Primer probe combination for polygene methylation detection, kit and application

Abstract

The invention provides a primer probe combination for polygene methylation detection, a kit and application, and belongs to the technical field of gene methylation detection reagents and preparation thereof. The primer probe combination comprises one or more of a primer probe of an APC gene, a primer probe of a DAPK1 gene, a primer probe of an RARB gene and a primer probe of an RASSF1A gene. And the probe is a magnetic bead-probe conjugate. By using the primer probe combination, a sample with the methylation positive ratio as low as 0.1% can still be detected, and the detection sensitivity is high. The primer probe combination can specifically distinguish APC gene methylation, DAPK1 gene methylation, RARB gene methylation and RASSF1A gene methylation, the detection specificity is good, in addition, breast cancer samples containing different types of gene methylation can be accurately distinguished, and the detection accuracy is high.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of gene methylation detection reagents and its preparation, and particularly relates to a primer probe combination, kit and application for multi-gene methylation detection. BACKGROUND

[0002] In epigenetics, diagnostics and therapeutics, detecting nucleic acid sequence changes at specific loci remains a key challenge. As these sequences are validated as clinical biomarkers for a variety of diseases, including cancer and neurological diseases, the identification of specific loci mutations, deletions and modifications of nucleic acids, which carry important genomic and epigenetic information, is increasingly important. Over the years, dozens of techniques for DNA sequence analysis have been developed, mainly divided into two categories of PCR-based and DNA sequencing-based methods. Although these methods are widely used, there are still many limitations in their application. For example, technologies such as nanopore and sequencing have been used to detect site-specific changes, including single-base mutations and 5-mC methylation. Although this method can analyze DNA sequences at single-base resolution, such detection usually requires a large amount of time, professional analysis knowledge and expensive instrument equipment to implement, limiting its application in clinical settings.

[0003] In contrast, the use of polymerase chain reaction (PCR) to amplify DNA sequences is now integrated into many routine clinical analysis workflows, for example, for infectious disease diagnosis. However, current methods cannot identify site-specific mutations at the single-base level, nor can they detect epigenetic base modifications. At the same time, PCR-based methods are heavily dependent on the design and optimization of specific primers, and poorly designed primers can produce false results. Many enhanced or improved PCR protocols, including AS quantitative PCR, although enhance the performance of site-specific mutation analysis, the complexity of the protocol limits the number of mutations that can be analyzed and the sensitivity of the analysis.

[0004] Therefore, there is an urgent need for a simple operation, high repeatability, and multi-site nucleic acid detection method that can be applied to various sample types in various fields. SUMMARY

[0005] In view of this, the purpose of the present application is to provide a primer probe combination, kit and application for multi-gene methylation detection.

[0006] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:

[0007] The application provides a primer probe combination for multi-gene methylation detection, which comprises one or more of a primer probe of an APC gene, a primer probe of a DAPK1 gene, a primer probe of a RARB gene and a primer probe of a RASSF1A gene; the probe is a magnetic bead-probe conjugate;

[0008] The upstream and downstream primers of the primer probe of the APC gene are shown as SEQ ID NO. 1-SEQ ID NO. 2, and the magnetic bead-probe conjugate of the APC gene is a magnetic bead conjugated with a tag sequence shown as SEQ ID NO. 11;

[0009] The upstream and downstream primers of the primer probe of the DAPK1 gene are shown as SEQ ID NO. 3-SEQ ID NO. 4, and the magnetic bead-probe conjugate of the DAPK1 gene is a magnetic bead conjugated with a tag sequence shown as SEQ ID NO. 12;

[0010] The upstream and downstream primers of the primer probe of the RARB gene are shown as SEQ ID NO. 5-SEQ ID NO. 6, and the magnetic bead-probe conjugate of the RARB gene is a magnetic bead conjugated with a tag sequence shown as SEQ ID NO. 13;

[0011] The upstream and downstream primers of the primer probe of the RASSF1A gene are shown as SEQ ID NO. 7-SEQ ID NO. 8, and the magnetic bead-probe conjugate of the RASSF1A gene is a magnetic bead conjugated with a tag sequence shown as SEQ ID NO. 14.

[0012] Preferably, the 5' end of the tag sequence is modified with AminolinkerC6.

[0013] Preferably, the magnetic bead is a MagPlex magnetic bead.

[0014] Preferably, the preparation method of the magnetic bead-probe conjugate comprises the following steps:

[0015] The magnetic beads are mixed with the tag sequence shown as any one of SEQ ID NO. 11-EQ ID NO. 14, 1-ethyl-(3-dimethylaminopropyl) carbonyl diimide solution is added and reacted, washed, and the supernatant is discarded to obtain the magnetic bead-probe conjugate.

[0016] Preferably, the number of the magnetic beads is 4×10 6 ~ 6×10 6The concentration of the tag sequence is 0.05-0.2 nM, and the amount of the tag sequence added is 1-4 μL; the concentration of the 1-ethyl-(3-dimethylaminopropyl) carbodiimide solution is 5-15 mg / mL, and the amount of the EDC added is 2-3 μL; the temperature of the reaction is 20-30 °C, and the time of the reaction is 25-35 min.

[0017] The application provides a kit for detecting methylation of multiple genes, comprising the primer probe combination.

[0018] Preferably, the kit further comprises human whole genome unmethylated DNA as a negative standard, DNA bisulfite conversion reagent and PCR reaction system.

[0019] The application provides application of the primer probe combination in preparation of a product for detecting methylation of multiple genes, wherein the multiple genes comprise one or more of APC gene, DAPK1 gene, RARB gene and RASSF1A gene.

[0020] The application provides application of the primer probe combination in preparation of a product for detecting breast cancer or diagnosing breast cancer gene methylation typing.

[0021] Preferably, the gene methylation comprises one or more of APC gene methylation, DAPK1 gene methylation, RARB gene methylation and RASSF1A gene methylation.

[0022] Compared with the prior art, the application has the following beneficial effects:

[0023] The application provides a primer probe combination, a kit and application for detecting methylation of multiple genes. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 Electrophoresis analysis results of amplification of upstream and downstream primers of different genes at different annealing temperatures for detecting methylation DNA negative or positive samples. DETAILED DESCRIPTION

[0025] The application provides a primer probe combination for multi-gene methylation detection, which comprises one or more of a primer probe of an APC gene, a primer probe of a DAPK1 gene, a primer probe of a RARB gene and a primer probe of a RASSF1A gene; the probe is a magnetic bead-probe conjugate;

[0026] The upstream and downstream primers of the primer probe of the APC gene are shown as SEQ ID NO. 1-SEQ ID NO. 2, and the magnetic bead-probe conjugate of the APC gene is a magnetic bead conjugated with a tag sequence shown as SEQ ID NO. 11;

[0027] The upstream and downstream primers of the primer probe of the DAPK1 gene are shown as SEQ ID NO. 3-SEQ ID NO. 4, and the magnetic bead-probe conjugate of the DAPK1 gene is a magnetic bead conjugated with a tag sequence shown as SEQ ID NO. 12;

[0028] The upstream and downstream primers of the primer probe of the RARB gene are shown as SEQ ID NO. 5-SEQ ID NO. 6, and the magnetic bead-probe conjugate of the RARB gene is a magnetic bead conjugated with a tag sequence shown as SEQ ID NO. 13;

[0029] The upstream and downstream primers of the primer probe of the RASSF1A gene are shown as SEQ ID NO. 7-SEQ ID NO. 8, and the magnetic bead-probe conjugate of the RASSF1A gene is a magnetic bead conjugated with a tag sequence shown as SEQ ID NO. 14.

[0030] In the application, the upstream primer of the application is composed of a universal primer+tag sequence+specific primer sequence, and the downstream primer is composed of another universal primer+specific primer sequence. The primer probe combination of the application has high specificity, high sensitivity and high accuracy for multi-gene methylation detection.

[0031] In the application, the 5' end of the tag sequence is modified with AminolinkerC6. The selection of each tag sequence in the application maximizes the reduction of secondary structures that may be formed between the probe sequences of each magnetic bead and between the tag and the specific primer fragment. The magnetic beads are MagPlex magnetic beads, and are further preferably carboxyl-modified MagPlex magnetic beads, which are purchased from Luminex Company. As a specific embodiment, the item numbers of the magnetic beads used for APC, DAPK1, RARB and RASSF1A genes are MC10020-ID, MC10033-ID, MC10035-ID and MC10037-ID, respectively, which are purchased from Luminex Company.

[0032] In the present application, the probe is a magnetic bead-probe conjugate obtained by conjugating a magnetic bead with a probe, and the preparation method of the magnetic bead-probe conjugate comprises the following steps:

[0033] The magnetic bead is mixed with the tag sequence shown in any one of SEQ ID NO. 11 to SEQ ID NO. 14, respectively, and then reacted after adding 1-ethyl-(3-dimethylaminopropyl) carbodiimide solution, washed, and the supernatant is discarded to obtain the magnetic bead-probe conjugate.

[0034] In the present application, the magnetic bead is mixed with the tag sequence shown in any one of SEQ ID NO. 11 to SEQ ID NO. 14, respectively. The magnetic bead is one of the magnetic beads with the product number of MC10020-ID, MC10033-ID, MC10035-ID, and MC10037-ID of Luminex Company. Before mixing, the step of resuspending the magnetic bead is further included: the magnetic bead with any product number is subjected to magnetic separation, the supernatant is discarded, and the magnetic bead is suspended in MES buffer to obtain a magnetic bead suspension. The MES buffer is 4.545 μL of 0.1M MES buffer with pH 4.5. The number of the magnetic bead is preferably 4×10 6 ~ 6×10 6 further preferably 4.5×10 6 ~ 5.5×10 6 more preferably 5×10 6 ; the concentration of the tag sequence is preferably 0.05-0.2 nM, further preferably 0.1-0.2 nM, and more preferably 0.1 nM; and the amount of the tag sequence added is preferably 1-4 μL, further preferably 1.5-3.5 μL, and more preferably 2 μL.

[0035] In the present application, after mixing, adding 1-ethyl-(3-dimethylaminopropyl) carbodiimide solution, reacting, washing, discarding the supernatant, the magnetic bead-probe conjugate is obtained. The concentration of the 1-ethyl-(3-dimethylaminopropyl) carbodiimide solution is preferably 5-15 mg / mL, further preferably 7-12 mg / mL, and more preferably 10 mg / mL; the addition amount of the 1-ethyl-(3-dimethylaminopropyl) carbodiimide solution is preferably 2-3 μL, and more preferably 2.5 μL; the temperature of the reaction is preferably 20-30°C, further preferably 22-28°C, and more preferably 25°C; the time of the reaction is preferably 25-35 min, further preferably 28-32 min, and more preferably 30 min. The reaction is carried out in the dark. After the reaction, the magnetic beads are separated and the supernatant is discarded to obtain the first magnetic beads, which are then washed. The washing method is as follows: the first magnetic beads are washed once with 0.02% Tween 20, then magnetically separated and the supernatant is discarded, then resuspended and precipitated with 0.1% SDS, then magnetically separated and the supernatant is discarded. The magnetic beads of the present application are coupled with the tag sequence through a covalent bond to form an amide bond.

[0036] The present application provides a kit for multi-gene methylation detection, comprising the primer probe combination described above.

[0037] In the present application, the kit further comprises human whole genome unmethylated DNA as a negative standard, DNA bisulfite conversion reagent and PCR reaction system. The DNA bisulfite conversion reagent can be a DNA bisulfite conversion kit. The present application does not have special limitations on the source of human whole genome unmethylated DNA and DNA bisulfite conversion kit, and commercially available products in the art can be used. The PCR reaction system is a first PCR reaction system and a second PCR reaction system, the first PCR reaction system is 2x Multiplex Buffer 10-12.5 μL, 10 U / μL Multiplex DNA Polymerase 0.8-1 μL, 5 pmol / mL PCR primer working solution 1.6-2 μL, template 0.5-2 μL and ddH2O 1.5-7.5 μL, and the specific composition is shown in Tables 3, 5 or 8; the second PCR reaction system is 2x Multiplex Buffer 12-13 μL, 10 U / μL Multiplex DNA Polymerase 0.5-1.5 μL, 20 pmol / mL PCR primer working solution 0.4-0.6 μL, first round amplification product 7-8 μL and ddH2O 1-3 μL, and the specific composition is shown in Table 9. The 5 pmol / mL PCR primer working solution is prepared by mixing 10 μL of 100 pmol / mL of each of the upstream primer and the downstream primer storage solution with 180 μL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). The 20 pmol / mL PCR primer working solution is prepared by mixing 10 μL of 100 pmol / mL of each of the upstream primer and the downstream primer storage solution with 30 μL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). The 5 pmol / mL PCR primer working solution is prepared by mixing 10 μL of 100 pmol / mL of each of the upstream primer and the downstream primer storage solution with 30 μL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0).

[0038] The present application provides an application of the above-mentioned primer probe combination in the preparation of a product for detecting multiple gene methylation, wherein the multiple genes include one or more of APC gene, DAPK1 gene, RARB gene and RASSF1A gene.

[0039] The present application provides an application of the above-mentioned primer probe combination in the preparation of a product for detecting breast cancer or diagnosing breast cancer gene methylation typing.

[0040] In the present application, the gene methylation includes one or more of APC gene methylation, DAPK1 gene methylation, RARB gene methylation and RASSF1A gene methylation.

[0041] In the present application, the product is a reagent or a kit.

[0042] In the present application, when the magnetic bead-probe conjugate is hybridized with the second round PCR product for detection, the specific hybridization method can be as follows: 5 μL of the second round PCR product is mixed with 35 μL of 2xTm buffer, 4 μL of magnetic bead-probe conjugate solution (the number of magnetic bead-probe conjugates is 2500 per reaction) and 16 μL of water, and then shaken uniformly. The PCR reaction conditions are set as follows: 96℃ for 90 s, 37℃ for 20 min. After hybridization, the liquid chip platform is used for detection, and then the detection result is determined. When the primer probe combination is used for detecting the methylation of multiple genes, if the fluorescence value (MFI) of a certain gene is greater than or equal to 100, it is determined that the gene is positive; if the fluorescence value (MFI) of a certain gene of the sample is less than 100, it is determined to be negative.

[0043] In the present application, all raw material components are commercially available products well known to those skilled in the art, unless otherwise specified.

[0044] The technical solutions provided by the present application will be described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present application.

[0045] Example 1

[0046] The liquid chip for detecting APC, DAPK1, RARB and RASSF1A gene methylation mainly includes:

[0047] I. Design of specific primers and probes

[0048] Two specific PCR primer sequences are designed for the methylation sites of the tumor suppressor genes APC, DAPK1, RARB and RASSF1A. The upstream primer is composed of "universal primer + tag sequence + specific primer sequence", and the downstream primer is composed of "another universal primer + specific primer sequence". The primers are designed to select the regions with significant methylation difference between cancer and control in the TCGA database. The primer sequences are shown in Table 1. All primers are synthesized by Jinweizhi Biotechnology Co., Ltd. and are prepared into 100 pmol / mL storage solution with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0).

[0049] Table 1 Primer sequences of APC, DAPK1, RARB and RASSF1A genes

[0050]

[0051]

[0052] The underlined sequences in the upstream sequences in Table 1 are reverse complements of the tag sequences in Table 2, and the underlined sequences in the downstream sequences are another universal primer.

[0053] II. Coupling of magnetic beads and tag sequences

[0054] According to the designed specific primer fragments, tag sequences are selected to minimize the secondary structure that can be formed between the probe sequences of each magnetic bead and between the tag and the specific primer fragments. Each tag sequence is modified at the 5' end with Aminolinker C6 (Aminolinker C6 is synthesized by Suzhou Jinyuzhi Biological Technology Co., Ltd. on commission). The numbers of the four selected magnetic beads and the corresponding tag sequences on the magnetic beads are shown in Table 2.

[0055] Table 2: Numbers of magnetic beads and corresponding tag sequences on the magnetic beads

[0056] Gene name Magnetic bead number Tag sequence (5'-3') APC 20 AAATTAGTTGAAAGTATGAGAAAG (SEQ ID NO. 11) DAPK1 33 TATTAGAGTTTGAGAATAAGTAGT (SEQ ID NO. 12) RARB 35 AATAAGAGAATTGATATGAAGATG (SEQ ID NO. 13) RASSF1A 37 TGTATATGTTAATGAGATGTTGTA (SEQ ID NO. 14)

[0057] The four magnetic beads with numbers 20, 33, 35 and 37 in Table 2 are purchased from Luminex Company, and the item numbers are MC10020-ID, MC10033-ID, MC10035-ID and MC10037-ID, respectively. The numbers of the magnetic beads are abbreviated using the numbers in the item numbers.

[0058] The four selected magnetic beads are carboxyl-modified MagPlex magnetic beads from Luminex Company, which are suitable for all liquid suspension chip systems of Luminex Company, such as MAGPIX or Luminex 200 liquid suspension chip system. The tag sequences are synthesized by Shanghai Shengong Biological Engineering Technology Service Co., Ltd. The synthesized tag sequences are prepared into 0.1 nM storage solution with nuclease-free water for standby. The coupling steps are as follows:

[0059] 5 x 10 6The uncoupled MagPlex magnetic beads numbered 20, 33, 35 and 37 above were separated by magnetism, the supernatant was discarded, and the magnetic beads were suspended in 45 μL of 0.1 M MES buffer (pH 4.5). The magnetic beads were resuspended to obtain magnetic bead suspensions, respectively. 2 μL of 0.1 nM of the tag sequence (see Table 2 for specific sequences) was added, respectively. 2.5 μL of a prepared 10 mg / mL EDC (1-ethyl-(3-dimethylaminopropyl) carbodiimide, purchased from Thermo) solution was added to the corresponding magnetic bead suspension, mixed, and reacted at 25°C in the dark for 30 min. After the reaction, the magnetic beads were separated by magnetism, the supernatant was discarded, and the magnetic beads were washed once with 1 mL of 0.02% (v / v) Tween 20, and then separated by magnetism again and the supernatant was discarded. The magnetic beads were resuspended with 0.1% (v / v) SDS for 40 s, separated by magnetism again, and the supernatant was discarded to obtain the magnetic bead-probe conjugates (denoted as B20_APC, B33_DAPK1, B35_RARB and B37_RASSF1A, also referred to as hybrid magnetic bead mixture), respectively. The magnetic bead-probe conjugates were resuspended with 80 μL of TE buffer, and stored at 2-8°C in the dark.

[0060] Example 2

[0061] One round of primer specificity verification

[0062] I. Dilution of positive and negative standard samples

[0063] One tube of human whole genome methylated DNA and one tube of human whole genome unmethylated DNA were each thawed and mixed by flicking at room temperature, and then diluted to 10 ng / μL using enzyme-free water according to the labeled concentration to obtain diluted human whole genome methylated DNA and human whole genome unmethylated DNA as the diluted methylation positive standard and methylation negative standard, respectively.

[0064] II. Conversion of positive and negative standard samples

[0065] Twenty μL of the diluted positive and negative standard samples were taken, respectively, and converted using a DNA bisulfite conversion kit (D5005) produced by Zymo research biological company. The specific steps were performed according to the reagent instructions, and the elution volume was 20 μL.

[0066] III. One round of PCR amplification of the sample to be tested

[0067] First, each PCR primer working solution was prepared: 10 μL of each of the primer storage solutions (SEQ ID NO. 1-SEQ ID NO. 8) for each gene site (APC, DAPK1, RARB, and RASSF1A) was taken into a 1.5 mL microcentrifuge tube, and 180 μL of TE buffer was added to each tube and mixed well to obtain the PCR primer working solution. The methylation-positive (PC) and methylation-negative (NC) standard samples transformed according to the above requirements were used as the templates to be tested, and the PCR reaction system is shown in Table 3. Each pair of primers was tested for specificity at four different annealing temperatures (62.3°C, 60.4°C, 57.9°C, and 56°C) using temperature gradient PCR.

[0068] Table 3 PCR reaction system

[0069] Component Volume (μL) 2 x Multiplex Buffer (High specificity) 10 Multiplex DNA Polymerase (High specificity) (10 U / μL) 0.8 PCR primer working solution (5 pmol / mL) 1.6 Template 0.5 ddH2O 7.1

[0070] After mixing, the solution was shaken, centrifuged, and placed in a PCR instrument for PCR reaction. The PCR amplification program was as follows:

[0071] 95°C for 2 min; 95°C for 30 s, annealing temperature (62.3°C, 60.4°C, 57.9°C, or 56°C) for 30 s, 72°C for 30 s, for a total of 35 cycles; 72°C for 5 min, 12°C for ∞.

[0072] Four, electrophoresis analysis of the results of one round of PCR amplification

[0073] Five μL of the PCR product of the first round was taken for electrophoresis detection, and the detection results are shown in Table 4. The results showed that each pair of primers could distinguish between the methylation-positive (PC) and methylation-negative (NC) standard samples under each temperature condition, proving that the specificity of the primers was good. Figure 1

[0074] Example 3

[0075] Specificity analysis

[0076] ​The positive and negative standards described in this example are human methylated DNA and human unmethylated DNA (ZYMO RESEARCH, D5014) purchased from Zymo research biological company (ZYMO RESEARCH, D5014); bisulfite conversion kit purchased from Zymo research biological company (ZYMO RESEARCH, D5005); Taq Pro Multiplex DNA Polymerase (High specificity) purchased from Nanjing Vazyme Biotechnology Co., Ltd. (Vazyme, PM202-01); Tris-HCl Tris-Hydroxymethyl aminomethane purchased from Beijing Solarbio Technology Co., Ltd. (Solarbio T8230); Triton X-100 (polyethylene glycol p-isooctyl phenyl ether) purchased from Beijing Solarbio Technology Co., Ltd. (Solarbio T8200); NaCl (sodium chloride) purchased from Tianda Chemical Reagent; ExoSAP-IT TM PCR Product Cleanup kit purchased from American ABI company.

[0077] The formula (see Table 4) and preparation method of 2xTm buffer are as follows:

[0078] Table 4 Formula of 2xTm buffer

[0079] Reagent Amount NaCl 5.85g Tris-HCl 6.057g Triton X-100 0.4 mL

[0080] Take 500 mL beaker and add about 200 mL distilled water, use electronic balance and pipette to take the components in Table 4 in about 200 mL distilled water, use magnetic stirrer to stir at room temperature until all dissolved. Use 250 mL volumetric flask to add distilled water to constant volume to 250 mL. After mixing, pour the solution back into the beaker and adjust the pH to 8.0 with concentrated hydrochloric acid, filter and store at 4°C.

[0081] I. Dilution of positive and negative standards

[0082] One tube of human whole genome methylated DNA and one tube of human whole genome unmethylated DNA were each thawed at room temperature, mixed by flicking and diluted to 10 ng / μL using enzyme-free water according to the labeled concentration, to obtain diluted human whole genome methylated DNA and diluted human whole genome unmethylated DNA as diluted methylation positive standard and methylation negative standard.

[0083] II. Conversion of positive and negative standards

[0084] Take 20 μL of each diluted positive and negative standard, respectively, and use the DNA bisulfite conversion kit (D5005) produced by Zymo research to convert, and the specific steps are performed according to the reagent instructions, and the elution volume is 20 μL.

[0085] III. One round of PCR amplification of the sample to be tested

[0086] First, prepare the PCR primer working solution: take 10 μL of each of the upstream and downstream primers (SEQ ID NO. 1-SEQ ID NO. 8) of each gene site (APC, DAPK1, RARB, and RASSF1A) in Table 1 into a 1.5 mL microcentrifuge tube, respectively, and add 180 μL of TE buffer and mix evenly to obtain the PCR primer working solution. The methylation positive (PC) and methylation negative (NC) standards converted according to the above requirements are used as the template to be tested, and the PCR amplification reaction system is shown in Table 5.

[0087] Table 5 PCR amplification reaction system

[0088] Component Volume (μL) 2 x Multiplex Buffer (High specificity) 12.5 Multiplex DNA Polymerase (High specificity) (10 U / μL) 1 PCR primer working solution (5 pmol / mL) 2 Template 2 ddH2O 7.5

[0089] After mixing, shake evenly, centrifuge instantly, and place on a PCR instrument for PCR reaction. The PCR amplification program is as follows:

[0090] 95℃ 2 min; 95℃ 30 s, 57℃ 30 s, 72℃ 30 s, a total of 30 cycles; 72℃ 5 min, 12℃ ∞.

[0091] IV. Purification treatment of PCR product

[0092] Take 5 μL of each gene PCR product, respectively, add 2 μL of ExoSAP-IT reagent (purchased from Applied Biosystem, item number 78201.1.ML), incubate at 37℃ for 15 min, incubate at 80℃ for 15 min, and inactivate the excess enzyme. The purified product is directly used for subsequent second round PCR reaction.

[0093] V. Second round of PCR amplification

[0094] First, prepare the PCR primer working solution: take 10 μL of each of the upstream and downstream primers (SEQ ID NO. 1-SEQ ID NO. 8) of each gene site (APC, DAPK1, RARB, and RASSF1A) in Table 1 into a 1.5 mL microcentrifuge tube, respectively, and add 180 μL of TE buffer and mix evenly to obtain the PCR primer working solution. The methylation positive (PC) and methylation negative (NC) standards converted according to the above requirements are used as the template to be tested, and the PCR amplification reaction system is shown in Table 5.

[0095] Table 6 Second round of PCR amplification reaction system ​

[0096]

[0097]

[0098] After mixing, oscillate uniformly, centrifuge instantly, place on a PCR instrument to perform a PCR reaction, and the PCR amplification procedure is: 95℃ 2min; 95℃ 30s, 60℃ 30s, 72℃ 30s, a total of 30 cycles; 72℃ 5min, 12℃ ∞.

[0099] Six, hybridization detection

[0100] (1) Hybridization: 5 μL of the second round of PCR product is taken, 35 μL of 2×Tm buffer solution is added, 4 μL of hybridization magnetic bead mixture (Luminex, Microspheres) of Example 1 (the number of magnetic bead-probe conjugates is 2500 per reaction) and 16 μL of water are added, and after mixing, oscillate uniformly. The PCR reaction conditions are set as follows: 96℃ 90s, 37℃ 20min.

[0101] (2) Liquid chip platform detection: the product obtained in step (1) is detected using a Luminex200 liquid chip platform, and the detection operation steps and parameter settings are operated according to the Luminex200 operation manual.

[0102] (3) Detection result determination: the sample detection result is compared with the negative standard result, and according to experience, if the fluorescence value (MFI) of a certain gene is greater than or equal to 100, it is determined that the gene is positive, and if the fluorescence value (MFI) of a certain gene of the sample is less than 100, it is determined to be negative.

[0103] (4) The detection results are shown in Table 7, PC1-PC4 are all methylation positive standard products of APC gene, DAPK1 gene, RARB gene and RASSF1A gene after bisulfite conversion, and NC is a methylation negative standard product after bisulfite conversion.

[0104] Table 7 Specific detection results of magnetic bead-probe conjugates

[0105] Position Sample B20_APC B33_DAPK1 B35_RARB B37_RASSF1A 1 PC1 1034 22.5 54 22 2 PC2 40 924 45 29 3 PC3 29 26 1254 30 4 PC4 45 58 56 844 5 NC 33 41 42 30

[0106] It can be seen that the detection method of the application can be specifically distinguished by using primers and magnetic bead-probe conjugates of four genes, which shows that the method has good specificity.

[0107] Example 4

[0108] Detection sensitivity analysis

[0109] The positive and negative standards described in this example are human methylated DNA and human unmethylated DNA (ZYMO RESEARCH, D5014) purchased from Zymo research biological company (ZYMO RESEARCH, D5014); bisulfite conversion kit purchased from Zymo research biological company (ZYMO RESEARCH, D5005); Taq Pro Multiplex DNA Polymerase (High specificity) purchased from Nanjing Vazyme Biotechnology Co., Ltd. (Vazyme, PM202-01); Tris-HCl Tris-Hydroxymethyl aminomethane purchased from Beijing Solarbio Technology Co., Ltd. (Solarbio T8230); Triton X-100 (polyethylene glycol p-isooctyl phenyl ether) purchased from Beijing Solarbio Technology Co., Ltd. (Solarbio T8200); NaCl (sodium chloride) purchased from Tianda Chemical Reagent; ExoSAP-IT TM PCR Product Cleanup kit purchased from ABI Company, USA.

[0110] The formula of 2xTm buffer is shown in Table 4, and the preparation method is shown in Example 3.

[0111] I. Different ratio of methylation positive sample dilution

[0112] One tube of human whole genome methylated DNA and one tube of human whole genome unmethylated DNA were thawed at room temperature, mixed by flicking, and then mixed according to the labeled concentration according to the proportion and diluted with enzyme-free water, to obtain a sample with a final concentration of 10 ng / μL. Among them, the sample contains 2.5%, 1%, 0.5%, 0.25%, and 0.1% of methylation positive samples, i.e., the sample contains 0.25 ng / μL, 0.1 ng / μL, 0.05 ng / μL, 0.025 ng / μL, and 0.01 ng / μL of methylation positive samples.

[0113] II. Different ratio of methylation positive sample and negative sample conversion

[0114] 20 μL of methylation positive sample with different positive ratios (2.5%, 1%, 0.5%, 0.25%, and 0.1%) and 20 μL of methylation negative sample diluted to 10 ng / μL were taken, respectively, and converted using the DNA bisulfite conversion kit (D5005) produced by Zymo research biological company. The specific steps were carried out according to the reagent instruction manual, and the elution volume was 20 μL.

[0115] III. One round of PCR amplification of the sample to be tested

[0116] The primer sequence of the first round of the APC, DAPK1, RARB and RASSF1A genes in Example 2 was used. The different ratio of the methylation positive samples and the negative (NC) standard after the bisulfite conversion as required above were used as the templates to be detected, and the reaction system of the first round of PCR was shown in Table 8.

[0117] Table 8 The reaction system of the first round of PCR

[0118] Component Volume (μL) 2 x Multiplex Buffer (High specificity) 12.5 Multiplex DNA Polymerase (High specificity) (10 U / μL) 1 PCR primer working solution (5 pmol / mL) Each 2 Template 2 ddH2O 1.5

[0119] After mixing, the mixture was shaken uniformly, centrifuged momentarily, and then placed in a PCR instrument for the PCR reaction. The PCR amplification procedure was as follows: 95℃ for 2 min; 95℃ for 30 s, 57℃ for 30 s, 72℃ for 30 s, for a total of 30 cycles; 72℃ for 5 min, and 12℃ for an infinite time.

[0120] Four, purification of the PCR product

[0121] 5 μL of the product after the PCR reaction of each gene was taken respectively, 2 μL of ExoSAP-IT reagent was added, incubated at 37℃ for 15 min, incubated at 80℃ for 15 min, and the excess enzyme was inactivated. The purified product was directly used for the subsequent second round of PCR reaction.

[0122] Five, second round of PCR amplification

[0123] 10 μL of the storage solution of the upstream and downstream primers (SEQ ID NO. 1-SEQ ID NO. 8) of each gene site (APC, DAPK1, RARB and RASSF1A) in Table 1 was taken respectively in a 1.5 mL microcentrifuge tube, 30 μL of TE buffer was added respectively, and the mixture was mixed uniformly to be the working solution of the PCR primer. The second round of primer of the APC, DAPK1, RARB and RASSF1A genes was used for the second round of PCR amplification, and the reaction system of the second round of PCR amplification in the embodiment was shown in Table 9.

[0124] Table 9 The reaction system of the second round of PCR amplification

[0125] Component Volume (μL) 2 x Multiplex Buffer (High specificity) 12.5 Multiplex DNA Polymerase (High specificity) (10 U / μL) 1 PCR primer working solution (20 pmol / mL) Each 0.5 Purified product 7.5 ddH2O 2

[0126] After mixing, the mixture was shaken uniformly, centrifuged momentarily, and then placed in a PCR instrument for the PCR reaction. The PCR amplification procedure was as follows: 95℃ for 2 min; 95℃ for 30 s, 57℃ for 30 s, 72℃ for 30 s, for a total of 30 cycles; 72℃ for 5 min, and 12℃ for an infinite time.

[0127] Six, hybridization detection

[0128] The method in Example 1 was used for the coupling of the magnetic bead probe to obtain the magnetic bead-probe conjugate, and the method in Example 3 was used for the hybridization detection.

[0129] (1) Hybridization: 5 μL of the second round PCR product was taken, 35 μL of 2xTm buffer was added, 4 μL of hybridization magnetic bead mixture (Luminex, Microspheres) of Example 1 (the number of magnetic bead-probe conjugates was 2500 per reaction) and 16 μL of water were added, and then the mixture was shaken uniformly. The PCR reaction conditions were set as follows: 96 °C for 90 s, 37 °C for 20 min, and the reaction was performed.

[0130] (2) Liquid chip platform detection: the product obtained in step (1) was detected using a Luminex200 liquid chip platform, and the detection operation steps and parameter settings were performed according to the Luminex200 operation manual.

[0131] (3) Detection result determination: the sample detection result was compared with the negative standard result, and according to experience, if the fluorescence value (MFI) of a certain gene was greater than or equal to 100, the gene was determined to be positive, and if the fluorescence value (MFI) of a certain gene of the sample was less than 100, it was determined to be negative.

[0132] (4) The detection results are shown in Table 10. 2.5% L, 1% L, 0.5% L, 0.25% L, and 0.1% L are methylation positive samples with positive rates of 2.5%, 1%, 0.5%, 0.25%, and 0.1% after bisulfite conversion, respectively, and NC is a methylation negative standard after bisulfite conversion.

[0133] Table 10 Magnetic bead-probe conjugate sensitivity detection results

[0134] Position Sample B20_APC B33_DAPK1 B35_RARB B37_RASSF1A 1 2.5％L 1814 1267 1980 1090 2 1％L 1378 723 1123 788 3 0.5％L 1629 565 1618 516 4 0.25％L 809.5 518 1056 444 5 0.1％L 525.5 394 809.5 341 6 NC 37 26 12 64.5

[0135] The results of Table 10 show that the detection method of the application can still detect positive samples in the case of 0.1% methylation positive samples using primers and magnetic bead-probe conjugates of four genes, which indicates that the method has good sensitivity.

[0136] Example 5

[0137] Using APC, DAPK1, RARB and RASSF1A gene methylation detection liquid chip for sample detection

[0138] I. Sample DNA extraction

[0139] The paraffin-embedded tissue DNA extraction kit (DP331) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. was used, and the DNA of 5 human breast cancer paraffin section tissue samples (C1-C5) and 5 non-cancer paraffin section tissue samples (H1-H5) was extracted according to the method described in the instruction manual.

[0140] Among them, human breast cancer paraffin section tissue sample C1 is APC, DAPK1, RARB and RASSF1A gene methylation positive sample, C2 is DAPK1, RARB and RASSF1A gene methylation positive sample, C3 is APC, DAPK1, RARB and RASSF1A gene methylation positive sample, C4 is APC and RASSF1A gene methylation positive sample, and C5 is APC, DAPK1 and RARB gene methylation positive sample.

[0141] II. DNA bisulfite conversion

[0142] The extracted DNA sample was converted by using the DNA bisulfite conversion kit (D5005) produced by Zymo research biological company according to the method of the instruction.

[0143] III. One round of PCR amplification of the sample to be tested

[0144] The converted DNA sample was amplified by using the one round primer of APC, DAPK1, RARB and RASSF1A gene according to example 2, and PC and NC as positive and negative controls. The PCR amplification system of this example is shown in table 11.

[0145] Table 11 One round of PCR amplification system of the sample to be tested

[0146] Component Volume (μL) 2 x Multiplex Buffer (High specificity) 12.5 Multiplex DNA Polymerase (High specificity) (10 U / μL) 1 PCR primer working solution (5 pmol / mL) 2 Post-transformation sample 9.5

[0147] After mixing, shake evenly, centrifuge instantly, and place in PCR instrument for PCR reaction. The PCR amplification program is: 95℃ 2min; 95℃ 30s, 57℃ 30s, 72℃ 30s, a total of 30 cycles; 72℃ 5min, 12℃ ∞.

[0148] IV. Purification treatment of PCR product

[0149] Take 5μL PCR reaction product, add 2μL ExoSAP-IT reagent, incubate at 37℃ for 15min, incubate at 80℃ for 15min, and inactivate the excess enzyme. The purified product is directly used for subsequent two round PCR reaction.

[0150] V. Two round of PCR amplification

[0151] Two round of PCR amplification was carried out by using the two round primer of APC, DAPK1, RARB and RASSF1A gene in example 3. The PCR amplification system of this example is shown in table 12.

[0152] Table 12 Two round of PCR amplification system of the sample to be tested

[0153] Component Volume (μL) 2 x Multiplex Buffer (High specificity) 12.5 Multiplex DNA Polymerase (High specificity) (10 U / μL) 1 PCR primer working solution (20 pmol / mL) 0.5 each purified product 7.5 ddH2O 2

[0154] After mixing, oscillate evenly, centrifuge instantly, and place on a PCR instrument for PCR reaction. The PCR amplification procedure is as follows: 95°C for 2 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, for a total of 30 cycles; 72°C for 5 min, 12°C for ∞.

[0155] Six, hybridization detection

[0156] The method of Example 1 was used to couple the magnetic bead probe, and the obtained magnetic bead-probe conjugate was subjected to hybridization detection using the method of Example 3.

[0157] (1) Hybridization: 5 μL of the second-round PCR product was taken, 35 μL of 2 x Tm buffer was added, 4 μL of the hybridization magnetic bead mixture (Luminex, Microspheres) of Example 1 (the number of magnetic bead-probe conjugates was 2500 per reaction) and 16 μL of water were added, and after mixing, oscillate evenly. The PCR reaction conditions were set as follows and the reaction was performed: 96°C for 90 s, 37°C for 20 min.

[0158] (2) Liquid chip platform detection: the product obtained in step (1) was subjected to detection using a Luminex200 liquid chip platform, and the detection operation steps and parameter settings were performed according to the Luminex200 operation manual.

[0159] (3) Detection result determination: the sample detection results were compared with the negative standard results, and according to experience, if the fluorescence value (MFI) of a certain gene was greater than or equal to 100, the gene was determined to be positive, and if the fluorescence value (MFI) of a certain gene of the sample was less than 100, it was determined to be negative.

[0160] (4) The detection results are shown in Table 13. PC is the methylation positive standard of APC, DAPK1, RARB and RASSF1A after bisulfite conversion, NC is the methylation negative standard after bisulfite conversion, C1-C5 are 5 breast cancer patient samples, and H1-H5 are 5 non-cancer patient samples.

[0161] Table 13 Multiple detection results of breast cancer and non-cancer samples in this example

[0162] position sample B20_APC B33_DAPK1 B35_RARB B37_RASSF1A 1 C1 994.5 804 1472 3918 2 C2 42 335 1351.5 276 3 C3 130 281 1100 193 4 C4 558 99 30 380.5 5 C5 1127 968.5 3399 36 6 H1 32 52 30 37 7 H2 27 50 28 38 8 H3 27 45 28 59 9 H4 28 38 28 53 10 H5 23 56 88 91 11 PC 1444.5 945 1428.5 1412 12 NC 20 18 35 53

[0163] It can be seen that the fluorescence values (MFI) of no less than 2 gene target sites of the 5 breast cancer patient samples are greater than or equal to 100, the fluorescence values (MFI) of all 4 gene target sites of the PC sample are greater than or equal to 100, and the fluorescence values (MFI) of each gene target site of the 5 non-cancer and NC control samples are less than 100, proving that the method can better distinguish breast cancer samples. In addition, compared with the known positive types of the methylation of the 5 breast cancer patient samples, the positive type results of the methylation detected by the APC, DAPK1, RARB and RASSF1A gene methylation detection liquid chip of the present application are completely consistent with the known positive types, and the coincidence rate is 100%.

[0164] The above only describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A primer probe combination for multi-gene methylation detection, characterized in that, The primer probe combination comprises one or more of a primer probe of an APC gene, a primer probe of a DAPK1 gene, a primer probe of a RARB gene, and a primer probe of a RASSF1A gene; the probe is a magnetic bead-probe conjugate; the upstream and downstream primers of the primer probe of the APC gene are shown as SEQ ID NO. 1-2, and the magnetic bead-probe conjugate of the APC gene is a magnetic bead conjugated with a tag sequence shown as SEQ ID NO. 11; the upstream and downstream primers of the primer probe of the DAPK1 gene are shown as SEQ ID NO. 3-4, and the magnetic bead-probe conjugate of the DAPK1 gene is a magnetic bead conjugated with a tag sequence shown as SEQ ID NO. 12; the upstream and downstream primers of the primer probe of the RARB gene are shown as SEQ ID NO. 5-6, and the magnetic bead-probe conjugate of the RARB gene is a magnetic bead conjugated with a tag sequence shown as SEQ ID NO. 13; the upstream and downstream primers of the primer probe of the RASSF1A gene are shown as SEQ ID NO. 7-8, and the magnetic bead-probe conjugate of the RASSF1A gene is a magnetic bead conjugated with a tag sequence shown as SEQ ID NO.

14.

2. The primer probe combination according to claim 1, characterized in that, The 5' end of the tag sequence is modified with AminolinkerC6.

3. The primer probe combination of claim 1, wherein The magnetic bead is a MagPlex magnetic bead.

4. The primer probe combination according to any one of claims 1 to 3, characterized in that The preparation method of the magnetic bead-probe conjugate comprises the following steps: mixing the magnetic bead with the tag sequence shown as any one of SEQ ID NO. 11-14, adding 1-ethyl-(3-dimethylaminopropyl) carbonyl diimide solution for reaction, washing, discarding the supernatant, and obtaining the magnetic bead-probe conjugate.

5. The primer probe according to claim 4, wherein The number of the magnetic beads is 4 x 104 6 ~ 6 x 104 6 The concentration of the tag sequence is 0.05~0.2nM, the added amount of the tag sequence is 1~4μL; the concentration of the 1-ethyl-(3-dimethylaminopropyl) carbodiimide solution is 5~15mg / mL, the added amount of the EDC is 2~3μL; the temperature of the reaction is 20~30℃, and the time of the reaction is 25~35min.

6. A kit for multi-gene methylation detection, characterized in that, The kit further comprises human whole genome unmethylated DNA as a negative standard, DNA bisulfite conversion reagent, and a PCR reaction system.

7. The kit of claim 6, wherein The multiple genes comprise one or more of an APC gene, a DAPK1 gene, a RARB gene, and a RASSF1A gene.

8. Use of the primer probe combination according to any one of claims 1 to 5 for the preparation of a test for the detection of a polygenic methylation product, characterized in that, 9. The primer probe combination of any one of claims 1-5 for use in the preparation of a product for detecting or diagnosing breast cancer gene methylation typing. The gene methylation comprises one or more of APC gene methylation, DAPK1 gene methylation, RARB gene methylation, and RASSF1A gene methylation.

10. Use according to claim 9, characterized in that, ​

Images