SNP marker for identifying silver pheasant species and application thereof
By using silver pheasant-specific SNP markers and primer sets, combined with PCR amplification and Sanger sequencing technology, the problem of morphological identification of silver pheasant chicks and females has been solved, enabling accurate identification of individual silver pheasants and supporting the conservation and scientific research of silver pheasants.
Patent Information
- Application Number
- CN202511223510.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-29
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2045-08-29
AI Technical Summary
Existing species identification methods are insufficient to accurately distinguish the species affiliation of silver pheasant chicks and females, especially in hybrid individuals, leading to difficulties in silver pheasant conservation and scientific research.
By employing single nucleotide polymorphism (SNP) markers, screening for silver pheasant-specific SNP sites, and designing corresponding primer sets, an efficient and accurate species identification system was established. PCR amplification and Sanger sequencing technologies were then used to analyze the SNP genotypes of individual pheasants.
This technology enables precise identification of individual silver pheasants, reduces errors caused by genetic marker mutations, improves the accuracy of identification results and ease of operation, and provides solid technical support for the protection and scientific research of silver pheasants.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to a SNP marker for Lophura species identification and application thereof. BACKGROUND
[0002] Lophura belongs to the family Phasianidae of the order Galliformes, and contains 12 large pheasant species, which plays an important role in the field of ecological system and biodiversity. Among them, there are three species in China, including Lophura nycthemera, Lophura leucomelanos and Lophura swinhoii.
[0003] As an important member of Lophura, Lophura nycthemera, also known as silver pheasant or white pheasant, has a very wide distribution range, covering Cambodia, China, Laos, Myanmar, Thailand and Vietnam. In China, it is distributed in South China, Central China and Southwest China. Lophura nycthemera not only has a wide distribution, but also has a unique hybridization characteristic, which can hybridize with other Lophura species, such as Lophura leucomelanos. The probability of this hybridization phenomenon varies in different environments. In captivity, due to the limited activity space of different Lophura pheasants and the increased contact opportunities, hybridization events are more likely to occur than in natural wild environments. The presence of hybrid individuals in captivity makes the conservation of wild species lose its original significance, and once these individuals are released into the wild, they are likely to enter the wild population, causing genetic pollution of the wild population and destroying the genetic purity and stability of the wild population, which poses a severe challenge to the species protection of Lophura nycthemera and brings great challenges to the species identification of Lophura nycthemera.
[0004] At present, common species identification methods often rely on mitochondrial markers, but this method has obvious limitations, as it can only reflect maternal genetic information and cannot accurately determine whether an individual is a hybrid offspring. From the perspective of morphology, adult male birds of Lophura can be distinguished from hybrid individuals by their unique feather color and other characteristics, but the morphological differences between chicks and females are not significant, making it difficult to accurately determine their species affiliation and whether they are hybrids. Traditional identification methods often fail to accurately determine the species affiliation of hybrid individuals, chicks and females, which has a negative impact on the protection, management and related scientific research of Lophura nycthemera. SUMMARY
[0005] In view of the above problems, the present application provides a SNP marker for Lophura nycthemera species identification, which can effectively solve the identification problems caused by Lophura nycthemera hybridization, chicks and female morphological identification difficulties, and provide solid technical support for the protection, population monitoring and related scientific research of Lophura nycthemera.
[0006] In order to achieve the above object, the present application provides a SNP marker for identifying the species of Crossoptilon mantchuricum, which comprises at least one of SNP1-SNP29, wherein the SNP1-SNP29 are as follows:
[0007] The SNP1 is located at the position of 52783760 of CM059454.1, and the allelic gene is A / T;
[0008] The SNP2 is located at the position of 50674802 of CM059455.1, and the allelic gene is G / T;
[0009] The SNP3 is located at the position of 67434585 of CM059456.1, and the allelic gene is G / T;
[0010] The SNP4 is located at the position of 32909224 of CM059457.1, and the allelic gene is C / A;
[0011] The SNP5 is located at the position of 45463750 of CM059458.1, and the allelic gene is C / A;
[0012] The SNP6 is located at the position of 30596551 of CM059459.1, and the allelic gene is A / C;
[0013] The SNP7 is located at the position of 25720838 of CM059460.1, and the allelic gene is A / C;
[0014] The SNP8 is located at the position of 21092701 of CM059461.1, and the allelic gene is T / G;
[0015] The SNP9 is located at the position of 11770694 of CM059462.1, and the allelic gene is T / G;
[0016] The SNP10 is located at the position of 19293029 of CM059463.1, and the allelic gene is G / A;
[0017] The SNP11 is located at the position of 15708961 of CM059464.1, and the allelic gene is G / T;
[0018] The SNP12 is located at the position of 16245322 of CM059465.1, and the allelic gene is T / C;
[0019] The SNP13 is located at the position of 21062230 of CM059466.1, and the allelic gene is G / A;
[0020] The SNP14 is located at the position of 17859502 of CM059467.1, and the allelic gene is A / GA;
[0021] SNP15 is located at position 391564 of CM059468.1, with allele T / C;
[0022] SNP16 is located at position 13115183 of CM059469.1, with allele A / C;
[0023] SNP17 is located at position 7524334 of CM059470.1, with allele G / A;
[0024] SNP18 is located at position 2547686 of CM059471.1, with allele G / A;
[0025] SNP19 is located at position 9926275 of CM059473.1, with allele A / T;
[0026] SNP20 is located at position 8584648 of CM059474.1, with allele T / A;
[0027] SNP21 is located at position 5367990 of CM059475.1, with allele T / C;
[0028] SNP22 is located at position 887366 of CM059476.1, with allele C / T;
[0029] SNP23 is located at position 8044890 of CM059477.1, with allele T / G;
[0030] SNP24 is located at position 2273112 of CM059478.1, with allele T / A;
[0031] SNP25 is located at position 7208087 of CM059479.1, with allele A / G;
[0032] SNP26 is located at position 1046139 of CM059480.1, with allele A / G;
[0033] SNP27 is located at position 2788444 of CM059481.1, with allele G / C;
[0034] SNP28 is located at position 99795 of CM059482.1, with allele T / G;
[0035] SNP29 is located at position 30285535 of CM059493.1, with allele C / A.
[0036] Single Nucleotide Polymorphism (SNP) as the third generation of molecular markers has many advantages compared with the previous genetic markers such as microsatellite. SNP is widely distributed in the genome, can cover the whole genome, provide more comprehensive genetic information, so as to accurately identify whether the individual is the hybrid offspring; its mutation rate is low, and the stability is strong, reduces the identification error caused by genetic marker mutation; at the same time, SNP is easy to type analysis, greatly improves the convenience of experimental operation and the accuracy of the results. Based on the characteristics of SNP, screening the specific SNP of Lophura nycho is of high feasibility and application value. Therefore, the present inventors propose the above SNP marker, by accurately identifying the specific SNP site of the above Lophura nycho, a set of efficient and accurate Lophura nycho species identification system can be established, and the current identification problems caused by Lophura nycho hybridization, chick and female morphological indistinguishable and the like can be effectively solved, and solid technical support is provided for the protection, population monitoring and related scientific research of Lophura nycho.
[0037] In one of the embodiments, SNP1-SNP29 are included.
[0038] The present application also provides a primer set for detecting the SNP marker, the primer set comprising at least one of primer pair 1-primer pair 29, and the primer pair 1-primer pair 29 is as follows:
[0039] The primer pair 1 comprises SEQ ID No. 1, SEQ ID No. 2;
[0040] The primer pair 2 comprises SEQ ID No. 3, SEQ ID No. 4;
[0041] The primer pair 3 comprises SEQ ID No. 5, SEQ ID No. 6;
[0042] The primer pair 4 comprises SEQ ID No. 7, SEQ ID No. 8;
[0043] The primer pair 5 comprises SEQ ID No. 9, SEQ ID No. 10;
[0044] The primer pair 6 comprises SEQ ID No. 11, SEQ ID No. 12;
[0045] The primer pair 7 comprises SEQ ID No. 13, SEQ ID No. 14;
[0046] The primer pair 8 comprises SEQ ID No. 15, SEQ ID No. 16;
[0047] The primer pair 9 comprises SEQ ID No. 17, SEQ ID No. 18;
[0048] Primer pair 10 comprises SEQ ID No. 19, SEQ ID No. 20;
[0049] Primer pair 11 comprises SEQ ID No. 21, SEQ ID No. 22;
[0050] Primer pair 12 comprises SEQ ID No. 23, SEQ ID No. 24;
[0051] Primer pair 13 comprises SEQ ID No. 25, SEQ ID No. 26;
[0052] Primer pair 14 comprises SEQ ID No. 27, SEQ ID No. 28;
[0053] Primer pair 15 comprises SEQ ID No. 29, SEQ ID No. 30;
[0054] Primer pair 16 comprises SEQ ID No. 31, SEQ ID No. 32;
[0055] Primer pair 17 comprises SEQ ID No. 33, SEQ ID No. 34;
[0056] Primer pair 18 comprises SEQ ID No. 35, SEQ ID No. 36;
[0057] Primer pair 19 comprises SEQ ID No. 37, SEQ ID No. 38;
[0058] Primer pair 20 comprises SEQ ID No. 39, SEQ ID No. 40;
[0059] Primer pair 21 comprises SEQ ID No. 41, SEQ ID No. 42;
[0060] Primer pair 22 comprises SEQ ID No. 43, SEQ ID No. 44;
[0061] Primer pair 23 comprises SEQ ID No. 45, SEQ ID No. 46;
[0062] Primer pair 24 comprises SEQ ID No. 47, SEQ ID No. 48;
[0063] Primer pair 25 comprises SEQ ID No. 49, SEQ ID No. 50;
[0064] Primer pair 26 comprises SEQ ID No. 51, SEQ ID No. 52;
[0065] Primer pair 27 comprises SEQ ID No. 53, SEQ ID No. 54;
[0066] Primer pair 28 comprises SEQ ID No. 55, SEQ ID No. 56;
[0067] Primer pair 29 comprises SEQ ID No. 57, SEQ ID No. 58.
[0068] In one embodiment, the primer set comprises primer pair 1-primer pair 29.
[0069] The present application also provides a detection system for species identification of Crossoptilon mantchuricum, comprising an amplification system, wherein the amplification system comprises the primer set.
[0070] The present application also provides a kit for species identification of Crossoptilon mantchuricum, wherein the kit comprises the primer set or the detection system.
[0071] The present application also provides application of the SNP marker, the primer set, the detection system or the kit in species identification of Crossoptilon mantchuricum.
[0072] The present application also provides a method for species identification of Crossoptilon mantchuricum, comprising the following steps: extracting DNA of a sample to be tested, performing PCR amplification by using the primer set, the detection system or the kit, obtaining a PCR amplification product, performing Sanger sequencing on the PCR amplification product, obtaining an amplification target sequence of each SNP site of an individual from which the sample to be tested is derived, comparing the sequence of the PCR amplification product with a reference genome, and obtaining the genotype of the SNP marker.
[0073] In one embodiment, the Sanger sequencing is double-end sequencing, and the primer is the primer set;
[0074] or the following primers are used for Sanger sequencing for SNP1-SNP29:
[0075] SNP1 CTGCTTGAACTCCCCTCCTG;
[0076] SNP2 TTAGGCCATTGGCACTGGAG;
[0077] SNP3 TGACAGAAAGGGGAGCTTCG;
[0078] SNP4 GAGAGCAGTGCAAACTGCAA;
[0079] SNP5 GGGGAAGTGCAAATTTGGGTAG;
[0080] SNP6 CCCAGCCAAAGGAAACTTGC;
[0081] SNP7 TCCCAAGCAACATCTCCACT;
[0082] SNP8 TGAGGATGGCACAGCGAAAT;
[0083] SNP9 AGAAGAGAAGGCTGAGAAGCA;
[0084] SNP10 ATGCAAATGTCCTCCCCTGT;
[0085] SNP11 TGCAGAGTCTCATCCCCACT;
[0086] SNP12 GCAGCAGATGGATGCGTAGT;
[0087] SNP13 CTGCTGCTGCTCTGAGTCAC;
[0088] SNP14 AAACCCTCTGTGAGTCAGCAC;
[0089] SNP15 GGAGGTGAGGGTATCCTGCT;
[0090] SNP16 CGGGTCACCTCGAGTCATTC;
[0091] SNP17 CCAACGTTAGGCAGGCAATG;
[0092] SNP18 TCCTGGGCTGACTCCTTTCT;
[0093] SNP19 CCAAGGCTTGCTGTTGACTG;
[0094] SNP20 CCCTCTCGAGATCCCGTCT;
[0095] SNP21 GCATTCAGAGTGTCTGCTCCT;
[0096] SNP22 TAGCATGGGGACTCCTCAAC;
[0097] SNP23 AACTGAGAGCTCCCCTTCCT;
[0098] SNP24 TGCCAGAGCAGTCAATTCCT
[0099] SNP25 GCTATGCTACTTCGTGCCCT
[0100] SNP26 ACCAACACCAGCCTTTCCAT
[0101] SNP27 TCACCTTGACCAACCTCCAA
[0102] SNP28 AGGCTCCCATACTCTTCCGT
[0103] SNP29 TGCTGAAAGAAATGGGGCTTG.
[0104] In one of the embodiments, the method further comprises judging whether the individual of the sample to be tested is a white pheasant according to the genotype of the SNP marker.
[0105] In one of the embodiments, the SNP marker is represented as allele 1 / allele 2, and the judging comprises: when the genotype of the SNP marker of the individual is homozygote of allele 1, the individual is judged as a white pheasant.
[0106] Compared with the prior art, the present application has the following beneficial effects:
[0107] The SNP marker for white pheasant species identification and the application thereof can effectively solve the identification problems caused by white pheasant crossbreeding, young bird and female bird morphological identification, and provide solid technical support for the protection, population monitoring and related scientific research of white pheasant. DETAILED DESCRIPTION
[0108] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the related embodiments. However, the present application can be implemented in many different forms, and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.
[0109] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terms used in the specification of the present application are only for the purpose of describing the specific embodiments and are not intended to limit the present application.
[0110] Source:
[0111] The reagents, materials and equipment used in this embodiment are commercially available unless otherwise specified. The experimental methods are conventional experimental methods in the art unless otherwise specified.
[0112] Embodiment
[0113] 1. Selection of SNP sites specific to Crossoptilon mantchuricum.
[0114] 1.1 SNP dataset detection.
[0115] To construct a reliable SNP dataset, the experiment extracted DNA from 13 Crossoptilon mantchuricum, 12 Crossoptilon auritum, 6 Crossoptilon formosum and 3 Crossoptilon dukung. (from the endangered wildlife germplasm bank of Guangzhou Zoo), constructed a DNA library, and then performed double-end 150bp sequencing on the Illumina platform. The whole genome resequencing data of each sample was more than 10 Gb. After quality control processing of the original reads data, the BWA software was used to align it to the chromosome level of the Crossoptilon auritum reference genome (NCBI accession number: GCA_030408155.1). Since there is no chromosome level reference genome for Crossoptilon mantchuricum at present, the inventors developed the Crossoptilon auritum chromosome level reference genome, which was then applied to the Crossoptilon mantchuricum genome. The amplified fragments were blast aligned on the Crossoptilon mantchuricum genome, and the sequences had high similarity, so the identification of the Crossoptilon mantchuricum species could be realized. Subsequently, the Samtools software was used to convert the alignment results into bam files, and the Picard software was used to remove duplicate reads. Finally, the HaplotypeCaller and GenotypeGVCFs commands in the Genome Analysis ToolKit software were used for SNP detection, and then the VariantFiltration command was used for quality control. The quality control conditions were set as: “DP<50||DP>1000||QD<2.0||FS>60.0||MQ<40.0||MQRankSum<-12.5||ReadPosRankSum<-8.0||SOR>3.0||QUAL<30.0”, --cluster-size 3 and --cluster-window-size 10, and finally a reliable SNP dataset was obtained. 1.2 SNP site screening.
[0116] The four SNP datasets of the genus Lophura were further screened to select SNP loci suitable for individual identification, with the following screening criteria: (1) the white pheasant genomic homozygous loci do not exist in the other three Lophura species; (2) the 200bp sequence on both sides of the SNP loci is blast compared to the reference genome of the blue pheasant, and only the SNP loci with more than 95% homologous results are retained; (3) there is no insertion and deletion within 200bp on both sides of the SNP loci. According to the above conditions, 29 SNP loci were pre-screened, which were located on 29 chromosomes, and these 29 chromosomes covered the genome. The specific information is shown in Table 1.
[0117] Table 1 Information table of 29 white pheasant specific SNP loci
[0118] SNP site Chromosome Position Allele 1 Allele 2 SNP1 CM059454.1 52783760 A T SNP2 CM059455.1 50674802 G T SNP3 CM059456.1 67434585 G T SNP4 CM059457.1 32909224 C A SNP5 CM059458.1 45463750 C A SNP6 CM059459.1 30596551 A C SNP7 CM059460.1 25720838 A C SNP8 CM059461.1 21092701 T G SNP9 CM059462.1 11770694 T G SNP10 CM059463.1 19293029 G A SNP11 CM059464.1 15708961 G T SNP12 CM059465.1 16245322 T C SNP13 CM059466.1 21062230 G A SNP14 CM059467.1 17859502 A G SNP15 CM059468.1 391564 T C SNP16 CM059469.1 13115183 A C SNP17 CM059470.1 7524334 G A SNP18 CM059471.1 2547686 G A SNP19 CM059473.1 9926275 A T SNP20 CM059474.1 8584648 T A SNP21 CM059475.1 5367990 T C SNP22 CM059476.1 887366 C T SNP23 CM059477.1 8044890 T G SNP24 CM059478.1 2273112 T A SNP25 CM059479.1 7208087 A G SNP26 CM059480.1 1046139 A G SNP27 CM059481.1 2788444 G C SNP28 CM059482.1 99795 T G SNP29 CM059493.1 30285535 C A
[0119] 1.2 PCR amplification of SNP loci.
[0120] In addition, 5 white pheasant, 6 blue pheasant, 3 black pheasant and 4 Thailand fireback pheasant DNA samples (from Guangzhou Zoo Endangered Wildlife Germplasm Bank) were selected to verify the above-mentioned 29 white pheasant specific SNP loci.
[0121] The primers were designed according to the sequences on both sides of the SNP loci, and the detailed information of the primers is shown in Table 2.
[0122] The PCR amplification system was 50μL: 1μL DNA, 25μL PCR Mix (2x), 2μL of forward and reverse primers (10pmol) each, and 20μL ddH2O. The PCR program was: 95℃, 5min; 95℃, 30s, 60℃, 30s, 72℃, 30s, 35 cycles; 72℃, 10min; 4℃ storage.
[0123] The PCR products were subjected to 2% agarose gel electrophoresis, and the PCR products meeting the desired size were sent to Guangzhou Qikao Biotechnology Co., Ltd. for double-end Sanger sequencing.
[0124] Table 2 PCR amplification primer information table of 29 SNP loci
[0125]
[0126]
[0127]
[0128] 1.3 SNP locus analysis.
[0129] After obtaining the double-end sequencing data of each SNP site, the sequencing sequence quality was checked using Chromas software, and the high-quality site sequence was reserved. Then, the double-end sequence was spliced using Mega to obtain the amplification sequence of each SNP site of each individual, and then compared with the reference genome sequence to obtain the genotype of each SNP site. In this embodiment, the representation of the polymorphism of each SNP site is: allele 1 / allele 2.
[0130] The results show that the white pheasant is a homozygote of allele 1 at 29 SNP sites, and the blue pheasant, black pheasant and Thai fireback pheasant are homozygotes of allele 2. That is, when the detection results of the 29 SNP sites are all homozygotes of allele 1, it is judged to be a white pheasant; otherwise, it is judged to be a non-white pheasant or a non-purebred white pheasant. The specific SNP site information is shown in Table 3.
[0131] Table 3 29 specific SNP sites of white pheasant
[0132]
[0133] The above table shows that the 29 SNP sites are specific SNP sites of white pheasant, which can be used to identify whether it is a white pheasant individual, establish a purebred white pheasant population, and provide important technical support for genetic protection of white pheasant species.
[0134] 1.4 Sanger sequencing primer selection.
[0135] In order to further reduce the sequencing cost of identification, the Sanger sequencing primer was screened.
[0136] Among the 29 SNP sites amplified by PCR this time, the forward primers of SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP12, SNP13, SNP14, SNP15, SNP16, SNP18, SNP19, SNP21, SNP23, SNP24, SNP25, SNP26 and SNP29 were used, and the reverse primers of SNP11, SNP17, SNP20, SNP22, SNP27 and SNP28 were used for Sanger sequencing. The obtained SNP site genotype is consistent with the above bidirectional sequencing result, therefore, the Sanger sequencing step can also use a single primer for different sites to obtain effective and reliable SNP site genotype. By adopting this Sanger sequencing primer combination, the sequencing cost can be reduced by half.
[0137] Any combination of the technical features in the above-described embodiments can be made, and for the sake of brevity, not all possible combinations are described, however, as long as the combination of the technical features does not exist in contradiction, it shall be considered within the scope of the present disclosure.
[0138] The above-described embodiments only express several implementation manners of the present application, and the description is relatively specific and detailed, but it shall not be understood as a limitation on the patent scope of the present application. It shall be pointed out that, for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, and these shall be within the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the appended claims.
Claims
1. A SNP marker for identifying the species of Bambusa vulgaris, characterized in that, comprises at least one of SNP1-SNP29, wherein SNP1-SNP29 are as follows: SNP1 is located at position 52783760 of CM059454.1, and the allelic bases are A / T; SNP2 is located at position 50674802 of CM059455.1, and the allelic bases are G / T; SNP3 is located at position 67434585 of CM059456.1, and the allelic bases are G / T; SNP4 is located at position 32909224 of CM059457.1, and the allelic bases are C / A; SNP5 is located at position 45463750 of CM059458.1, and the allelic bases are C / A; SNP6 is located at position 30596551 of CM059459.1, and the allelic bases are A / C; SNP7 is located at position 25720838 of CM059460.1, and the allelic bases are A / C; SNP8 is located at position 21092701 of CM059461.1, and the allelic bases are T / G; SNP9 is located at position 11770694 of CM059462.1, and the allelic bases are T / G; SNP10 is located at position 19293029 of CM059463.1, and the allelic bases are G / A; SNP11 is located at position 15708961 of CM059464.1, and the allelic bases are G / T; SNP12 is located at position 16245322 of CM059465.1, and the allelic bases are T / C; SNP13 is located at position 21062230 of CM059466.1, and the allelic bases are G / A; SNP14 is located at position 17859502 of CM059467.1, and the allelic bases are A / GA; SNP15 is located at position 391564 of CM059468.1, and the allelic bases are T / C; SNP16 is located at position 13115183 of CM059469.1, and the allelic bases are A / C; SNP17 is located at position 7524334 of CM059470.1, and the allelic bases are G / A; SNP18 is located at position 2547686 of CM059471.1, and the allelic bases are G / A; SNP19 is located at position 9926275 of CM059473.1, and the allelic bases are A / T; SNP20 is located at position 8584648 of CM059474.1, and the allelic bases are T / A; SNP21 is located at position 5367990 of CM059475.1, and the allelic bases are T / C; SNP22 is located at position 887366 of CM059476.1, and the allelic bases are C / T; SNP23 is located at position 8044890 of CM059477.1, and the allelic bases are T / G; SNP24 is located at position 2273112 of CM059478.1, and the allelic bases are T / A; SNP25 is located at position 7208087 of CM059479.1, and the allelic bases are A / G; SNP26 is located at position 1046139 of CM059480.1, and the alleles are A / G; SNP27 is located at position 2788444 of CM059481.1, and the alleles are G / C; SNP28 is located at position 99795 of CM059482.1, and the alleles are T / G; SNP29 is located at position 30285535 of CM059493.1, and the alleles are C / A.
2. The SNP marker of claim 1, wherein SNP1-SNP29 are included.
3. A primer set for detecting the SNP marker of any one of claims 1-2, characterized in that, The primer set comprises at least one of primer pair 1-primer pair 29, and the primer pair 1-primer pair 29 is as follows: primer pair 1 comprises SEQ ID No. 1, SEQ ID No. 2; primer pair 2 comprises SEQ ID No. 3, SEQ ID No. 4; primer pair 3 comprises SEQ ID No. 5, SEQ ID No. 6; primer pair 4 comprises SEQ ID No. 7, SEQ ID No. 8; primer pair 5 comprises SEQ ID No. 9, SEQ ID No. 10; primer pair 6 comprises SEQ ID No. 11, SEQ ID No. 12; primer pair 7 comprises SEQ ID No. 13, SEQ ID No. 14; primer pair 8 comprises SEQ ID No. 15, SEQ ID No. 16; primer pair 9 comprises SEQ ID No. 17, SEQ ID No. 18; primer pair 10 comprises SEQ ID No. 19, SEQ ID No. 20; primer pair 11 comprises SEQ ID No. 21, SEQ ID No. 22; primer pair 12 comprises SEQ ID No. 23, SEQ ID No. 24; primer pair 13 comprises SEQ ID No. 25, SEQ ID No. 26; primer pair 14 comprises SEQ ID No. 27, SEQ ID No. 28; primer pair 15 comprises SEQ ID No. 29, SEQ ID No. 30; primer pair 16 comprises SEQ ID No. 31, SEQ ID No. 32; primer pair 17 comprises SEQ ID No. 33, SEQ ID No. 34; primer pair 18 comprises SEQ ID No. 35, SEQ ID No. 36; primer pair 19 comprises SEQ ID No. 37, SEQ ID No. 38; primer pair 20 comprises SEQ ID No. 39, SEQ ID No. 40; primer pair 21 comprises SEQ ID No. 41, SEQ ID No. 42; primer pair 22 comprises SEQ ID No. 43, SEQ ID No. 44; primer pair 23 comprises SEQ ID No. 45, SEQ ID No. 46; primer pair 24 comprises SEQ ID No. 47, SEQ ID No. 48; Primer pair 25 comprises SEQ ID No. 49, SEQ ID No. 50; Primer pair 26 comprises SEQ ID No. 51, SEQ ID No. 52; Primer pair 27 comprises SEQ ID No. 53, SEQ ID No. 54; Primer pair 28 comprises SEQ ID No. 55, SEQ ID No. 56; Primer pair 29 comprises SEQ ID No. 57, SEQ ID No.
58.
4. The primer set of claim 3, wherein, The primer set comprises primer pair 1-primer pair 29.
5. A detection system for the identification of the species of Bambusa vulgaris, characterized by, The detection system comprises an amplification system, and the amplification system comprises the primer set according to any one of claims 3-4.
6. A kit for the identification of the species of Bambusicola sonorivox, characterized in that, The kit comprises the primer set according to any one of claims 3-4 or the detection system according to claim 5.
7. The SNP marker according to any one of claims 1-2, the primer set according to any one of claims 3-4, the detection system according to claim 5 or the kit according to claim 6 is used for species identification of Lophura.
8. A method for identifying the species of a Bornean leaf deer, characterized by, The method comprises the following steps: DNA of the sample to be tested is extracted, and the primer set according to any one of claims 3-4, the detection system according to claim 5 or the kit according to claim 6 is used for PCR amplification to obtain a PCR amplification product, Sanger sequencing is performed on the PCR amplification product to obtain an amplification target sequence of each SNP site of the individual from which the sample to be tested is derived, and the sequence of the reference genome is compared to obtain the genotype of the SNP marker according to any one of claims 1-2.
9. The method of claim 8, wherein, The Sanger sequencing is double-end sequencing, and the primer is the primer set according to any one of claims 3-4; Or the following primers are used for Sanger sequencing for SNP1-SNP29: SNP1 CTGCTTGAACTCCCCTCCTG; SNP2 TTAGGCCATTGGCACTGGAG; SNP3 TGACAGAAAGGGGAGCTTCG; SNP4 GAGAGCAGTGCAAACTGCAA; SNP5 GGGGAAGTGCAAATTTGGGTAG; SNP6 CCCAGCCAAAGGAAACTTGC; SNP7 TCCCAAGCAACATCTCCACT; SNP8 TGAGGATGGCACAGCGAAAT; SNP9 AGAAGAGAAGGCTGAGAAGCA; SNP10 ATGCAAATGTCCTCCCCTGT; SNP11 TGCAGAGTCTCATCCCCACT; SNP12 GCAGCAGATGGATGCGTAGT; SNP13 CTGCTGCTGCTCTGAGTCAC; SNP14 AAACCCTCTGTGAGTCAGCAC; SNP15 GGAGGTGAGGGTATCCTGCT; SNP16 CGGGTCACCTCGAGTCATTC; SNP17 CCAACGTTAGGCAGGCAATG; SNP18 TCCTGGGCTGACTCCTTTCT; SNP19 CCAAGGCTTGCTGTTGACTG; SNP20 CCCTCTCGAGATCCCGTCT; SNP21 GCATTCAGAGTGTCTGCTCCT; SNP22 TAGCATGGGGACTCCTCAAC; SNP23 AACTGAGAGCTCCCCTTCCT; SNP24 TGCCAGAGCAGTCAATTCCT; SNP25 GCTATGCTACTTCGTGCCCT; SNP26 ACCAACACCAGCCTTTCCAT; SNP27 TCACCTTGACCAACCTCCAA; SNP28 AGGCTCCCATACTCTTCCGT; SNP29 TGCTGAAAGAAATGGGGCTTG.
10. The method of claim 8, wherein, The method further comprises judging whether the individual of the sample to be tested is a white pheasant according to the genotype of the SNP marker.
Citation Information
Patent Citations
Genetic marker for silver pheasant identification and application
CN118147319A
Apparatus for predicting life of underground cable
KR102776703B1