Target, kit and method for discriminating brucella vaccine strains from wild strains

By designing specific nucleotide and crRNA compositions using CRISPR/Cas12a and RPA amplification technologies, rapid and efficient typing detection of Brucella vaccine strains and wild-type strains was achieved. This solves the problems of difficulty in differentiation and complexity of field testing in existing technologies, and is suitable for field testing of multiple types of samples and large-scale epidemiological surveys.

CN121087202BActive Publication Date: 2026-02-24AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE) +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511639891.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-11
Publication Date
2026-02-24
Estimated Expiration
2045-11-11

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and easily distinguish between Brucella vaccine strains and wild strains. Traditional detection methods have a high false positive rate and are not suitable for on-site testing. Existing nucleic acid testing equipment is complex and time-consuming, and cannot meet the rapid testing needs of pastures and other on-site environments.

Method used

By employing CRISPR/Cas12a technology combined with recombinase polymerase amplification (RPA) technology, specific nucleotide and crRNA compositions were designed for the detection of Brucella vaccine strains and wild-type strains. Rapid and efficient typing detection was achieved through multiplex RPA amplification and CRISPR/Cas12a detection.

Benefits of technology

It achieves efficient and accurate identification of Brucella positive samples in complex vaccination contexts, and can complete multi-target amplification and typing detection within 35 minutes with a sensitivity of 5 copies/μL. It is suitable for rapid on-site screening in farms, slaughterhouses, and regulatory ports, and is compatible with pooled sample detection strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121087202B_ABST
    Figure CN121087202B_ABST
Patent Text Reader

Abstract

The present application provides a target point, a kit and a method for identifying Brucella vaccine strains and wild strains. The present application obtains a specific nucleotide sequence capable of specifically distinguishing Brucella vaccine strains and wild strains through a large number of research and analysis, which can be used as an effective target point for identifying Brucella vaccine strains and wild strains. The present application also provides a primer composition for multiplex RPA amplification of the target point, and a crRNA composition for detecting the specific nucleotide sequence based on the CRISPR / Cas12a technology. Using the crRNA composition for CRISPR / Cas12a detection of the product of the multiplex RPA amplification, the multiplex amplification and typing detection can be quickly and efficiently (about 35 min) completed, and the minimum detection limit is 5 copies / μL, which has good specificity and sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, and relates to the detection of Brucella, and in particular to targets, reagent kits and methods for differentiating Brucella vaccine strains from wild strains. Background Technology

[0002] Brucellosis is a zoonotic infectious disease caused by bacteria of the genus Brucella. Animals infected with Brucella typically exhibit clinical symptoms such as abortion, infertility, and orchitis, leading to a significant decline in livestock productivity. Humans can also become infected through direct contact with the bodily fluids of infected animals, ingestion of contaminated animal products, or inhalation of aerosols. Clinical symptoms are diverse and nonspecific, easily confused with other diseases.

[0003] Currently, Brucella prevention and control primarily rely on vaccination and culling of infected animals. Commonly used Brucella vaccine strains include live attenuated strains such as S2, A19, and M5, which have played a crucial role in controlling the spread of brucellosis. However, antibodies produced in animals after vaccination are often difficult to distinguish from the immune response caused by natural infection. Traditional serological testing methods (such as the Rose Bengal test and serum agglutination test) have significant false-positive rates, severely impacting source tracing analysis.

[0004] Furthermore, while existing nucleic acid detection methods (such as PCR and qPCR) possess high sensitivity and specificity, they are limited by factors such as complex equipment, long testing cycles, and high operator skill requirements, making them unsuitable for rapid testing needs in pastures and other field environments. Therefore, there is an urgent need for a simple, rapid molecular diagnostic technology capable of distinguishing between vaccine strains and wild-type Brucella infections for rapid on-site detection and large-scale epidemiological investigations. Summary of the Invention

[0005] Based on this, the purpose of this invention is to provide a target, reagent kit, and method for identifying Brucella vaccine strains and wild-type strains, which can achieve rapid, efficient, and on-site identification of Brucella vaccine strains and wild-type strains.

[0006] To achieve the above objectives, the present invention adopts the following technical solution.

[0007] A first aspect of the present invention provides a nucleotide composition comprising at least one of groups A and C, and groups B and D:

[0008] Group A: Specific nucleotides of wild-type Brucella, the sequence of which is shown in SEQ ID NO. 1;

[0009] Group B: Specific nucleotides of the A19 vaccine strain, the sequence of which is shown in SEQ ID NO. 6;

[0010] Group C: Specific nucleotides of the S2 vaccine strain, including nucleotides with sequences as shown in SEQ ID NO. 13 and / or SEQ ID NO. 14;

[0011] Group D: Specific nucleotides of the M5-90Δ26 vaccine strain, the sequence of which is shown in SEQ ID NO. 15.

[0012] In some embodiments, the nucleotide composition comprises groups A, B, C, and D.

[0013] A second aspect of the invention provides the use of the nucleotide composition described above as a detection target in distinguishing between Brucella vaccine strains and wild-type strains.

[0014] A third aspect of the invention provides the use of reagents for detecting the levels of the nucleotide composition described above in the preparation of kits for differentiating Brucella vaccine strains from wild-type strains.

[0015] In some embodiments, the reagent comprises a crRNA composition for CRISPR / Cas12a detection.

[0016] In some embodiments, the crRNA composition comprises the following (1) to (4):

[0017] (1) a crRNA for detecting specific nucleotides of wild-type Brucella, said crRNA comprising at least one of the crRNAs with sequences shown in SEQ ID NO. 16, 19 and 21;

[0018] (2) A crRNA for detecting specific nucleotides of the A19 vaccine strain, the sequence of which is shown in SEQ ID NO.27;

[0019] (3) a crRNA for detecting specific nucleotides of the S2 vaccine strain, said crRNA comprising at least one of the crRNAs with sequences as shown in SEQ ID NO. 34-35;

[0020] (4) crRNA for detecting specific nucleotides of the M5-90Δ26 vaccine strain, said crRNA comprising at least one of the crRNAs with sequences shown in SEQ ID NO. 36, 37 and 39.

[0021] A fourth aspect of the invention provides a kit for distinguishing between Brucella vaccine strains and wild-type strains, the kit comprising reagents for detecting the levels of the nucleotide composition described above.

[0022] In some embodiments, the reagent comprises a crRNA composition for CRISPR / Cas12a detection.

[0023] In some embodiments, the crRNA composition comprises the following (1) to (4):

[0024] (1) a crRNA for detecting specific nucleotides of wild-type Brucella, said crRNA comprising at least one of the crRNAs with sequences shown in SEQ ID NO. 16, 19 and 21;

[0025] (2) A crRNA for detecting specific nucleotides of the A19 vaccine strain, the sequence of which is shown in SEQ ID NO.27;

[0026] (3) a crRNA for detecting specific nucleotides of the S2 vaccine strain, said crRNA comprising at least one of the crRNAs with sequences as shown in SEQ ID NO. 34-35;

[0027] (4) crRNA for detecting specific nucleotides of the M5-90Δ26 vaccine strain, said crRNA comprising at least one of the crRNAs with sequences shown in SEQ ID NO. 36, 37 and 39.

[0028] In some embodiments, the kit further includes an RPA amplification primer composition comprising primer pairs 1-4 as follows:

[0029] Primer pair 1: an upstream primer and a downstream primer for specific nucleotides against wild-type Brucella, wherein the sequence of the upstream primer is shown in SEQ ID NO. 41 and the sequence of the downstream primer is shown in SEQ ID NO. 46;

[0030] Primer pair 2: an upstream primer and a downstream primer for A19 vaccine strain-specific nucleotides, wherein the sequence of the upstream primer is shown in SEQ ID NO. 52 and the sequence of the downstream primer is shown in SEQ ID NO. 55;

[0031] Primer pair 3: an upstream primer and a downstream primer for S2 vaccine strain-specific nucleotides, wherein the sequence of the upstream primer is shown in SEQ ID NO. 59 and the sequence of the downstream primer is shown in SEQ ID NO. 60;

[0032] Primer pair 4: an upstream primer and a downstream primer for M5-90Δ26 vaccine strain-specific nucleotides, the sequence of which is shown in SEQ ID NO. 65 and the sequence of which is shown in SEQ ID NO. 68.

[0033] A fifth aspect of the present invention provides a method for non-diagnostic identification of Brucella vaccine strains and wild-type strains, comprising the steps of: detecting the level of the nucleotide composition described above in the test sample using a kit as described above.

[0034] In some embodiments, the method includes the following steps: (1) performing multiple RPA reactions on the test sample using the RPA amplification primer composition to obtain amplification products; and (2) detecting the amplification products using the crRNA composition.

[0035] In some embodiments, the final concentration of each upstream primer in the RPA amplification primer composition in the multiplex RPA reaction system is 20 pmol to 30 pmol.

[0036] In some embodiments, the final concentration of each downstream primer in the RPA amplification primer composition in the multiplex RPA reaction system is 20 pmol to 30 pmol.

[0037] Through extensive research and analysis, this invention has obtained specific nucleotide sequences that can distinguish between Brucella vaccine strains (A19, S2, M5-90Δ26) and wild-type strains. Using these specific nucleotide sequences as detection targets, the source of Brucella positive samples can be identified in the context of complex vaccination, distinguishing between "wild-type virus infection" and "vaccine residues", enabling efficient and accurate Brucella detection.

[0038] The present invention also provides a crRNA composition for detecting the specific nucleotide sequence based on CRISPR / Cas12a technology, wherein the crRNA composition can achieve high sensitivity and specificity detection of the specific nucleotide sequence.

[0039] Furthermore, this invention provides an RPA amplification primer composition capable of simultaneously amplifying detection targets of wild-type, A19, S2, and M5-90Δ26 vaccine strains in the same system. The primers in this composition do not interfere with each other or exhibit non-specific binding, ensuring the accuracy of multiplex amplification. Using the crRNA composition of this invention to detect the products of the multiplex RPA amplification using CRISPR / Cas12a allows for rapid and efficient (approximately 35 minutes) multi-target amplification and genotyping detection, with a limit of detection of 5 copies / μL.

[0040] This invention solves the problems of difficulty in distinguishing between Brucella vaccine strains and wild strains, and the complexity and time-consuming nature of on-site testing in existing technologies. It provides a simple, efficient, and low-cost on-site Brucella typing test solution, which is particularly suitable for rapid on-site screening scenarios such as farms, slaughterhouses, and regulatory ports. It can also be used for on-site testing and large-scale Brucella screening of various types of samples such as milk, meat, vaginal secretions, and aborted fetal tissue. Furthermore, it is compatible with pooled sample testing strategies and has significant practical application value within the "One Health" framework. Attached Figure Description

[0041] Figure 1 The results show the detection results of different crRNAs for each vaccine strain.

[0042] Figure 2 The results are from the detection of the multiplex RPA amplification system combined with the CRISPR / Cas12a detection system.

[0043] Figure 3 This represents the lowest detection limit for single-tube multiplex RPA-Cas12a detection.

[0044] Figure 4 The results are for a simulated sample.

[0045] Figure 5 This is a comparison of the detection method of the present invention with other detection methods.

[0046] Figure 6 The results are for the pooled sample.

[0047] Figure 7 This invention relates to the single-tube multiple RPA-Cas12a detection principle.

[0048] Figure 8 This is a comparison diagram of the present invention with other detection methods. Detailed Implementation

[0049] Experimental methods in the following embodiments of the present invention, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. All commonly used chemical reagents used in the embodiments are commercially available products.

[0050] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0051] The terms "comprising" and "having," and any variations thereof, are intended to cover non-exclusive inclusion. For example, a process, method, apparatus, product, or device that includes a series of steps is not limited to the steps or modules listed, but may optionally include steps not listed, or may optionally include other steps inherent to such process, method, product, or device.

[0052] The term "and / or" as used in this invention describes the relationship between related objects, indicating that there can be three relationships. For example, A and / or B can represent three situations: A exists alone, A and B exist simultaneously, and B exists alone.

[0053] Terminology Explanation

[0054] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0055] Brucella

[0056] This refers to bacteria belonging to the genus Brucella, including common zoonotic species such as B. abortus, B. melitensis, and B. suis.

[0057] vaccine strain

[0058] This refers to Brucella strains that have been attenuated or genetically modified for immunization, such as S2, A19, and M5-90Δ26. In this invention, vaccine strains specifically refer to live or attenuated vaccines used for animal immunization.

[0059] wild strain

[0060] This refers to naturally occurring pathogenic strains of Brucella that have not undergone artificial attenuation or modification, and can cause natural infection in animals or humans.

[0061] RPA (Recombinase Polymerase Amplification)

[0062] An isothermal amplification technique is used to rapidly amplify a target DNA sequence at 37–42°C using recombinase, single-stranded binding protein, and DNA polymerase.

[0063] CRISPR / Cas12a detection system

[0064] This refers to a nucleic acid detection technology that uses the Cas12a protein and specific crRNA to identify target DNA and generates a fluorescent signal by non-specifically cleaving reporter molecules.

[0065] crRNA (CRISPR RNA)

[0066] A short RNA molecule used to guide Cas12a in recognizing target sequences, consisting of direct repeat sequences and spacer sequences.

[0067] In this article, the term "Cas12a" refers to the endonuclease in the CRISR system, which is characterized by both cis and trans single-stranded DNA cleavage activities.

[0068] In this paper, the term "reporter molecule" refers to an oligonucleotide with both a fluorescent group and a quencher group that produces a detectable fluorescent signal after nonspecific cleavage by Cas12a.

[0069] The following description is based on specific embodiments.

[0070] Example 1: Construction and Alignment of Target Sequence Library

[0071] 1. Collection and alignment of whole genome sequences

[0072] The complete genome sequences of Brucella bacteria published up to March 2025 were downloaded from global databases, covering *B. abortus* (including the A19 vaccine strain and isolates from multiple locations), *B. suis* (including the S2 vaccine strain and isolates from multiple locations), and *B. melitensis* (including the M5-90Δ26 vaccine strain and isolates from multiple locations). Functional annotation was performed using eggNOG-mapper (v2.1.9), and rapid sequence alignment was performed using Diamond. SNP sites were identified using BCFtools (v1.16), and candidate specific fragments with discriminative ability were screened. The reference annotation database for alignment analysis was the eggNOG bacterial database. The following two categories of candidate target sequences were obtained:

[0073] Universally conserved fragment: Completely conserved in all Brucella genomes and has no homologous sequence in closely related bacteria;

[0074] Vaccine strain-specific fragments: These fragments are only present in the corresponding vaccine strains and their derived sequences of Brucella suis str. S2 (abbreviated as S2), Brucella suis str. A19 (abbreviated as A19), and Brucella suis str. M5-90Δ26 (abbreviated as M5-90Δ26), while they are absent or show significant SNP differences in wild-type strains.

[0075] The specific strains of Brucella whose complete genomes were downloaded are shown in Table 1 below:

[0076] Table 1

[0077]

[0078] After extensive analysis and screening, the following detection targets were obtained.

[0079] The nucleotide sequence of the target BCSP31 is as follows:

[0080] SEQ ID NO. 1: GCTCGGTTGCCAATATCAATGCGATCAAGTCGGGCGCTCTGGAGTCCGGCTTTACGCAGTCAGACGTTGCCTATTGGGCCTATAACGGCACCGGCCTTTATGATGGCAAGGGCAAGGTGGAAGATTTGCGCCTTCTGGCGACGCTTTACCCGGAAACGATCCATATCGTTGCGCGTAAGGATGCAAACATCAAATCGGTCGCAGACCTGAAAGGCAAGCGCG.

[0081] The specific targets of the A19 vaccine strain and the S2 vaccine strain are shown in Tables 2 and 3 below, respectively:

[0082] Table 2

[0083]

[0084] Table 3

[0085]

[0086] The nucleotide sequence of the specific target of the M5-90Δ26 vaccine strain is as follows:

[0087] SEQ ID NO. 15:

[0088] 2. Establishment of the target library

[0089] The selected candidate sequences are uniformly numbered and stored in the Brucella target database of this invention, including: 1 universal detection target sequence (220bp); 6 S2 specific target sequences; 7 A19 specific target sequences; and 1 M5-90Δ26 specific target sequence (801bp), for subsequent wild-type strain identification studies in the context of vaccines.

[0090] Example 2: Design and Screening of crRNA Probes

[0091] Based on the target library established in Example 1, in order to achieve efficient identification of vaccine strain-specific targets and wild-type Brucella targets, this example designed and screened a variety of crRNA probes.

[0092] (1) Design and synthesis of crRNA sequences

[0093] Based on the specific target sequences of each vaccine strain (S2, A19, M5-90Δ26) and their corresponding wild-type strain-specific sequences obtained from the study and screening in Example 1, a variety of crRNA sequences that are completely complementary to the target fragments were designed. To ensure the recognition effect of the CRISPR / Cas12a system, priority was given to selecting target sites containing typical TTTV (V=A / C / G) PAM sites, and the probe sites were ensured to have good sequence conservation and specificity in the target sequence. This example studied a variety of crRNAs, and the following crRNA sequences are used for comparison and illustration.

[0094] The crRNA sequences targeting the BCSP31 sequence are shown in Table 4:

[0095] Table 4

[0096]

[0097] Table 5 shows the crRNA sequences targeting the A19-specific target sequence:

[0098] Table 5

[0099]

[0100] The crRNA sequences targeting the S2 specific target sequence are shown in Table 6:

[0101] Table 6

[0102]

[0103] The crRNA sequences targeting the M5-90Δ26 specific target sequence are shown in Table 7:

[0104] Table 7

[0105]

[0106] The crRNA sequence was synthesized using GenScript (Nanjing, Jiangsu).

[0107] (2) Construction and screening of CRISPR / Cas12a in vitro fluorescence reaction system

[0108] The synthesized crRNA and Cas12a protein were used together on the target DNA template to construct a 20 μL in vitro fluorescence reaction system, the specific composition of which is as follows:

[0109] Cas12a protein: 200 ng;

[0110] crRNA: 1 pmol;

[0111] NEBuffer r3.1: 2μL (10×);

[0112] RNase inhibitor: 0.1 μL;

[0113] Reporter probe (FAM-TTATT-BHQ1): 25 pmol;

[0114] Template DNA: PCR purified product diluted to 10 10 copies / μL;

[0115] Nuclease-free water: Add to total volume.

[0116] The reaction was carried out at 38°C, and the fluorescence signal was recorded using a real-time fluorescence PCR instrument at 1-minute intervals. The total reaction time was 30 minutes.

[0117] The template DNA described above was a diluted and quantified product of an inactivated vaccine strain (provided by Harbin Veterinary Research Institute) after PCR amplification, recovery, and purification. The PCR amplification conditions were: 94℃, 3 min; 94℃, 1 min; 55℃, 30 s; 40 cycles; 72℃, 30 s. A 25 μL amplification reaction system was prepared, consisting of: upstream primer: 1 μL; downstream primer: 1 μL; template: 1 μL; Premix Taq: 12.5 μL; nuclease-free water: 9.5 μL. After thorough mixing, the system was briefly centrifuged to remove any residue from the tube wall, and then the reaction was performed to obtain the PCR product. The template DNA in the CRISPR system was then purified and recovered using a DiaSpin column-based DNA gel extraction kit (Sangon Biotech Shanghai).

[0118] The primers used for PCR amplification are shown in Table 8. All primers were synthesized by Sangon Biotech (Shanghai).

[0119] Table 8 Amplification Primer Table

[0120]

[0121] (3) Screening criteria and results

[0122] The signal-to-noise ratio (S / N) and peak fluorescence intensity were used as the main indicators for screening crRNA probes. Among the candidate crRNAs, probes with an S / N > 5, high fluorescence intensity, and low background noise were considered qualified.

[0123] The detection results of different crRNAs of each vaccine strain are as follows: Figure 1 As shown. By Figure 1 It can be seen that B-cr1, B-cr4, and B-cr6 have better detection effects on BCSP31; A-cr5 has better detection effects on the specific site of A19 vaccine strain; S-cr5 and S-cr6 have better detection effects on the specific site of S2 vaccine strain; and M-cr1, M-cr2, and M-cr4 have better detection effects on the specific site of M5-90Δ26 vaccine strain.

[0124] Finally, crRNAs that could stably recognize specific sites of vaccine strains S2, A19, and M5-90Δ26, as well as specific sequences of wild-type Brucella, were selected. All systems exhibited good sequence specificity and did not show significant non-specific reactions with non-target sequences.

[0125] In subsequent studies, the detection of BCSP31 was performed using a mixture of B-cr1, B-cr4, and B-cr6; the detection of specific sites in the A19 vaccine strain was performed using A-cr5; the detection of specific sites in the S2 vaccine strain was performed using a mixture of S-cr5 and S-cr6; and the detection of specific sites in the M5-90Δ26 vaccine strain was performed using a mixture of M-cr1, M-cr2, and M-cr4.

[0126] Example 3: Optimization and Compatibility Analysis of Multiple RPA Amplification Systems

[0127] To achieve rapid and specific amplification of target nucleic acid fragments, this invention constructs and optimizes an isothermal amplification system suitable for Brucella target amplification based on recombinase polymerase amplification (RPA) technology, and verifies its high compatibility with the CRISPR / Cas12a system.

[0128] To achieve simultaneous detection of Brucella vaccine strains and wild-type strains, four primer pairs amplifying the detection targets of BCSP31, S2, A19, and M5-90 vaccine strains were introduced into a single-tube reaction to construct a multiplex amplification system. Optimization of primer concentrations enabled efficient amplification of multiple targets within the same reaction system. This was combined with a downstream CRISPR / Cas12a detection system (single-tube multiplex amplification-Cas12a detection). By introducing the multiplex amplification products into four separate CRISPR / Cas12a detection systems (each targeting the crRNA of A19, S2, M5-90Δ26, and BCSP31), and recording signal changes in a fluorescence reading device, simultaneous determination of different Brucella targets was achieved.

[0129] (1) Primer design

[0130] Based on the specific target regions screened in Examples 1 and 2, multiple primer pairs were designed using Primer3 software.

[0131] All primers were synthesized by Sangon Biotech (Shanghai).

[0132] To effectively achieve multiplex amplification, this embodiment designed a large number of primers for the detection targets of BCSP31, S2, A19, and M5-90Δ26 vaccine strains. The primer pairs shown in Table 9 below are used as examples for comparison and illustration:

[0133] Table 9. Amplification Primers

[0134]

[0135] (2) Construction of multiplex amplification reaction system

[0136] The multiplex amplification reaction was performed using the GenDx RPA kit. The specific composition of the 50 μL reaction system is as follows:

[0137] 1 lyophilized reaction ball;

[0138] Each upstream primer (10 μM): 25 pmol;

[0139] Each downstream primer (10 μM): 25 pmol;

[0140] Activator: 2 μL;

[0141] Template DNA: 1–2 μL (PCR product diluted to 10 μL) 4 (copies / μL)

[0142] Nuclease-free water: Add to total volume.

[0143] The reaction was terminated after incubation at 42°C for 25 minutes, and the amplification product was directly transferred into the CRISPR detection system constructed in Example 2.

[0144] (3) Screening results

[0145] Through continuous combination, optimization, and analysis of primer pairs, the optimal multiplex amplification primers were finally obtained, including: primer pairs for BCSP31: upstream primer F1 and downstream primer R1; primer pairs for the A19 vaccine strain-specific sequence: upstream primer F2 and downstream primer R2; primer pairs for the S2 vaccine strain-specific sequence: upstream primer F3 and downstream primer R1; and primer pairs for the M5-90Δ26 vaccine strain-specific sequence: upstream primer F3 and downstream primer R3. Table 10 below shows some examples of multiplex primer combinations for illustration.

[0146] Table 10

[0147]

[0148] As shown in Table 10, when multiplex amplification was performed using primer combinations consisting of the four primer pairs BCSP31-F1R1, A19-F2R2, S2-F3R1, and M5-90Δ26-F3R3, the strongest detection signals were obtained in subsequent CRISPR detection of BCSP31, S2, A19, and M5-90Δ26.

[0149] The detection limit for single-tube multiplex amplification of the above primer composition was found to be 5 copies / μL. Figure 2 It has a very high detection sensitivity.

[0150] (4) The multiplex amplification system has good amplification compatibility and target resolution.

[0151] Single positive sample (e.g., containing only A19 DNA): only the A19 and BCSP31 channels produce fluorescence;

[0152] Mixed vaccine samples (containing A19, S2, and M5-90Δ26): all channels showed positive signals;

[0153] Blank control: No fluorescence signal was output in any of the three channels.

[0154] The results are as follows Figure 3 As shown, the results demonstrate that the multiplex amplification system has good amplification compatibility and target resolution, and is suitable for simultaneous target detection in complex background samples.

[0155] Example 4: Simulated Sample Detection and Verification

[0156] To verify the application value of the multiplex amplification-CRISPR / Cas12a detection system constructed in this invention in a clinical sample environment, a detection experiment was conducted using simulated infected samples to simulate the complex background of on-site samples and evaluate the actual detection capability, accuracy and stability of the system.

[0157] (1) Construction of simulated samples

[0158] Brucella suis S2, Brucella abortus A19, Brucella melitensis M5-90Δ26 strains, as well as Escherichia coli, Salmonella, and Staphylococcus strains were used as negative samples. The samples were then subjected to high-temperature lysis with a DNA rapid release agent, and the method was determined.

[0159] (2) Detection method

[0160] Each simulated sample was tested using the aforementioned multiplex amplification system and four CRISPR / Cas12a detection channels (for BCSP31, A19, S2, and M5-90Δ26), with the fluorescence signal reading method being the same as in Example 3.

[0161] Each simulated sample was set up in 3 replicates, with an additional template-free control and a non-target bacteria negative control.

[0162] (3) Test results

[0163] In simulated samples 1-4, the corresponding target sites all produced obvious fluorescence signals within 20 minutes and had good channel differentiation.

[0164] Simulated sample 5 and the non-Brucella negative control showed no obvious fluorescence signal;

[0165] The results are shown in Table 11:

[0166] Table 11

[0167]

[0168] (4) Specificity and interference assessment

[0169] To further verify the species specificity of the system, host genomic DNA (cattle, sheep, and pig tissue DNA) was added for a four-channel detection experiment. No non-specific fluorescent signals were observed in any of the samples. Figure 4 This indicates that the detection method has good species specificity and anti-interference ability, and is suitable for sample detection in complex backgrounds.

[0170] (5) Evaluation of effectiveness compared with other detection methods

[0171] To evaluate the performance of the detection platform of this invention in actual samples, it was compared with existing commercial Brucella test strips. A mixed bacterial suspension of S2 vaccine strain, A19 vaccine strain, and M5-90Δ26 vaccine strain was used for inactivation, and commercial test strips were then used for detection. The results were compared with this method and the qPCR method.

[0172] The results are as follows Figure 5 As shown, after dilution to 2 13 When the test strip signal completely disappears, the signal from this platform remains easily interpretable, indicating that this platform has higher sensitivity in low-concentration Brucella samples. The system of this invention utilizes multiplex amplification + CRISPR signal amplification, which can still stably detect low copy number DNA. This platform has vaccine identification capabilities, while the test strip cannot distinguish the source of the strain.

[0173] Example 5: Detection of Brucella in Meat Samples

[0174] To further verify the applicability of the multiplex amplification-CRISPR / Cas12a rapid detection platform established in this invention in actual food samples, commercially available animal-derived meat products were selected for Brucella contamination detection to evaluate its application value in food safety and cross-departmental pathogen monitoring.

[0175] (1) Sample source and processing

[0176] A total of 20 animal-derived meat samples were collected, including:

[0177] Beef (10 servings) 1-10;

[0178] Lamb (6 servings) 11-16;

[0179] Pork (4 servings) 17-20.

[0180] The samples were sourced from a slaughterhouse in Heilongjiang Province. All samples were collected by the Harbin Veterinary Research Institute and subjected to DNA extraction according to regulations, and stored at -20℃.

[0181] (2) Detection method

[0182] The extracted DNA sample was subjected to Brucella DNA detection using the multiplex amplification + CRISPR / Cas12a detection platform described in this invention, with the following four channels set up:

[0183] Channel 1: Universal target BCSP31 (positive in both wild-type and vaccine strains)

[0184] Channel 2: A19-specific target

[0185] Channel 3: S2 Specific Target

[0186] Channel 4: M5-90Δ26 Specific Target

[0187] One detection reaction was set up for each sample, and a commercial qPCR kit was used as a control detection method.

[0188] The test results are shown in Table 12:

[0189] Table 12

[0190]

[0191] Note: Samples No. 2 and No. 14 were vaccine residue samples; Brucella DNA was not detected in the other samples.

[0192] (3) Results Analysis

[0193] The detection platform of this invention has excellent detection capability for low concentrations of Brucella DNA in meat samples; the universal target combined with the vaccine typing channel can distinguish between wild-type and vaccine strain contamination sources; it is consistent with the positive results of commercial qPCR for Brucella, but qPCR can only determine whether it is Brucella, and cannot distinguish between vaccine residue and wild-type. Therefore, samples that were detected as vaccine residues by this invention were further sequenced to determine whether they were indeed vaccine residues. The results showed that the detection results of this invention and the sequencing results had a 100% concordance rate.

[0194] The entire detection process of this invention does not require DNA purification and concentration, and the reaction time is less than 40 minutes, making it suitable for rapid screening applications in cold chain, market, and port.

[0195] Example 6: Brucella detection in milk samples and vaccine contamination identification

[0196] To further verify the applicability of the method of the present invention in animal-derived samples, milk samples from dairy farms in Brucella epidemic areas were selected for testing. The aim was to evaluate the system's ability to identify wild-type infection in the context of vaccine interference and to compare the results with existing qPCR methods.

[0197] (1) Sample preparation and processing

[0198] A total of 30 milk samples were collected. All samples were immediately inactivated after collection, and genomic DNA was extracted using the MolPure® bacterial DNA extraction kit for subsequent testing.

[0199] (2) RPA-CRISPR combined detection

[0200] The multiplex RPA amplification system described in this invention was used to detect the following three targets:

[0201] Brucella conserved target (BCSP31): reflects the presence of Brucella infection;

[0202] A19 vaccine-specific targets: reflect the presence of vaccination or vaccine residue;

[0203] S2 vaccine-specific targets: reflect the presence of vaccination or vaccine residue;

[0204] M5-90Δ26 vaccine-specific target: reflects the presence of vaccination or vaccine residue;

[0205] The reaction system and procedures were performed according to general methods. Detection was conducted using a portable fluorescence analyzer.

[0206] (3) Comparison and analysis of some milk sample test results with qPCR results are shown in Table 13:

[0207] Table 13

[0208]

[0209] Of the 30 samples tested, the method of this invention detected 4 positive samples for BCSP31. One sample was positive only for the wild-type target, two samples were positive for both the wild-type target and the A19 vaccine-specific target, and one sample was positive for both the wild-type target and the S2 vaccine-specific target. All four BCSP31-positive samples were qPCR-positive for Brucella. Sequencing of these four positive samples further confirmed wild-type virus infection and vaccine residues, and the results were consistent with the detection results of this invention.

[0210] Example 7: Detection and Typing Analysis of Brucella in Vaginal Secretion Samples

[0211] To further verify the applicability and discrimination ability of the method of the present invention in reproductive tract samples, this embodiment selects vaginal secretion samples from suspected infected female animals for Brucella detection and evaluates the system's accuracy in distinguishing between wild-type and vaccine strains.

[0212] (1) Sample source and preprocessing

[0213] A total of 22 vaginal secretion samples were collected from dairy cows and sheep that had experienced abortion or suspected infection symptoms. All samples were collected by the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences. The sampling process followed biosafety regulations. All samples were inactivated at high temperature after collection and stored at -20°C for later use.

[0214] (2) Multiplex amplification-Cas12a detection

[0215] The detection system follows the multiplex isothermal amplification and CRISPR fluorescence signal interpretation steps in the method of this invention, and the target sites include:

[0216] Conserved target (BCSP31) is used to identify Brucella infection;

[0217] Vaccine strain-specific targets (A19, S2, M5-90Δ26) are used to identify vaccination history or vaccine contamination.

[0218] The reaction system included positive, negative, and blank control groups, and parallel validation was performed using qPCR.

[0219] (3) Analysis of test results

[0220] The test results are shown in Table 14:

[0221] Table 14

[0222]

[0223] The results showed that the method of this invention detected positive signals in all qPCR-positive samples, with a sensitivity of 100%. Among the 6 Brucella-positive samples, 2 were positive for the wild-type target only, 2 were positive for both the wild-type target and the A19 vaccine-specific target, and 2 were positive for both the wild-type target and the S2 vaccine-specific target. The detection results were further validated by first-generation sequencing, with a concordance rate of 100%.

[0224] Example 8: Brucella Detection and Pooled Testing Strategy Optimization in Mixed Samples

[0225] To improve the efficiency and cost-effectiveness of large-scale Brucella detection, this embodiment uses the multi-target rapid detection system described in this invention, combined with a two-stage pooled detection model, to evaluate the simulated sample pool and verify its applicability and accuracy under low positive rate conditions.

[0226] (1) Pooled testing model and theoretical support

[0227] Based on the classic Dorfman two-phase mixed detection strategy:

[0228] The samples are mixed in a fixed quantity (n) and then tested for the first time;

[0229] If the pooled sample result is negative, then the entire group is negative;

[0230] If the combined result is positive, then each sample in that group should be tested separately.

[0231] To estimate the optimal pooled testing size, the following estimation formula is used:

[0232] in:

[0233] E(T): Total expected number of tests

[0234] N: Total number of samples

[0235] n: Mix group size

[0236] p: Single sample positivity rate

[0237]

[0238]

[0239] In this simulation, the positive rate was assumed to be 0.4% (p=0.004), and the optimal pooled test group size was calculated as follows:

[0240]

[0241] (2) Simulated sample mixture design

[0242] Select from the pre-confirmed sample: 8 qPCR positive samples and 120 negative dummy samples.

[0243] Construct the following mixed sample group:

[0244] Group A (1 positive + 15 negative), 8 groups in total

[0245] Group B (0 positive + 16 negative), a total of 5 groups, served as a negative control.

[0246] Group C (2 positive + 14 negative), a total of 5 groups, simulates a higher infection rate.

[0247] After mixing each group, DNA was extracted and processed according to the RPA-CRISPR detection system provided in this invention.

[0248] (3) Statistics of pooled test results

[0249] The test results are shown in Table 15 and Figure 6 As shown:

[0250] Table 15

[0251]

[0252] The intensity of the detection signal is positively correlated with the number of positive samples. The more positive samples there are, the faster the fluorescence signal grows and the more obvious the color development.

[0253] (4) Conclusion

[0254] This invention can be effectively applied to large-scale Brucella screening in the context of low positive rates; it has a short detection cycle, strong repeatability, and the ability to provide batch early warning and initial risk screening; combined with pooled testing strategies, it can significantly reduce testing costs and manpower input, and is suitable for high-throughput application scenarios such as milk stations, slaughterhouses, and border ports.

[0255] Example 9: Rapid Detection and Evaluation of On-Site Samples

[0256] To verify the feasibility and detection stability of the multiplex amplification-CRISPR / Cas12a molecular diagnostic platform provided by this invention in a real production environment, this embodiment conducted a Brucella infection screening test at a ranch site.

[0257] (1) Detection scenario and equipment configuration

[0258] Testing location: A large-scale breeding farm and its transport vehicle parking area in Heilongjiang Province.

[0259] Samples collected: A total of 27 on-site samples were collected, including: milk samples (n=8), vaginal secretions (n=7), fresh meat tissue samples (n=6), and smear samples from the surface of the railings of cattle and sheep transport vehicles (n=6).

[0260] Equipment used: Portable isothermal amplification instrument (42°C RPA); Portable blue fluorescence reading device (with AI analysis module); Integrated PCR reaction tubes and ready-to-use lysis buffer kits;

[0261] After initial lysis, the samples can be directly amplified and detected on-site without centrifugation or cold chain transport.

[0262] (2) Testing process and operation time

[0263] Sample processing and lysis (5 minutes):

[0264] The lysis buffer solution of this invention is used to directly react with the original sample (milk, secretions, meat paste or surface wiping liquid), and after the reaction at room temperature, it directly enters the amplification step.

[0265] Multiplex amplification reaction (20 minutes):

[0266] Using the optimized multiplex amplification system of this invention, wild-type and vaccine-specific sites can be amplified simultaneously.

[0267] CRISPR / Cas12a detection and signal readout (10 minutes):

[0268] The portable blue light module reads fluorescence signals in real time, and the accompanying APP automatically interprets the results. The total detection time is less than 35 minutes, which is suitable for on-site sampling and testing needs.

[0269] (3) Analysis of test results

[0270] The test results are shown in Table 16:

[0271] Table 16

[0272]

[0273] (4) Summary of advantages

[0274] Rapid deployment: The system's miniaturized design allows for on-site molecular testing without the need for laboratory facilities;

[0275] High sensitivity: Compared to traditional colloidal gold test strips, it can identify low concentrations of contamination or early infection;

[0276] High throughput compatibility: It can be combined with mixed inspection strategies and is suitable for scenarios such as vehicle-mounted inspection, market supervision, and border quarantine.

[0277] Intelligent reading: Avoids misjudgment by manual reading and improves the standardization of on-site operations.

[0278] The principle of this invention, single-tube multiplex amplification-Cas12a detection, is as follows: Figure 7 As shown; a comparison of the present invention with other detection methods. Figure 8 As shown.

[0279] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0280] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A nucleotide composition for identifying Brucella vaccine strains and wild strains in cattle and sheep, characterized in that, The nucleotide composition comprises the following groups: A, B, C, and D: Group A: Specific nucleotides of wild-type Brucella, the sequence of which is shown in SEQ ID NO. 1; Group B: Specific nucleotides of the A19 vaccine strain, the sequence of which is shown in SEQ ID NO. 6; Group C: Specific nucleotides of the S2 vaccine strain, including nucleotides with sequences as shown in SEQ ID NO. 13 and SEQ ID NO. 14; Group D: Specific nucleotides of the M5-90Δ26 vaccine strain, the sequence of which is shown in SEQ ID NO.

15.

2. The use of the reagent for detecting the nucleotide composition as described in claim 1 in the preparation of a kit for differentiating Brucella vaccine strains from wild-type strains in cattle and sheep, characterized in that, The reagents include a crRNA composition for CRISPR / Cas12a detection.

3. The application as described in claim 2, characterized in that, The crRNA composition comprises the following (1) to (4): (1) a crRNA for detecting specific nucleotides of wild-type Brucella, said crRNA comprising at least one of the crRNAs with sequences shown in SEQ ID NO. 16, 19 and 21; (2) a crRNA for detecting specific nucleotides of the A19 vaccine strain, the sequence of which is shown in SEQ ID NO. 27; (3) a crRNA for detecting specific nucleotides of the S2 vaccine strain, said crRNA comprising at least one of the crRNAs with sequences as shown in SEQ ID NO. 34-35; (4) crRNA for detecting specific nucleotides of the M5-90Δ26 vaccine strain, said crRNA comprising at least one of the crRNAs with sequences shown in SEQ ID NO. 36, 37 and 39.

4. A kit for identifying Brucella vaccine strains and wild strains in cattle and sheep, characterized in that, The kit contains reagents for detecting the nucleotide composition as described in claim 1; the reagents include a crRNA composition for CRISPR / Cas12a detection, the crRNA composition comprising the following (1) to (4): (1) a crRNA for detecting specific nucleotides of wild-type Brucella, said crRNA comprising the sequences shown in SEQ ID NO. 16, 19 and 21; (2) a crRNA for detecting specific nucleotides of the A19 vaccine strain, the sequence of which is shown in SEQ ID NO. 27; (3) crRNA for detecting specific nucleotides of the S2 vaccine strain, wherein the crRNA comprises crRNA with sequences as shown in SEQ ID NO. 34-35; (4) crRNA for detecting specific nucleotides of the M5-90Δ26 vaccine strain, said crRNA comprising the sequences shown in SEQ ID NO. 36, 37 and 39.

5. The kit according to claim 4, characterized in that, The kit also includes an RPA amplification primer composition comprising primer pairs 1-4 as follows: Primer pair 1: an upstream primer and a downstream primer for specific nucleotides against wild-type Brucella, wherein the sequence of the upstream primer is shown in SEQ ID NO. 41 and the sequence of the downstream primer is shown in SEQ ID NO. 46; Primer pair 2: an upstream primer and a downstream primer for A19 vaccine strain-specific nucleotides, wherein the sequence of the upstream primer is shown in SEQ ID NO. 52 and the sequence of the downstream primer is shown in SEQ ID NO. 55; Primer pair 3: an upstream primer and a downstream primer for S2 vaccine strain-specific nucleotides, wherein the sequence of the upstream primer is shown in SEQ ID NO. 59 and the sequence of the downstream primer is shown in SEQ ID NO. 60; Primer pair 4: an upstream primer and a downstream primer for M5-90Δ26 vaccine strain-specific nucleotides, the sequence of which is shown in SEQ ID NO. 65 and the sequence of which is shown in SEQ ID NO.

68.

6. A method for differentiating Brucella vaccine strains from wild-type strains for non-diagnostic purposes, characterized in that, Includes the following steps: The nucleotide composition of claim 1 in the test sample was detected using the kit as described in any one of claims 4 to 5.

Citation Information

Patent Citations

  • Detection kit for identifying brucella and detection method thereof

    CN118910300A

  • PCR (Polymerase Chain Reaction) kit and method for identifying brucella pathogen and application

    CN119639926A