme activities

[0093] Enzyme Relative enzyme activity (%) Wild type 100.00 Mut-A69K 151.65 Mut-A69L 123.52 Mut-A69D 105.66 Mut-A69N 179.45 Mut-G100E 116.39 Mut-G100S 111.41 Mut-G100K 105.86 Mut-G100N 135.41 Mut-A69N-G100E 189.25 Mut-A69N-G100N 196.39

[0094] As shown in Table 3, the relative enzyme activity results indicate that Example 1 improved the stability of carbonyl reductase through site-directed mutagenesis. The relative enzyme activities of the mutants Mut-A69N, Mut-G100N, and Mut-A69N-G100N were significantly improved compared to the wild type.

[0095] Example 4: Application of carbonyl reductase mutant in the preparation of florfenicol intermediates

[0096] The single-point mutants Mut-A69N, Mut-G100N, and the combined mutant Mut-A69N-G100N, which exhibit superior thermal stability, were selected for the preparation of florfenicol intermediates. The specific steps are as follows:

[0097] The composition and catalytic conditions of the catalytic system are as follows:

[0098] In a 20 mL reaction system: add 100 mM potassium phosphate buffer solution (pH 7.0), 50% n-butyl acetate as a co-solvent, crude carbonyl reductase solution (20 g / L, prepared in the same way as in Example 2), glucose dehydrogenase (10 g / L), 200 mM glucose, and NADP. +2 g / L, substrate 2-acetamido-3-(4-(methylsulfonyl)phenyl)-3-oxopropanoic acid methyl ester 100 g / L, complete to 20 mL with potassium phosphate buffer.

[0099] The reaction system was placed in a 35 °C water bath, magnetic stirring device 600 rpm, reaction for 24 h. During the reaction, sample was taken at regular intervals, sample volume 200 μL, after separation and purification, diluted 100 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0100] The results showed that after 24 h of catalysis, the yield of (2S, 3R)-2-acetamido-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propanoic acid methyl ester produced by WT catalysis reached 72.2%, e.e.>99%; Mut-A69N reached 92.9%, e.e.>99%; Mut-G100N reached 95.2%, e.e.>99%; Mut-A69N-G100N reached 99.7%, e.e.>99%.

[0101] Example 5: Application of carbonyl reductase mutants in the preparation of duloxetine intermediates

[0102] Single-point mutants Mut-A69N, Mut-G100N with better thermal stability and combined mutant Mut-A69N-G100N were selected for the preparation of duloxetine intermediates. The specific steps are as follows:

[0103] The composition of the catalytic system and the catalytic conditions are as follows:

[0104] 20 mL reaction system: crude enzyme solution (preparation method same as example 2) 20 g / L, substrate KEES 150 g / L, cosolvent n-butyl acetate (amount 50%), co-substrate glucose 100 mM (solvent potassium phosphate buffer), glucose dehydrogenase (amount 10 g / L), coenzyme NADP + 3 g / L (solvent potassium phosphate buffer). Complete to 20 mL with potassium phosphate buffer.

[0105] The reaction system was placed in a 35 °C water bath, magnetic stirring device 600 rpm, reaction for 24 h. During the reaction, sample was taken at regular intervals, sample volume 200 μL, after separation and purification, diluted 100 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0106] The results show that after 24 h of catalysis, the yield of (S)-HEES produced by WT catalysis reaches 78.5%, e.e.>99%; Mut-A69N reaches 90.31%, e.e.>99%; Mut-G100N reaches 90.3%, e.e.>99%; Mut-A69N-G100N reaches 98.6%, e.e.>99%.

[0107] Example 6: Application of carbonyl reductase mutants in the preparation of rosuvastatin intermediates

[0108] The single-point mutants Mut-A69N, Mut-G100N with better thermal stability and the combined mutant Mut-A69N-G100N are selected for application in the preparation of rosuvastatin intermediates. The specific steps are as follows:

[0109] The composition of the catalytic system and the catalytic conditions are as follows:

[0110] 20 mL reaction system: crude enzyme solution (preparation method is the same as that of Example 2) is weighed at 20 g / L, substrate (S)-CHOH is 150 g / L, cosolvent n-butyl acetate (amount is 50%), auxiliary substrate glucose is 100 mM (solvent is potassium phosphate buffer), glucose dehydrogenase (amount is 10 g / L), coenzyme NADP + is 3 g / L (solvent is potassium phosphate buffer). Potassium phosphate buffer is used to complete to 20 mL.

[0111] The reaction system is placed in a 35°C water bath, and the magnetic stirring device is 600 rpm. Reaction is sampled at 24 h, and the sampling volume is 200 μL. After separation and purification, it is diluted by 40 times with 30% acetonitrile, and the conversion rate is determined by HPLC analysis.

[0112] The results show that after 24 h of catalysis, the yield of (S)-HEES produced by WT catalysis reaches 78.5%, e.e.>99%; Mut-A69N reaches 90.31%, e.e.>99%; Mut-G100N reaches 90.3%, e.e.>99%; Mut-A69N-G100N reaches 98.6%, e.e.>99%.

[0113] Example 7: Application of carbonyl reductase mutants in the preparation of atorvastatin intermediates

[0114] The single-point mutants Mut-A69N, Mut-G100N with better thermal stability and the combined mutant Mut-A69N-G100N are selected for application in the preparation of atorvastatin intermediates. The specific steps are as follows:

[0115] The composition of the catalytic system and the catalytic conditions are as follows:

[0116] 20 mL reaction system: crude enzyme solution (preparation method is the same as example 2) 20 g / L, substrate 6-cyano-5(R)-hydroxy-3-oxohexanoic acid tert-butyl ester 150 g / L, cosolvent n-butyl acetate (amount 50%), auxiliary substrate glucose 100 mM (solvent is potassium phosphate buffer), glucose dehydrogenase (amount 10 g / L), coenzyme NADP + 3 g / L (solvent is potassium phosphate buffer). Use potassium phosphate buffer to complete to 20 mL.

[0117] Put the reaction system in a 35 ℃ water bath, magnetic stirring device 600 rpm, reaction 24 h reaction sampling, sampling volume 200 μL, after separation and purification, dilute 100 times with acetonitrile, and determine the conversion rate by HPLC analysis. The results show that after 24 h of catalysis, the yield of (3R, 5R)-6-cyano-3, 5-dihydroxyhexanoic acid tert-butyl ester produced by WT catalysis reaches 71.9%, e.e.> 99%; Mut-A69N reaches 79.2%, e.e.> 99%; Mut-G100N reaches 80.1%, e.e.> 99%; Mut-A69N-G100N reaches 93.8%, e.e.> 99%.

[0118] Example 8: Application of carbonyl reductase mutants in preparation of vibunol intermediate

[0119] Select single-point mutants Mut-A69N, Mut-G100N and combined mutant Mut-A69N-G100N with better thermal stability for application in preparation of vibunol intermediate. The specific steps are as follows:

[0120] The composition of the catalytic system and the catalytic conditions are as follows:

[0121] 20 mL reaction system: dissolve the substrate (S)-aminoketone ester in 10 mL n-butyl acetate (final concentration 100 g / L), add 1 mL of 0.1 mM NaH2PO4-Na2HPO4 buffer solution with pH 6.5-7.0, add crude enzyme solution (final concentration 20 g / L, preparation method is the same as example 2), add 2 mL of crude enzyme solution of glucose dehydrogenase (final concentration 10 g / L), add 100 mg of coenzyme NADPH, and add 1.774 g of auxiliary substrate glucose. Use potassium phosphate buffer to complete to 20 mL.

[0122] Put the reaction system in a 35 ℃ water bath, magnetic stirring device 600 rpm, reaction sampling, sampling volume 200 μL, after separation and purification, dilute 100 times with pure acetonitrile, and determine the conversion rate by HPLC analysis.

[0123] The results show that after 24 h of catalysis, the yield of (2S, 3R)-aminohydroxy ester produced by WT catalysis reaches 92.0%, e.e. >99%; Mut-A69N reaches 96.6%, e.e. >99%; Mut-G100N reaches 94.5%, e.e. >99%; Mut-A69N-G100N reaches 99.9%, e.e. >99%.

[0124] Example 9: Effect of fed-batch process on carbonyl reductase mutant for preparing vibegron intermediate

[0125] The single-point mutants Mut-A69N, Mut-G100N with better thermal stability and the combined mutant Mut-A69N-G100N were selected for application in the fed-batch process for preparing vibegron intermediate. The specific steps are as follows:

[0126] (1) 20 mL reaction system: dissolve the substrate (S)-aminoketo ester in 10 mL n-butyl acetate (final concentration 80 g / L), add 1 mL of 0.1 mM, pH 6.5 NaH2PO4-Na2HPO4 buffer solution, add crude enzyme solution (final concentration 20 g / L), add glucose dehydrogenase (final concentration 10 g / L), add 100 mg of coenzyme NADPH, and add 1.774 g of auxiliary substrate glucose. Use potassium phosphate buffer to complete to 20 mL.

[0127] Place the reaction system in a 35 °C water bath, and use a magnetic stirring device at 600 rpm. After 8 h, add 1.4 g of substrate (total substrate concentration after feeding is 150 g / L). Take samples at regular intervals, and dilute 150 times with pure acetonitrile after separation and purification. Determine the conversion rate by HPLC analysis.

[0128] The results show that after 24 h of catalysis, the yield of (2S, 3R)-aminohydroxy ester produced by WT catalysis reaches 92.0%, e.e. >99%; Mut-A69N reaches 96.6%, e.e. >99%; Mut-G100N reaches 94.5%, e.e. >99%; Mut-A69N-G100N reaches 99.9%, e.e. >99%.

[0129] (2) 500 mL reaction system: dissolve the substrate (S)-aminoketo ester in 10 mL n-butyl acetate ((S)-aminoketo ester final concentration 80 g / L), add crude enzyme solution (final concentration 20 g / L), add glucose dehydrogenase (final concentration 10 g / L), add 3.0 g of coenzyme NADPH, and add 35.5 g of auxiliary substrate glucose. Use potassium phosphate buffer to complete to 500 mL.

[0130] The reaction system was placed in a 35℃ water bath, the stirring device was set to 600 rpm, 35 g of the substrate was added after 8 h (the total concentration of the substrate after the addition was 150 g / L), reaction timing sampling was performed, the sampling volume was 200 μL, after separation and purification, the sample was diluted 150 times with pure acetonitrile, and the conversion rate was determined by HPLC analysis.

[0131] The results show that after 24 h of catalysis, the yield of (2S, 3R)-aminohydroxy ester produced by WT catalysis reaches 94.5%, e.e.>99%; Mut-A69N reaches 98.9%, e.e.>99%; Mut-G100N reaches 98.6%, e.e.>99%; and Mut-A69N-G100N reaches 99.9%, e.e.>99%.

[0132] Compared with the non-supplemental process, the supplemental process further improves the production efficiency.

[0133] The raw materials and equipment used in the present application are conventional raw materials and equipment in the art unless otherwise specified; the methods used in the present application are conventional methods in the art unless otherwise specified.

[0134] The above is only a preferred embodiment of the present application, and does not limit the present application in any way, and any simple modification, change and equivalent transformation of the above embodiment according to the technical essence of the present application still belongs to the protection scope of the technical solution of the present application.

Claims

1. A carbonyl reductase mutant, characterized in that The carbonyl reductase mutant is obtained by single-point mutation or multi-point combined mutation of the 69th and 100th amino acids in the amino acid sequence shown in SEQ ID NO.

2.

2. The carbonyl reductase mutant of claim 1, wherein The mutation is one or a combination of the following two: (1) the 69th alanine is mutated into any one of lysine, leucine, aspartic acid and asparagine; (2) the 100th glycine is mutated into any one of glutamic acid, serine, lysine and asparagine.

3. The carbonyl reductase mutant of claim 2, wherein The mutant is one of the following: (a) the 69th alanine in the amino acid sequence shown in SEQ ID NO. 2 is mutated into asparagine; (b) the 100th glycine in the amino acid sequence shown in SEQ ID NO. 2 is mutated into asparagine; (c) the 69th alanine in the amino acid sequence shown in SEQ ID NO. 2 is mutated into asparagine, and the 100th glycine is mutated into asparagine.

4. The carbonyl reductase mutant of claim 3, wherein The carbonyl reductase mutant is obtained by mutating the 69th alanine in the amino acid sequence shown in SEQ ID NO. 2 into asparagine, and mutating the 100th glycine into asparagine.

5. A gene encoding the carbonyl reductase mutant according to any one of claims 1-4.

6. A recombinant vector containing the gene encoding the carbonyl reductase mutant according to claim 5.

7. A recombinant genetically engineered bacterium containing the gene encoding the carbonyl reductase mutant constructed by the recombinant vector according to claim 6.

8. Use of the carbonyl reductase mutant according to any one of claims 1-4 in the synthesis of chiral alcohol, which is a duloxetine intermediate, florfenicol intermediate, rosuvastatin intermediate, atorvastatin intermediate or vibegron intermediate.

9. Use according to claim 8, wherein The method of the use is: using wet bacterium, crude enzyme solution after wet bacterium crushing or pure enzyme extracted from genetically engineered bacterium containing the gene encoding the carbonyl reductase mutant as catalyst, and using chiral ketone as substrate to perform biological catalytic reaction, thereby obtaining the corresponding chiral alcohol; the chiral ketone is S )-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropionic acid methyl ester, florfenicol intermediate (2 S )-6-chloro-5-hydroxy-3-oxohexanoic acid tert-butyl ester (3 S )-CHOH), 6-cyano-5 R )-hydroxy-3-oxohexanoic acid tert-butyl ester, the corresponding chiral alcohol is vibegron intermediate (2 S ,3 R )-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropionic acid methyl ester, florfenicol intermediate (2 S ,3 R )-2-acetamido-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propionic acid methyl ester, duloxetine intermediate (3 S )-3-hydroxy-3-(2-thienyl)propionic acid ethyl ester, rosuvastatin intermediate (3 R ,5 S )-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester, atorvastatin intermediate (3 R ,5 R )-6-cyano-3,5-dihydroxyhexanoic acid tert-butyl ester.

10. A method for the enzymatic synthesis of a chiral alcohol, characterized in that The method is: using wet bacterium, crude enzyme solution after wet bacterium crushing or pure enzyme extracted from genetically engineered bacterium containing the gene encoding the carbonyl reductase mutant according to any one of claims 1-4 as catalyst, and using chiral ketone as substrate to perform biological catalytic reaction, thereby obtaining the corresponding chiral alcohol; the chiral ketone is S )-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropionic acid methyl ester, florfenicol intermediate (2 S )-6-chloro-5-hydroxy-3-oxohexanoic acid tert-butyl ester S )-CHOH), 6-cyano-5 R )-hydroxy-3-oxohexanoic acid tert-butyl ester, the corresponding chiral alcohol is vibegron intermediate (2 S ,3 R )-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropionic acid methyl ester, florfenicol intermediate (2 S ,3 R )-2-acetamido-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propionic acid methyl ester, duloxetine intermediate (3 S )-3-hydroxy-3-(2-thienyl)propionic acid ethyl ester, rosuvastatin intermediate (3 R ,5 S )-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester, atorvastatin intermediate (3 R ,5 R )-6-cyano-3,5-dihydroxyhexanoic acid tert-butyl ester.

Images