Wheat ear length related molecular marker and application thereof
By detecting the SNP loci genotypes in the wheat genome and using CAPS markers to identify the TaSIK1-5A genotype, the problem of wheat spike type improvement was solved, enabling rapid identification and breeding of long-spiked or short-spiked wheat varieties, thus improving breeding efficiency and yield.
Patent Information
- Application Number
- CN202410715575.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-04
- Publication Date
- 2025-12-05
AI Technical Summary
There is a lack of effective methods in the current technology to improve or screen wheat spike type, especially to select materials with shorter spike length and higher spike density to increase wheat yield.
By detecting the genotypes of SNP A and SNP B sites in the wheat genome, the haplotypes of the TaSIK1-5A gene were identified using CAPS markers (combined with PCR and restriction endonucleases Xho I and Hph I), the spike length trait was evaluated, and the TaSIK1-5A-Hap1 and TaSIK1-5A-Hap2 genotypes were developed for breeding long-spiked or short-spiked wheat varieties.
It provides a rapid and accurate method for identifying wheat spike length traits, significantly improving the efficiency of wheat breeding and enabling the development of new varieties with different spike lengths to meet the needs of high-yield breeding.
Smart Images

Figure BDA0004875482600000081 
Figure BDA0004875482600000091 
Figure BDA0004875482600000101
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of molecular markers and their applications, and relates to a wheat ear length-related molecular marker and its application. BACKGROUND
[0002] Wheat is the second largest food crop in China, feeding more than one-third of the population. As the organ supporting the growth of spikelets and grains, the length of the wheat ear axis determines the number and density of spikelets, and is closely related to yield. The length of the ear is also an important indicator in the trade-off of high-yield breeding in modern wheat breeding. In the process of wheat breeding in China, breeders tend to choose materials with shorter ear length and higher ear density.
[0003] Phosphorylation cascade mediates the growth and development of plants, and MAPKs are the most studied phosphorylation cascade signaling pathways. SIK1 encodes a MAP4K3 kinase containing a phosphorylated serine / threonine domain and is highly conserved in evolution. In the model plant Arabidopsis thaliana, SIK1 gene regulates the length and fertility of siliques. Currently, there is no report on the study of wheat TaSIK1 gene. Through homologous comparison of amino acid sequences, three homologous genes TaSIK1-5A / 5B / 5D were obtained in the fifth partial homologous group of wheat chromosomes. The use of molecular markers can improve the breeding efficiency of target traits, and the development of TaSIK1-5A molecular markers can help molecular design breeding and accelerate the breeding process of high-yield wheat. SUMMARY
[0004] The technical problem solved by the present application is how to improve or screen wheat ear type.
[0005] In order to achieve the above technical problem, in a first aspect, the present application provides the use of a substance for detecting the genotype of SNP A site and the genotype of SNP B site in the genome of wheat in any one of the following:
[0006] Alternatively, the present application provides the use of a substance for detecting the haplotype in the genome of wheat in any one of the following:
[0007] 1) identifying or assisting in identifying the wheat ear length trait;
[0008] 2) assisting in breeding long-ear wheat varieties;
[0009] 2) assisting in breeding short-ear wheat varieties;
[0010] The genotype of the SNP A site is AA or TT;
[0011] The genotype of the SNP B site is AA or GG;
[0012] The SNP A site is the 101st in SEQ ID NO: 7;
[0013] the SNP B site is at position 101 of SEQ ID NO: 8;
[0014] the haplotype is a combination of the genotype of the SNP A site and the genotype of the SNP B site in the wheat genome;
[0015] the haplotype is TaSIK1-5A-Hapl or TaSIK1-5A-Hap2;
[0016] the TaSIK1-5A-Hapl is that the genotype of the SNP A site is AA and the genotype of the SNP B site is GG. Type is AA;
[0017] the TaSIK1-5A-Hap2 is that the genotype of the SNP A site is TT and the genotype of the SNP B site is GG.
[0018] In the above-mentioned application, the substance for detecting the haplotype in the wheat genome is a substance for detecting the genotype of the SNP A site and the genotype of the SNP B site in the wheat genome.
[0019] In the above-mentioned application, the substance comprises any one of the following:
[0020] 1) the substance for detecting the genotype of the SNP A site in the wheat genome is a primer for detecting the genotype of the SNP A site and a restriction enzyme Xho I; and the substance for detecting the genotype of the SNP B site in the wheat genome is a primer for detecting the genotype of the SNP B site and a restriction enzyme Hph I;
[0021] the primer for detecting the genotype of the SNP A site consists of a single-stranded DNA molecule shown in SEQ ID NO: 9 or a derivative thereof and a single-stranded DNA molecule shown in SEQ ID NO: 10 or a derivative thereof;
[0022] the primer for detecting the genotype of the SNP B site consists of a single-stranded DNA molecule shown in SEQ ID NO: 11 or a derivative thereof and a single-stranded DNA molecule shown in SEQ ID NO: 12 or a derivative thereof;
[0023] 2) a PCR system containing each primer in 1) and a digestion system containing each restriction enzyme in 1);
[0024] 3) a kit containing each primer, each restriction enzyme in 1).
[0025] The ear length of the wheat whose genotype of SNP A locus is AA and genotype of SNP B locus is AA is greater than or candidate greater than the ear length of the wheat whose genotype of SNP A locus is TT and genotype of SNP B locus is GG; further greater than significantly.
[0026] The ear length of the wheat whose genotype of SNP A locus is AA and genotype of SNP B locus is AA is greater than or candidate greater than the ear length of the wheat whose genotype of SNP A locus is TT and genotype of SNP B locus is GG; further greater than significantly.
[0027] The ear length of the wheat whose genotype of SNP A locus is AA and genotype of SNP B locus is AA is greater than or candidate greater than the ear length of the wheat whose genotype of SNP A locus is TT and genotype of SNP B locus is GG; further greater than significantly.
[0028] The ear length of the wheat whose genotype of SNP A locus is AA and genotype of SNP B locus is AA is greater than or candidate greater than the ear length of the wheat whose genotype of SNP A locus is TT and genotype of SNP B locus is GG; further greater than significantly.
[0029] In a second aspect, the present application provides a method for identifying or assisting in identifying the ear length trait of wheat, which is as follows A or B:
[0030] The method shown in A comprises the following steps:
[0031] Detecting the genotype of SNP A locus and genotype of SNP B locus in the genome of wheat, the ear length of the wheat whose genotype of SNP A locus is TT and genotype of SNP B locus is GG is less than or candidate less than the ear length of the wheat whose genotype of SNP A locus is AA and genotype of SNP B locus is AA; or, the ear length of the wheat whose genotype of SNP A locus is AA and genotype of SNP B locus is AA is greater than or candidate greater than the ear length of the wheat whose genotype of SNP A locus is TT and genotype of SNP B locus is GG;
[0032] the genotype of the SNP the genotype of the SNP
[0033] The genotype of SNP B locus is AA or GG;
[0034] The SNP A locus is 101 of SEQ ID NO: 7;
[0035] The SNP B locus is 101 of SEQ ID NO: 8;
[0036] The method shown in B comprises the following steps:
[0037] The ear length of the wheat with the haplotype of TaSIK1-5A-Hap2 is less than or candidate less than the ear length of the wheat with the haplotype of TaSIK1-5A-Hap1; or the ear length of the wheat with the haplotype of TaSIK1-5A-Hap1 is greater than or candidate greater than the ear length of the wheat with the haplotype of TaSIK1-5A-Hap2;
[0038] The haplotype is a combination of the genotype of the SNP site A and the genotype of the SNP site B in the wheat genome;
[0039] The haplotype is TaSIK1-5A-Hap1 or TaSIK1-5A-Hap2;
[0040] The TaSIK1-5A-Hap1 is that the genotype of the SNP site A is AA and the genotype of the SNP site B is AA;
[0041] The TaSIK1-5A-Hap2 is that the genotype of the SNP site A is TT and the genotype of the SNP site B is GG.
[0042] In the method described above, the detection of the haplotype in the wheat genome is determined by detecting the genotype of the SNP site A and the genotype of the SNP site B in the wheat genome.
[0043] In the method described above,
[0044] The method for detecting the genotype of the SNP site A in the wheat genome is as follows:
[0045] 1) Extracting the wheat genome DNA;
[0046] 2) Using the primer for detecting the genotype of the SNP site A in the first aspect to perform PCR amplification with the genome DNA as the template to obtain the PCR product A;
[0047] 3) Using Xho I to cut the PCR product A, if the size of the cutting product is only 500-600 bp, then the genotype of the SNP site A is AA; if the size of the cutting product is 200-220 bp and 300-330 bp, then the genotype of the SNP site A is TT;
[0048] The method for detecting the genotype of the SNP site B in the wheat genome is as follows:
[0049] 1) Extracting the wheat genome DNA;
[0050] 2) Using the primer for detecting the genotype of the SNP site B in the first aspect to perform PCR amplification with the genome DNA as the template to obtain the PCR product B;
[0051] 3) the PCR product B is digested with Hph I enzyme, if the sizes of the digested products are 360-370 bp and 380-390 bp, the genotype of the SNP B site is AA; if the size of the digested product is only 700-800 bp, the genotype of the SNP B site is GG.
[0052] The 500-600 bp digested product can be 537 bp in the embodiment of the present application, and the nucleotide sequence of the fragment is SEQ ID NO: 1 after sequencing.
[0053] A site is AA or TT; if the size of the enzyme digestion product is 200-220 bp and 300-330 bp, the genotype of the SNP The 500-600 bp digested product can be 537 bp in the embodiment of the present application, and the nucleotide sequence of the fragment is SEQ ID NO: 1 after sequencing.
[0054] The 300-330 bp digested product can be 322 bp in the embodiment of the present application, and the nucleotide sequence of the fragment is SEQ ID NO: 2 after sequencing.
[0055] The 360-370 bp digested product can be 362 bp in the embodiment of the present application, and the nucleotide sequence of the fragment is SEQ ID NO: 4 after sequencing.
[0056] The 380-390 bp digested product can be 385 bp in the embodiment of the present application, and the nucleotide sequence of the fragment is SEQ ID NO: 5 after sequencing.
[0057] The 700-800 bp digested product can be 747 bp in the embodiment of the present application, and the nucleotide sequence of the fragment is SEQ ID NO: 6 after sequencing.
[0058] In a third aspect, the present application provides a method for breeding long spike wheat varieties, comprising the following steps: selecting the wheat with the genotype AA of the SNP A site and the genotype AA of the SNP B site in the second aspect to breed, so as to realize breeding long spike wheat varieties.
[0059] Or selecting the wheat with the haplotype TaSIK1-5A-Hap1 in the second aspect to breed, so as to realize breeding long spike wheat varieties.
[0060] In a fourth aspect, the present application provides a method for breeding short spike wheat varieties, comprising the following steps: selecting the wheat with the genotype TT of the SNP A site and the genotype GG of the SNP B site in the second aspect to breed, so as to realize breeding short spike wheat varieties.
[0061] Or selecting the wheat with the haplotype TaSIK1-5A-Hap2 in the second aspect to breed, so as to realize breeding short spike wheat varieties.
[0062] In a fifth aspect, the present application provides a kit comprising the substance for detecting the genotype of the SNP A site and the genotype of the SNP B site in the wheat genome according to the first aspect.
[0063] The present application has the advantages of:
[0064] (1) The present application is based on the fact that two SNP mutation sites exist in the CDS of TaSIK1-5A gene in a natural population of wheat, and two CAPS markers are developed for identifying the genotypes of TaSIK1-5A-Hap1 and TaSIK1-5A-Hap2, and evaluating the ear length of the material. The ear length of Hap1 is longer, and the ear length of Hap2 is shorter. The two CAPS markers provide genetic resources and molecular markers for the genetic improvement of wheat ear type, and can accelerate the process of wheat breeding.
[0065] (2) The present application provides new markers for molecular marker-assisted breeding of wheat, which can be used for wheat polymer molecular breeding.
[0066] (3) The present application has important theoretical and practical guiding value for breeding new varieties of wheat ear type. BRIEF DESCRIPTION OF DRAWINGS
[0067] Figure 1 Figure 1 is a haplotype diagram of SNP mutation sites of wheat TaSIK1-5A gene.
[0068] Figure 2 Figure 2 is an enzyme digestion verification of TaSIK1-5A-Hap1 and TaSIK1-5A-Hap2, and 1-10 are wheat varieties Yumai No. 2, Yuanzhu, Fan6, Aikang 58, Yandanzhan 4110, Hussar, Am6, Am3, MY5122, and XJ1.
[0069] Figure 3 For Beijing and Yangling, Shaanxi under two environments TaSIK1-5A-Hap1 and TaSIK1-5A-Hap2 Variety average Comparison of ear length. DETAILED DESCRIPTION
[0070] The experimental methods used in the following examples are conventional methods unless otherwise specified.
[0071] The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified. The present application will be specifically described below in combination with the drawings and specific examples.
[0072] Example 1, establishment of haplotype and SNP site and method for identifying ear length
[0073] I. Obtaining of SNP site of TaSIK1-5A gene
[0074] 1. Polymorphism analysis of TaSIK1-5A was performed according to the micro-core germplasm data provided by the wheat multi-omics website, and it was found that TaSIK1-5A (Gene ID: TraesCS5A02G392500, http: / / 202.194.139.32 / cgi-bin / geneDetail.py?search=TraesCS5A02G392500) had one SNP site at the first exon and one SNP site at the 14th exon:
[0075] The first SNP site is named SNP A, which is located on wheat chromosome 5A, and its physical position is 588731569 according to the Chinese Spring genome IWGSCRefSeq v1.1, which is located at a position 518 bp after the ATG of TaSIK1-5A genomic DNA; the SNP site is SEQ ID NO: 7 at position 101, and the genotype of the SNP site is AA, TT or AT;
[0076] The second SNP site is named SNP B, which is located on wheat chromosome 5A, and its physical position is 588737306 according to the Chinese Spring genome IWGSCRefSeq v1.1, which is located at a position 6255 bp after the ATG of TaSIK1-5A genomic DNA; the SNP site is SEQ ID NO: 8 at position 101, and the genotype of the SNP site is AA, GG or AG.
[0077] It was found that the genotypes of the two SNP sites were linked in the diversity materials, and the genotypes of the two SNP sites could be combined into two haplotypes, namely TaSIK1-5A-Hap1 and TaSIK1-5A-Hap2;
[0078] The haplotype TaSIK1-5A-Hap1 has the genotype AA at the SNP A site and the genotype AA at the SNP B site;
[0079] The haplotype TaSIK1-5A-Hap2 has the genotype TT at the SNP A site and the genotype GG at the SNP B site. Figure 1
[0080] 2. Development of molecular markers for SNP sites
[0081] Based on the nucleotide sequence of TaSIK1-5A, genome-specific primers were designed for the above two SNP sites. The designed primers are SNP-5A-518-F / R (used for identifying SNP A site) and SNP-5A-6255-F / R (used for identifying SNP B site), and the sequences are as follows:
[0082] Upstream primer SNP-5A-518-F: GACGACGACGACGACCCTTAC (SEQ ID NO: 9)
[0083] Downstream primer SNP-5A-518-R: CTCCCTAGTAACGCTATCTGGGAG (SEQ ID NO: 10)
[0084] Upstream primer SNP-5A-6255-F: TCATCAGAGAAACAGCTGTGC (SEQ ID NO: 11)
[0085] Downstream primer SNP-5A-6255-R: CCTTCTACACCCTTGTGATGC (SEQ ID NO: 12) ID NO: 12)
[0086] 3. Method for identifying SNP site of TaSIK1-5A gene
[0087] 1) PCR amplification
[0088] PCR amplification product A (product band size 537 bp, molecular marker CAPS-518) and PCR amplification product B (product band size 747 bp, molecular marker CAPS-6255) are obtained by amplifying wheat genomic DNA using the above-mentioned primers SNP-5A-518-F / R and SNP-5A-6255-F / R, respectively;
[0089] 2) Enzymatic digestion
[0090] The above-mentioned PCR amplification product A is cut with restriction enzyme Xho I, and the enzyme digestion product is detected by electrophoresis:
[0091] If the enzyme digestion product band size is only 537 bp, the genotype of SNP A site is AA;
[0092] If the enzyme digestion product band size is 322 bp and 215 bp, the genotype of SNP A site is TT.
[0093] The above-mentioned PCR amplification product B is cut with restriction enzyme Hph I, and the enzyme digestion product is detected by electrophoresis:
[0094] If the enzyme digestion product band size is 362 bp and 385 bp, the genotype of SNP B site is AA;
[0095] If the enzyme digestion product band size is only 747 bp, the genotype of SNP B site is GG.
[0096] The haplotype of the sample to be tested with genotype AA of SNP A site and genotype AA of SNP B site is Hapl;
[0097] The haplotype of the sample to be tested with the genotype of TT at SNP A site and the genotype of GG at SNP B site is Hap2.
[0098] II. Analysis of 431 wheat diversity materials
[0099] Genomic DNA of 431 wheat natural materials was extracted, and different materials were identified by using the amplification primers and corresponding enzyme digestion sites of molecular markers CAPS-518 and CAPS-6255 to obtain haplotypes.
[0100] 1. PCR amplification
[0101] 1) The first SNP site SNP A
[0102] PCR amplification was performed on DNA of different wheat varieties using primers SNP-5A-518-F / SNP-5A-518-R to obtain PCR product A.
[0103] The PCR amplification system was 15 μL, specifically: 7.5 μL 2×Taq PCR Mix, 1.2 μL DNA template (100 ng / μL), 0.3 μL (10 μM) upstream primer, 0.3 μL (10 μM) downstream primer, 5.7 μL ddH2O;
[0104] The PCR amplification program was: 95℃ 4min; 34 cycles: 95℃ 30s, 59℃ 30s, 72℃ 30s; 72℃ extension 5min; after amplification, the amplification product was stored at 4℃.
[0105] 2) The second SNP site SNP B
[0106] PCR amplification was performed on DNA of different wheat varieties using primers SNP-5A-6255-F / SNP-5A-6255-R to obtain PCR product B.
[0107] The PCR amplification system was 15 μL, specifically: 7.5 μL 2×Taq PCR Mix, 1.2 μL DNA template (100 ng / μL), 0.3 μL 10 μM upstream primer, 0.3 μL 10 μM downstream primer, 5.7 μL ddH2O;
[0108] The PCR amplification program was: 95℃ 5min; 34 cycles: 95℃ 30s, 60℃ 30s, 72℃ 30s; 72°C extension for 5 min; End amplification, store at 4°C.
[0109] 2. Enzymatic digestion
[0110] 1) The first SNP site SNP A
[0111] Enzyme digestion of PCR product A was carried out using restriction enzyme Xho I, and the enzyme digestion system was 10 μL, specifically: 1 μL 10 x CutSmart Buffer, 5 μL PCR product A, 0.2 μL restriction enzyme Xho I (20 U / μL), 3.8 μL ddH2O. 37°C enzyme digestion for 12 h, to obtain enzyme digestion product A.
[0112] 2) Second SNP site SNP B
[0113] Enzyme digestion of PCR product B was carried out using restriction enzyme Hph I, and the enzyme digestion system was 10 μL, specifically: 1 μL 10 x CutSmart Buffer, 5 μL PCR product B, 0.2 μL restriction enzyme Hph I (5 U / μL), 3.8 μL ddH2O. 37°C enzyme digestion for 12 h, to obtain enzyme digestion product B.
[0114] 3, Agarose gel electrophoresis
[0115] Enzyme digestion products A2 and B2 were detected by 2% agarose gel, 1 x TAE and 10000 x GelRed nucleic acid dye, to identify whether the two enzyme digestion products were cut into two fragments, and the genotypes of the target SNP sites of different wheat varieties and the haplotypes of the wheat varieties were determined according to the electrophoresis results:
[0116] 1) First SNP site SNP A
[0117] If the enzyme digestion product A is one fragment with a size of 537 bp (SEQ ID NO: 1), the genotype of SNP A site is AA.
[0118] If the enzyme digestion product A is two fragments with sizes of 322 bp and 215 bp (SEQ ID NO: 2 and SEQ ID NO: 3), the genotype of SNP A site is TT.
[0119] 2) Second SNP site SNP B
[0120] If the enzyme digestion product B is two fragments with sizes of 362 bp and 385 bp (SEQ ID NO: 4 and SEQ ID NO: 5) (since the two fragments have little difference in size, the electrophoresis shows close bands), the genotype of SNP B site is AA.
[0121] If the enzyme digestion product B is one fragment with a size of 747 bp (SEQ ID NO: 6), the genotype of SNP B site is GG.
[0122] If the genotype of SNP A site is AA and the genotype of SNP B site is AA, the sample to be tested is TaSIK1-5A-Hap1 haplotype (referred to as Hap1) ;
[0123] If the genotype of SNP A site is TT and the genotype of SNP B site is GG, the sample to be tested is TaSIK1-5A-Hap2 haplotype (referred to as Hap2).
[0124] As shown in the partial enzyme digestion results Figure 2 , 1-10 from left to right represent different varieties, respectively Yumai 2, cylinder, Fan 6, Bainong dwarf 58, Yanzhan 4110, Hussar, Am 6, Am 3, MY5122, XJ1, and the last one is DNA marker band.
[0125] Using the above steps, the haplotype of the 431 natural population materials was typed, and the typing results are shown in Table 1.
[0126] Table 1 is the typing results of TaSIK1-5A gene in 431 wheat materials
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141] Three, correlation analysis of wheat haplotype and spike length trait
[0142] The haplotype data of the TaSIK1-5A gene of 431 wheat materials shown in Table 1 were correlated with the spike length phenotype data of wheat planted in Beijing and Yangling, Shaanxi in 2023. The results are shown in Table 2.
[0143] Table 2 shows the association analysis between haplotype and spikelet length.
[0144]
[0145] Based on the data shown in Table 2, the correlation analysis between haplotype and spikelet length was plotted as follows: Figure 3 The comparison shows: a. Ear length comparison between Beijing Hap1 and Hap2 varieties; b. Ear length comparison between Shaanxi Yangling Hap1 and Hap2 varieties.
[0146] from Figure 3 Association analysis between wheat haplotypes and spike length revealed highly significant differences in average spike length among different haplotypes, with the spike length of haplotype TaSIK1-5A-Hap2 wheat being significantly lower than that of haplotype TaSIK1-5A-Hap1. Specifically, under Beijing growing conditions, the average spike length of haplotype TaSIK1-5A-Hap2 wheat was significantly lower than that of haplotype TaSIK1-5A-Hap1 wheat by 9.31% among 431 diverse materials; under Yangling, Shaanxi growing conditions, the average spike length of haplotype TaSIK1-5A-Hap2 wheat was significantly lower than that of haplotype TaSIK1-5A-Hap1 wheat by 12.34%.
[0147] In summary, the haplotypes identified in this invention are highly correlated with spike length traits in the wheat genome, and can be used to identify wheat spike length traits, thus possessing significant breeding application value. A haplotype is a polymorphism or genotype combination of two variation sites, SNP A and SNP B, in the wheat genome.
[0148] Therefore, wheat spike length can be determined by detecting the genotypes of SNP sites A and B in the wheat genome:
[0149] Wheat with genotype TT at SNP A and genotype GG at SNP B has a spike length that is less than or candidate to be less than wheat with genotype AA at SNP A and genotype AA at SNP B.
[0150] Or, wheat with genotype AA at both SNP A and SNP B has an ear length greater than or candidate to be greater than wheat with genotype TT at both SNP A and SNP B.
[0151] the genotype of the SNP A site is AA or TT;
[0152] the genotype of the SNP B site is AA or GG;
[0153] the SNP A site is the 101st site of SEQ ID NO: 7;
[0154] the SNP B site is the 101st site of SEQ ID NO: 8;
[0155] The wheat ear length trait can also be determined according to detecting haplotype in the wheat genome:
[0156] The ear length of the wheat material with haplotype of TaSIK1-5A-Hap2 is less than or candidate less than the material with haplotype of TaSIK1-5A-Hap1; or the ear length of the wheat material with haplotype of TaSIK1-5A-Hap2 is less than or candidate less than the material with haplotype of TaSIK1-5A-Hap1;
[0157] the haplotype is a combination of the genotype of SNP site A and the genotype of SNP site B in the wheat genome;
[0158] the haplotype is TaSIK1-5A-Hap1 or TaSIK1-5A-Hap2;
[0159] the TaSIK1-5A-Hap1 is that the genotype of the SNP A site is AA and the genotype of the SNP B site is AA;
[0160] the TaSIK1-5A-Hap2 is that the genotype of the SNP A site is TT and the genotype of the SNP B site is GG.
[0161] The above detecting haplotype in the wheat genome is determined by detecting the genotype of the SNP A site and the genotype of the SNP B site in the wheat genome.
[0162] The method for detecting the genotype of SNP A site in the wheat genome is as follows:
[0163] 1) Extracting wheat genome DNA;
[0164] 2) Using SNP-5A-518-F / R to perform PCR amplification with the genome DNA as a template to obtain PCR product A;
[0165] 3) Using Xho I to cut the PCR product A, if the size of the cutting product is 500-600 bp, then the genotype of the SNP A the genotype of the SNP A site is AA; if the size of the enzyme digestion product is 200-220 bp and 300-330 bp, the genotype of the SNP A site point is TT;
[0166] The method for detecting the genotype of SNP B site in the wheat genome is as follows:
[0167] 1) Extracting wheat genome DNA;
[0168] 2) Using SNP-5A-6255-F / R to perform PCR amplification with the genome DNA as a template to obtain a PCR product B;
[0169] 3) Using Hph I to cut the PCR product B, if the size of the cutting product is 360-370bp and 380-390bp, then the genotype of the SNP B site is AA; if the size of the cutting product is 700-800bp, then the genotype of the SNP B site is GG.
[0170] It should be noted that the above embodiments of the present application are only examples for clearly illustrating the present application, and are not intended to limit the embodiments of the present application. Based on the above description, other different forms of changes or variations can be made by those skilled in the art. It is impossible to enumerate all the embodiments here. Any obvious changes or variations derived from the technical scheme of the present application are still within the protection scope of the present application.
Claims
1. Use of a substance for detecting genotypes of SNP site A and genotypes of SNP site B in a wheat genome in any one of the following: Or, use of a substance for detecting haplotype in a wheat genome in any one of the following: 1) identifying or assisting in identifying a wheat ear length trait; 2) assisting in breeding a long-ear wheat variety; 2) assisting in breeding a short-ear wheat variety; the genotype of the SNP site A is AA or TT; the genotype of the SNP site B is AA or GG; the SNP site A is at position 101 of SEQ ID NO: 7; the SNP site B is at position 101 of SEQ ID NO: 8; the haplotype is a combination of the genotype of the SNP site A and the genotype of the SNP site B; the haplotype is TaSIK1-5A-Hapl or TaSIK1-5A-Hap2; the TaSIK1-5A-Hapl is that the genotype of the SNP site A is AA and the genotype of the SNP site B is AA; the TaSIK1-5A-Hap2 is that the genotype of the SNP site A is TT and the genotype of the SNP site B is GG.
2. The use according to claim 1, wherein: the substance for detecting haplotype in a wheat genome is a substance for detecting genotypes of the SNP site A and genotypes of the SNP site B in a wheat genome.
3. The use according to claim 1 or 2, wherein: the substance comprises any one of the following: 1) primers for detecting the genotype of the SNP site A and restriction enzyme Xho I; the substance for detecting genotypes of SNP site B in a wheat genome is primers for detecting the genotype of the SNP site B and restriction enzyme Hph I; the primers for detecting the genotype of the SNP site A consist of a single-stranded DNA molecule represented by SEQ ID NO: 9 or a derivative thereof and a single-stranded DNA molecule represented by SEQ ID NO: 10 or a derivative thereof; the primers for detecting the genotype of the SNP site B consist of a single-stranded DNA molecule represented by SEQ ID NO: 11 or a derivative thereof and a single-stranded DNA molecule represented by SEQ ID NO: 12 or a derivative thereof; 2) a PCR system containing each primer in 1) and a digestion system containing each restriction enzyme in 1); 3) a kit containing each primer, each restriction enzyme in 1).
4. A method for identifying or assisting in identifying a wheat ear length trait, which is A or B as follows: the method of A comprises the following steps: the ear length of the wheat whose genotype of SNP A site is TT and genotype of SNP B site is GG is less than or candidate less than the ear length of the wheat whose genotype of SNP A site is AA and genotype of SNP B site is AA; or, the ear length of the wheat whose genotype of SNP A site is AA and genotype of SNP B site is AA is greater than or candidate greater than the ear length of the wheat whose genotype of SNP A site is TT and genotype of SNP B site is GG; the genotype of the SNP A site is AA or TT; the genotype of the SNP B site is AA or GG; the SNP A site is 101th in SEQ ID NO: 7; the SNP B site is 101th in SEQ ID NO: 8; the method shown in B comprises the following steps: detecting haplotype in the wheat genome, the ear length of the wheat whose haplotype is TaSIK1-5A-Hap2 is less than or candidate less than the ear length of the wheat whose haplotype is TaSIK1-5A-Hap1; or the ear length of the wheat whose haplotype is TaSIK1-5A-Hap1 is greater than or candidate greater than the ear length of the wheat whose haplotype is TaSIK1-5A-Hap2; the haplotype is a combination of genotype of SNP site A and genotype of SNP site B in the wheat genome; the haplotype is TaSIK1-5A-Hap1 or TaSIK1-5A-Hap2; the TaSIK1-5A-Hap1 is that the genotype of the SNP A site is AA and the genotype of the SNP B site is AA; the TaSIK1-5A-Hap2 is that the genotype of the SNP A site is TT and the genotype of the SNP B site is GG.
5. The method of claim 4, wherein: the detecting haplotype in the wheat genome is determined by detecting genotype of the SNP A site and genotype of the SNP B site in the wheat genome.
6. The method of claim 4 or 5, wherein: the method for detecting genotype of SNP A site in the wheat genome is as follows: 1) extracting wheat genome DNA; 2) using the primer for detecting genotype of SNP A site in claim 3 to perform PCR amplification with the genome DNA as template, to obtain PCR product A; 3) using Xho I to cut the PCR product A, if the size of the cutting product is 500-600bp, then the genotype of the SNP A site is AA; if the size of the cutting product is 200-220bp and 300-330bp, then the genotype of the SNP A site is TT; the method for detecting genotype of SNP B site in the wheat genome is as follows: 1) extracting wheat genome DNA; 2) using the primer for detecting genotype of SNP B site in claim 3 to perform PCR amplification with the genome DNA as template, to obtain PCR product B; 3) the PCR product B is digested by Hph I enzyme, if the size of the digested product is 360-370 bp and 380-390 bp, the genotype of the SNP B site is AA; if the size of the digested product is 700-800 bp, the genotype of the SNP B site is GG.
7. A method for breeding long spike wheat variety, comprising the following steps: selecting the wheat with the genotype AA of the SNP A site and the genotype AA of the SNP B site in any one of claims 4-6 to breed, so as to realize breeding long spike wheat variety. Or selecting the wheat with the haplotype TaSIK1-5A-Hap1 in any one of claims 4-6 to breed, so as to realize breeding long spike wheat variety.
8. A method for breeding short spike wheat variety, comprising the following steps: selecting the wheat with the genotype TT of the SNP A site and the genotype GG of the SNP B site in any one of claims 4-6 to breed, so as to realize breeding short spike wheat variety. Or selecting the wheat with the haplotype TaSIK1-5A-Hap2 in any one of claims 4-6 to breed, so as to realize breeding short spike wheat variety.
9. A kit, comprising the material for detecting the genotype of the SNP A site and the genotype of the SNP B site in the wheat genome in any one of claims 1-3.