DsRNA (double-stranded ribonucleic acid) for increasing amylose content of wheat as well as synthesis method and application of dsRNA
By designing dsRNA targeting the SBEIIb gene and spraying it onto wheat plants, the problem of increasing the amylose content in wheat using traditional breeding methods was solved, achieving efficient and low-cost quality improvement.
Patent Information
- Application Number
- CN202510966073.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-14
- Publication Date
- 2025-12-05
AI Technical Summary
Existing technologies are not efficient and simple to increase the amylose content of wheat. Traditional breeding methods are time-consuming and unstable, and dsRNA technology has not been applied in wheat quality improvement.
We designed dsRNA to target the SBEIIb gene, constructed a recombinant vector and extracted dsRNA using SDS thermal lysis, sprayed it onto wheat plants to silence the SBEIIb gene, and combined this with nanocarrier technology to enhance RNA stability.
It significantly increases the amylose content of wheat, is simple to operate, low in cost, and is suitable for wheat trait improvement and new resource creation.
Smart Images
Figure CN121065175A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of wheat quality improvement, in particular to a dsRNA for increasing the amylose content of wheat and a synthesis method and application thereof. BACKGROUND
[0002] Wheat is one of the three major crops in the world, and is the core source of human dietary energy and nutrition. Its kernel is mainly composed of three parts: endosperm (about 83%), germ and bran, among which the endosperm is rich in carbohydrates (mainly starch), proteins, a small amount of fat, vitamins and minerals. Starch accounts for 65-75% of the dry weight of the endosperm and is the core component of energy storage, and its molecular structure directly affects the food processing characteristics and nutritional function. Wheat starch is mainly composed of two polysaccharides, amylose and amylopectin, and the ratio is usually 20-30%:70-80%. The structural differences between the two result in different physicochemical properties and application values.
[0003] Amylose is linearly connected by hundreds to thousands of glucose units through α-1,4 glycosidic bonds, with a low molecular weight (about 10 5 ~ 10 6 Da), and is tightly arranged in a spiral shape. Its linear structure makes it easy to combine between molecular chains through hydrogen bonds, forming a dense crystalline region, so it has the following characteristics: high gelatinization temperature (about 80-85℃); strong gel stability; easy to retrograde (ageing) and the like. The main chain of amylopectin is connected by α-1,4 glycosidic bonds, and every 20-25 glucose units is branched out by a short chain through α-1,6 glycosidic bonds, forming a highly branched structure with a very high molecular weight (about 10 7 ~ 10 8 Da). Its branching characteristics bring significant functional differences: low gelatinization temperature (about 55-65℃); strong water retention and anti-aging properties; rapid digestibility and the like. The ratio of amylose and amylopectin directly affects the quality and nutrition of wheat products. High amylopectin is suitable for baked goods, giving a fluffy texture; high amylose is used for products such as noodles that require toughness; amylose is slowly digested, which can reduce the glycemic index (GI) and partially convert to resistant starch, promoting intestinal health; amylopectin provides rapid energy, suitable for high-intensity activities.
[0004] There are many studies on the function and application of wheat SBEII s gene. SBEII s regulates the synthesis of amylose in crops, significantly affecting the physicochemical properties and nutritional function of starch. In maize, knocking out SBEIIb gene using CRISPR / Cas9 can increase the content of amylose and resistant starch, which is suitable for the development of low glycemic index (GI) food; in wheat, knocking out SBEIIa gene can increase the content of resistant starch and improve the nutritional and health functions; in potato, by optimizing the gene editing strategy, the potential of regulating starch synthesis is demonstrated. The advantage of gene editing technology is high efficiency, precision and directional improvement, but its application still faces the trade-off between yield and agronomic traits, such as corn kernel shrinkage, plant height reduction and technical complexity.
[0005] In addition, in traditional wheat amylose directional improvement breeding, mainly through hybridization and backcross breeding, but due to the instability of offspring separation, long cycle and linkage of unfavorable genes, it is difficult to breed excellent varieties with high amylose content.
[0006] Double-stranded RNA (dsRNA) technology is widely used in agriculture for pest control and virus prevention. It can precisely inhibit the key physiological functions of pests or pathogens through RNA interference (RNAi) mechanism targeting specific genes. For example, in cotton bollworm control, transgenic cotton expressing dsRNA targeting juvenile hormone synthesis genes can significantly inhibit larval development and reduce the use of chemical pesticides; in aphid control, phloem-specific delivery of dsRNA can interfere with its feeding behavior and improve crop resistance. The advantages of dsRNA technology include high targeting, environmental friendliness and resistance delay, and combined with nano-carrier technology can enhance RNA stability and delivery efficiency, providing an innovative solution for green and sustainable agriculture. At present, domestic and foreign scholars have used dsRNA technology to protect plants from pests and diseases, which is considered a new type of biological pesticide, but there is no report on improving wheat quality based on dsRNA technology. SUMMARY
[0007] The present application provides a dsRNA for increasing the content of wheat amylose, as well as its synthesis method and application, to improve the quality of wheat by dsRNA technology.
[0008] In order to achieve the above object, the specific scheme adopted by the present application is: a dsRNA for increasing the content of wheat amylose, the dsRNA is transcribed from a sequence fragment of SBEIIb gene, the sequence fragment is at least one of SBE1, SBE2, SBE3 and SBE4; the sequence of SBE1 is shown as SEQ ID NO. 1, the sequence of SBE2 is shown as SEQ ID NO. 2, the sequence of SBE3 is shown as SEQ ID NO. 3, and the sequence of SBE4 is shown as SEQ ID NO. 4.
[0009] A synthesis method of the dsRNA for increasing the content of wheat amylose, comprising the following steps:
[0010] S1, selecting an interference target point in the SBEIIb gene, the sequence fragment of the interference target point is at least one of SBE1, SBE2, SBE3 and SBE4;
[0011] S2, constructing a recombinant vector containing the interference target point;
[0012] S3, extracting the dsRNA by SDS heat lysis method.
[0013] As a further optimization of the above technical scheme, the construction step of the recombinant vector is:
[0014] S201, taking pET28a as the initial vector, removing the RBS-containing fragment by enzyme digestion, inserting a 113bp sequence containing an inverted T7 promoter and a multiple cloning site to obtain a dsRNA expression vector;
[0015] S202, using the cDNA of wheat leaves or grains as a template, amplifying the DNA fragment corresponding to the interference target point by PCR;
[0016] S203, double enzyme digestion and ligation of the DNA fragment and the dsRNA expression vector, and then transforming E. coli DH5α to obtain a recombinant vector containing the interference target point.
[0017] As a further optimization of the above technical scheme, in step S201, the restriction endonuclease Xba I and Xho I are used to remove the RBS-containing fragment.
[0018] As a further optimization of the above technical scheme, in step S203, the DNA fragment and the dsRNA expression vector are double enzyme digested with restriction endonuclease Xba I and Sal I.
[0019] As a further optimization of the above technical scheme, in step S3, the bacterial liquid containing the recombinant vector is centrifuged at 12000 rpm for 2 min, the precipitate is resuspended with 1mL 0.2% SDS solution, incubated at 80℃ for 10 min, and the supernatant is taken after centrifugation again.
[0020] The application of a dsRNA in increasing the amylose content of wheat.
[0021] As a further optimization of the above technical solution, the dsRNA is sprayed on the wheat plant from the flowering stage.
[0022] As a further optimization of the above technical solution, the dsRNA is sprayed on the wheat plant from the flowering stage.
[0023] As a further optimization of the above technical solution, the dsRNA is sprayed on the wheat plant from the flowering stage.
[0024] Compared with the prior art, the present application has the following beneficial effects:
[0025] The present application provides a dsRNA for increasing the amylose content of wheat, by spraying the dsRNA on the wheat plant at the flowering stage, the SBEIIb gene of the wheat is silenced, thereby cultivating a new resource of wheat with significantly increased amylose, which has great application value in the field of wheat molecular breeding. The method has the advantages of simple operation, high interference efficiency and low cost, and can be widely applied in wheat trait improvement and new resource creation. BRIEF DESCRIPTION OF DRAWINGS
[0026] Figure 1 It is a construction process of a dsRNA expression vector;
[0027] Figure 2 It is a pRNAi-SBEs-dsRNA expression vector map;
[0028] Figure 3 It is the extraction and verification of dsRNA; 1, dsTaSBE1 obtained by thermal lysis method; 2, dsTaSBE2 obtained by thermal lysis method; 3, dsTaSBE3 obtained by thermal lysis method; 4, dsTaSBE4 obtained by thermal lysis method; 5, dsTaSBE1 after double enzyme digestion; 6, dsTaSBE2 after double enzyme digestion; 7, dsTaSBE3 after double enzyme digestion; 8, dsTaSBE4 after double enzyme digestion;
[0029] Figure 4 It is the amylose content of wheat leaves and the expression level of starch synthesis related genes; wherein, Figure A: amylose standard curve established by perchloric acid method; Figure B: amylose content in wheat leaves; Figure C: relative expression level of TaSBEIIb1 gene; Figure D: relative expression level of TaSBEIIa1 gene; Figure E: relative expression level of TaSSII gene; Figure F: relative expression level of TaSSIV gene; Different letters on the top of the column chart represent significant differences (p<0.05) between the values;
[0030] Figure 5Figure A: amylose standard curve established by iodine binding method; Figure B: amylose content in wheat grains; Figure C: amylose content in wheat grains after spraying naked dsRNA; Figure D: amylose content in wheat grains after spraying dsRNA-HACC nanocomposites; Different letters on the column chart represent significant differences (p < 0.05) between values. DETAILED DESCRIPTION
[0031] The technical solutions of the present application will be further described in detail below in combination with specific examples. Parts not described and disclosed in detail in the following examples of the present application should be understood as known or should be known by those skilled in the art. In the following genes or dsRNAs, "Ta" is the abbreviation of "Triticum aestivum", representing wheat.
[0032] Example 1
[0033] A dsRNA for increasing the amylose content of wheat, the dsRNA being transcribed from a sequence fragment of SBEIIb gene, the sequence fragment being at least one of SBE1, SBE2, SBE3 and SBE4, the sequence of SBE1 being as shown in SEQ ID NO. 1, the sequence of SBE2 being as shown in SEQ ID NO. 2, the sequence of SBE3 being as shown in SEQ ID NO. 3, and the sequence of SBE4 being as shown in SEQ ID NO. 4.
[0034] The SBE1 sequence (SEQ ID NO. 1) is: GACCTCCATGATGTATACCCACCATGGATTACAAGTAACCTTTACAGGGA GCTACCATGAATACTTTGGCTTTGCCACTGATGTAGATGCGGTCGTTTACT TGATGCTGGTGAATGATCTAATTCATGGGTTTTATCCCGAAGCGGTAACTA TCGGTGAAGATGTTAGTGGAATGCCTACATTTGCCCTTCCTGTTCAAGTTG GTGGAGTTGGTTTTGACTATCGCTTACATATGGCTGTTGCCGACAAATGGA TTGAACTTCTCAAAGGAAATGATGAAGCTTGGGAGATGGGTAATATTGTG CACACACTAACAAATAGAAGGTGGTTGGAAAAGTGTGTTACTTATGCTGA AAGTCACGATCAAGCACTGGTTGGAGACAAGACTATTGCATTCTGGTTGATGGACAAGGATATGTATGATTTCATGGCTCT.
[0035] The SBE2 sequence (SEQ ID NO. 2) is: ATAATGGCAATCCAAGAGCACTCATACTATGGAAGCTTTGGGTACCATGT TACCAATTTCTTTGCACCAAGTAGCCGTTTTGGGTCCCCAGAAGATTTAAA ATCTTTGATTGATAGAGCTCACGAGCTTGGCTTGGTTGTCCTCATGGATGT TGTTCACAGTCACGCGTCAAATAATACCTTGGACGGGTTGAATGGTTTTGA TGGCACGGATACACATTACTTTCATGGCGGTTCACGGGGCCATCATTGGA TGTGGGATTCCCGTGTGTTCAACTACGGGAATAAGGAAGTTATAAGGTTT CTACTTTCCAATGCAAGATGGTGGCTAGAGGAGTATAAGTTTGATGGTTTC CGATTCGACGGCGCGACCTCCATGATGTATACCCACCATGGATTACAAGTAACCTTTACAGGGAGCTACCATG.
[0036] The SBE3 sequence (SEQ ID NO. 3) is: GCGGTTACGAGAAGTTTGGATTTGTGCGCAGCGCTGAAGGTATCACTTAC CGAGAATGGGCTCCTGGAGCAGATTCTGCAGCATTAGTTGGCGACTTCAA CAATTGGGATCCAAATGCAGACCATATGAGCAAAAATGACTTGGGTATTT GGGAGATTTTTCTGCCAAACAATGCAGACGGTTCGCCACCAATTCCTCAC GGCTCACGGGTGAAGGTGCGAATGGGTACTCCATCTGGGACAAAGGATTC AATTCCTGCTTGGATCAAGTACTCCGTGCAGACTCCAGGAGATATACCAT ACAATGGAATATATTATGATCCTCCCGAAGAGGAGAAGTATGTATTCAAG CATCCTCAACCTAAACGACCAAAATCATTGCGGATATATGAAACACATGT TGGCATGAGTAGCCCGGAACCAAAGATCAACACATATGCAAACTTTCGGGATGAGGTGC。
[0037] The SBE4 sequence (SEQ ID NO.4) is as follows: TCGGAGGTTCTGGATGGCGCGTGGTCATGCGCGCGGGTGGGCCGTCCGGG GAGGTGATGATCCCTGACGGCGGTAGTGGCGGAACACCGCCTTCCATCGA CGGTCCCGTTCAGTTCGACTCTGATGATCTGAAGGTTCCATTCATCGATGA TGAAACAAGCCTACAGGATGGAGGTGAAGATACTATTTGGTCTTCAGAGA CAAATCAGGTTACTGAAGAAATTGATGCTGAAGGCACGAGCAGAATGGA CAAAGAATCATCTACGGGAGAGAAATTACGCATTCTGCCACCACCGGGAA ATGGACAGCAAATATACGAGATTGACCCAACGCTCCGAGACTTTAAGTAC CATCTTGAGTATCGATACAGCCTATATAGGAGAATACGTTCAGACATTGATGAACACAAAGGAGGCATGGAT。
[0038] Example 2
[0039] A method for synthesizing dsRNA to increase the amylose content of wheat, comprising the following steps:
[0040] S1. Sequences at multiple different sites in the SBEIIb gene were selected as interference targets. There were four interference targets: SBE1, SBE2, SBE3, and SBE4. The sequence of SBE1 is shown in SEQ ID NO.1, the sequence of SBE2 is shown in SEQ ID NO.2, the sequence of SBE3 is shown in SEQ ID NO.3, and the sequence of SBE4 is shown in SEQ ID NO.4.
[0041] The specific steps are as follows: The SBEIIa / b gene, which is highly expressed in wheat seeds, was selected as the target gene. The CDS sequences of four genes, SBEIIa1, SBEIIa2, SBEIIb1, and SBEIIb2, were found in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ). The similarity analysis of the four CDS sequences was performed using DNAMAN software. It was found that the SBEIIb1 gene had the highest similarity to the three genes SBEIIa1, SBEIIa2, and SBEIIb2. Finally, four sequences at different sites in the SBEIIb1 gene were selected as interference targets.
[0042] S2. Construct a recombinant vector containing the interference target;
[0043] S201. Using vector pET28a as the initial backbone, the redundant fragment including RBS is removed with restriction endonucleases Xba I and Xho I. Simultaneously, a 113bp gene sequence containing inverted T7 and multiple cloning sites is inserted to construct the dsRNA expression vector, denoted as pRNAi. Figure 1 As shown.
[0044] S202. Using wheat leaf or grain cDNA as a template, PCR was used to amplify the DNA fragments corresponding to SBE1, SBE2, SBE3 and SBE4.
[0045] The primer sequences used for PCR amplification include:
[0046] SBE1-F: CTAGTCTAGAGACCTCCATGATGTATACCCACCA
[0047] SBE1-R:ACGCGTCGACAGAGCCATGAAATCATACATATCCTT
[0048] SBE2-F:CTAGTCTAGAATAATGGCAATCCAAGAG
[0049] SBE2-R:ACGCGTCGACCATGGTAGCTCCCTGTAA
[0050] SBE3-F: CTAGTCTAGAGCGGTTACGAGAAGTTTG
[0051] SBE3-R:ACGCGTCGACGCACCTCATCCCGAAAGT
[0052] SBE4-F: CTAGTCTAGATCGGAGGTTCTGGATGGC
[0053] SBE4-R:ACGCGTCGACATCCATGCCTCCTTTGTG
[0054] S203. The DNA fragment and pRNAi vector were double-digested with restriction endonucleases Xba I and Sal I, ligated, and transformed into E. coli DH5α to obtain recombinant vectors pRNAi-SBE1, pRNAi-SBE2, pRNAi-SBE3, and pRNAi-SBE4.
[0055] Specifically, four DNA fragments and the pRNAi vector were digested and ligated. The target bands were recovered via gel digestion based on their size and position. Simultaneously, the pRNAi vector was double-digested. The target fragments and digested pRNAi plasmids were recovered via gel digestion. The appropriate ratio was calculated using the T4 ligation system ratio formula, and the ligation reaction was performed. After the reaction, the cells were transformed into competent *E. coli* DH5α cells. Positive bacterial cultures were obtained through sequencing, and plasmids were extracted to construct four recombinant vectors: pRNAi-SBE1, pRNAi-SBE2, pRNAi-SBE3, and pRNAi-SBE4. Figure 2 As shown.
[0056] Four recombinant vectors, pRNAi-SBE1, pRNAi-SBE2, pRNAi-SBE3, and pRNAi-SBE4, were transformed into expression strain HT115, and positive bacterial cultures were obtained by PCR verification and sequencing.
[0057] S3. Extract dsRNA using the SDS thermal lysis method.
[0058] The specific steps are as follows: Transfer 1 mL of bacterial culture to a 2 mL centrifuge tube, centrifuge at 12000 rpm for 2 minutes, and discard the supernatant. Resuspend the precipitate in 1 mL of 0.2% SDS aqueous solution, incubate at 80℃ for 10 min, centrifuge at 12000 rpm for 5 min, transfer the supernatant to a new centrifuge tube, and perform electrophoresis on a 0.8% agarose gel using 5 μL. Verify dsRNA expression by digestion with DNase I and RNaes I enzymes. The results are as follows. Figure 3 As shown. dsRNAs include ds-SBE1, ds-SBE2, ds-SBE3, and ds-SBE4.
[0059] Example 3
[0060] The amylose content in wheat leaves was measured after spraying wheat plants with ds-SBE1, ds-SBE2, ds-SBE3, and ds-SBE4.
[0061] The amylose content in wheat leaves reached its highest level on the seventh day, with an increase of about 5% compared to the control.
[0062] The expression levels of the wheat starch branching enzyme TaSBEIIb1 gene were determined by qRT-PCR at days 1, 3, and 7 after interference with ds-SBE1, 2, 3, and 4. The interference efficiency was calculated. Compared with the control, spraying with ds-SBE1, ds-SBE2, ds-SBE3, and ds-SBE4 interfered with the relative expression of TaSBEIIb, TaSSII, TaSSIV, and TaSBEIIa1 in starch synthesis, with the highest interference efficiency for TaSBEIIb1 gene on day 7. Simultaneously, interference with TaSBEIIb also affected the expression of other genes involved in starch synthesis, such as TaSSII, TaSSIV, and TaSBEIIa1 genes, with the highest interference efficiency on days 3, 7, and 3, respectively. Results are as follows: Figure 4 As shown.
[0063] Example 4
[0064] An application of dsRNA in increasing the amylose content of wheat is described. The application method involves spraying dsRNA onto wheat plants starting from the flowering stage to increase the amylose content of wheat grains.
[0065] In 2023, ds-SBE1, ds-SBE2, ds-SBE3 and ds-SBE4 were sprayed on wheat fields in Menlou Village, Zhongyuan District, Zhengzhou City, Henan Province. The wheat variety tested was Zhengmai 16, a commonly grown wheat variety in the area.
[0066] The specific steps are as follows:
[0067] Solution preparation: During the wheat flowering stage, take a solution with a concentration of 0.2 mg / mL. -1 An aqueous solution of dsRNA (one of ds-SBE1, ds-SBE2, ds-SBE3 or ds-SBE4) was prepared, and Silwet L-77 was added to it to make the concentration of Silwet L-77 in the aqueous solution 0.2%. The solution was stirred thoroughly to ensure that the two were fully mixed and that the solution was homogeneous and stable.
[0068] Spraying preparation: Using a calibrated sprayer, calculate and measure the required volume of dsRNA solution based on the dosage of 2g dsRNA per acre, and pour the solution into the sprayer's reservoir.
[0069] Field spraying: Choose a sunny, windless or light-winded day (wind force not exceeding level 2) for spraying operations. Spray at a uniform speed and pressure to ensure that the wheat plants in the field are evenly sprayed and avoid missed spraying or repeated spraying.
[0070] Follow-up management: Repeat the above steps once, with a one-week interval between the two sprays.
[0071] Wheat samples sprayed with dsRNA were ground up, and samples without dsRNA spraying were used as controls for the determination and statistical analysis of amylose content.
[0072] The results are as follows Figure 5 As shown in B, in the field trial in 2023, spraying dsRNA promoted the increase of wheat amylose in the early stage, but the effect gradually weakened as the wheat matured.
[0073] Example 5
[0074] An application of dsRNA in increasing the amylose content of wheat was described. The method involved adding chitosan quaternary ammonium salt (HACC) to a prepared dsRNA aqueous solution during the wheat flowering stage to coat the dsRNA. The coated dsRNA solution was then sprayed onto a wheat experimental field once a week, eventually yielding mature wheat. Coating dsRNA with chitosan quaternary ammonium salt (HACC) extended its stability time.
[0075] In 2024, naked dsRNA and dsRNA-HACC nanocomposites were sprayed on wheat plants in Nanfan Village, Yuanmou County, Chuxiong Yi Autonomous Prefecture, Yunnan Province, during their flowering stage. The naked dsRNA consisted of ds-SBE1, ds-SBE2, ds-SBE3, and ds-SBE4; the dsRNA-HACC nanocomposites were dsRNA coated with chitosan quaternary ammonium salts, including ds-SBE1-HACC, ds-SBE2-HACC, ds-SBE3-HACC, and ds-SBE4-HACC. The tested wheat variety was the locally grown Nongmai 482.
[0076] The application of the dsRNA-HACC nanocomposite includes the following steps:
[0077] Solution preparation: During the wheat flowering stage, take a solution with a concentration of 0.2 mg / mL. -1 An aqueous solution of dsRNA (selected from ds-SBE1, ds-SBE2, ds-SBE3, or ds-SBE4) was prepared, and Silwet L-77 and chitosan quaternary ammonium salt HACC were added to it. The addition amounts were controlled to ensure that the concentration of Silwet L-77 in the aqueous solution was 0.2% and the concentration of chitosan quaternary ammonium salt HACC was 1%. The solution was stirred thoroughly to ensure uniformity and stability. It should be noted that during the solution preparation process, a concentration of 1% HACC is sufficient to complete the coating of dsRNA, resulting in a dsRNA-HACC nanocomposite.
[0078] Spraying preparation: Using a calibrated sprayer, calculate and measure the required volume of dsRNA solution based on the dosage of 2g dsRNA per acre, and pour the solution into the sprayer's reservoir.
[0079] Field spraying: Choose a sunny, windless or light-winded day (wind force not exceeding level 2) for spraying operations. Spray at a uniform speed and pressure to ensure that the wheat plants in the field are evenly sprayed and avoid missed spraying or repeated spraying.
[0080] Subsequent management: Repeat the above steps once a week until the wheat matures.
[0081] Wheat samples sprayed with dsRNA were ground up, and samples without dsRNA spraying were used as controls for the determination and statistical analysis of amylose content.
[0082] The results are as follows Figure 5 As shown in C and 5D, in the 2024 field trial, both naked dsRNA spraying and chitosan quaternary ammonium salt coated dsRNA could increase the amylose content in mature wheat grains from 27.72% to 30.37%, an increase of about 10% compared to the control.
[0083] Therefore, the dsRNA obtained in this invention significantly increased the amylose content in wheat after spraying compared with the control, which is of great value in the field of wheat quality improvement.
[0084] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A dsRNA for increasing the amylose content of wheat, characterized in that, The dsRNA is transcribed from a sequence fragment of the SBEIIb gene, the sequence fragment being at least one of SBE1, SBE2, SBE3 and SBE4; the sequence of SBE1 is shown as SEQ ID NO. 1, the sequence of SBE2 is shown as SEQ ID NO. 2, the sequence of SBE3 is shown as SEQ ID NO. 3, and the sequence of SBE4 is shown as SEQ ID NO.
4.
2. The method of claim 1, wherein the dsRNA for increasing the amylose content of wheat is synthesized by, The method comprises the following steps: S1, selecting an interference target in the SBEIIb gene, the sequence fragment of the interference target being at least one of SBE1, SBE2, SBE3 and SBE4; S2, constructing a recombinant vector containing the interference target; S3, extracting the dsRNA by using SDS heat lysis method.
3. The method of claim 2, wherein the dsRNA for increasing amylose content in wheat is synthesized by, The construction step of the recombinant vector is: S201, taking pET28a as the initial vector, removing the fragment containing RBS by enzyme digestion, inserting a 113bp sequence containing reverse T7 promoter and a multiple cloning site to obtain a dsRNA expression vector; S202, using cDNA of wheat leaves or grains as a template, amplifying the DNA fragment corresponding to the interference target by PCR; S203, double enzyme digestion and ligation of the DNA fragment and the dsRNA expression vector, and then transforming E. coli DH5α to obtain a recombinant vector containing the interference target.
4. The method of claim 3, wherein the dsRNA for increasing the amylose content of wheat is synthesized by, In step S201, the restriction enzymes Xba I and Xho I are used to remove the fragment containing RBS.
5. The method of claim 3, wherein the dsRNA for increasing the amylose content of wheat is synthesized by, In step S203, the DNA fragment and the dsRNA expression vector are double enzyme digested by using the restriction enzymes Xba I and Sal I.
6. The method of claim 2, wherein the dsRNA for increasing the amylose content of wheat is synthesized by, In step S3, the bacterial liquid containing the recombinant vector is centrifuged at 12000rpm for 2min, the precipitate is resuspended with 1mL 0.2% SDS solution, incubated at 80℃ for 10min, and then the supernatant is taken after centrifugation.
7. The dsRNA of claim 1 in the application of increasing the amylose content of wheat.
8. The dsRNA of claim 7 in the application of increasing the amylose content of wheat, wherein the dsRNA is sprayed on the wheat plant from the flowering stage.
9. The dsRNA of claim 8 in the application of increasing the amylose content of wheat, wherein the dsRNA is coated with a packaging material and then sprayed on the wheat plant.
10. The dsRNA of claim 8 in the application of increasing the amylose content of wheat, wherein the packaging material is chitosan quaternary ammonium salt.