Compositions and methods for cellular immunotherapy

By combining anti-GPC3-CAR T-cell therapy with lymphopenia and immune stimulation, the problem of insufficient tumor-killing efficacy in the treatment of solid tumors has been solved, resulting in significant tumor shrinkage and prolonged survival time.

CN121102467APending Publication Date: 2025-12-12CRAGE MEDICAL CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510118979.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2016-04-22
Filing Date
2017-04-21
Publication Date
2025-12-12

AI Technical Summary

Technical Problem

Current CAR T-cell therapies face challenges in identifying antigenic differences between tumors and normal tissues when treating solid tumors, and their killing efficacy within tumors is insufficient, resulting in poor treatment outcomes.

Method used

Anti-GPC3 chimeric antigen receptor (CAR) T-cell therapy enhances the killing effect on solid tumors expressing phosphatidylinositol proteoglycan-3 (GPC3) by administering anti-GPC3-CAR T cells to patients in combination with lymphopenia treatment and immunostimulants.

Benefits of technology

It can significantly reduce tumor size by at least 30%, stabilize tumor size by less than 10%, and prolong median survival by at least 6 months. It is applicable to a variety of solid tumors such as liver cancer and gastric cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005258464070000191
    Figure BDA0005258464070000191
  • Figure BDA0005258464070000231
    Figure BDA0005258464070000231
  • Figure BDA0005258464070000241
    Figure BDA0005258464070000241
Patent Text Reader

Abstract

Provided are methods for treating a subject of a solid tumor expressing GPC3 comprising administering to the subject an anti-GPC3 chimeric antigen receptor immunoresponsive cell wherein the administering is performed after or concurrently with subjecting the subject to a lymphopenia treatment. A kit for use in the method is also provided.
Need to check novelty before this filing date? Find Prior Art

Description

CROSS-REFERENCE

[0001] This application claims the benefit of Chinese Patent Application No. CN201610256568.9, filed April 22, 2016, the contents of which are incorporated herein in their entirety.

[0002] This application is a divisional application of the application patent application with the application number CN201780038997.1, the application name of "Composition and method for cellular immunotherapy", the application date of April 21, 2017. BACKGROUND

[0003] Cancer has a major social impact worldwide. In 2016, an estimated 1,685,210 new cases of cancer were diagnosed in the United States alone, and 595,690 people will die from the disease. According to the Journal of Oncology Practice (Erikson 2007), by 2020, approximately 1 in 19 of the 182 million Americans will be a cancer patient or cancer survivor, an increase from 117 million Americans (1 in 26) in 2005.

[0004] Chimeric antigen receptors (CARs) are recombinant receptors for antigens that re- direct the specificity and function of T cells and other immune cells in a single molecule. The use of CARs in cancer immunotherapy can bypass the obstacles of active immunization, rapidly generating T cells that target tumors. Once expressed in a cell, CAR-modified cells can exert immediate and long-term effects in a subject.

[0005] Chimeric antigen receptor (CAR) T cell therapy, which edits T cells from cancer patients to recognize their tumors, has shown promise in treating blood cancers. In recent clinical trials, CAR T cell therapy significantly improved the treatment outcomes for patients with advanced, otherwise incurable, blood cancers such as leukemia and lymphoma. In contrast, CAR T cells face a unique set of challenges for the treatment of solid tumors. Among the challenges are identifying antigens that are expressed by the tumor that clearly distinguish the tumor from normal tissue, and establishing effective killing of tumor cells within the tumor and thus reduction in tumor size. SUMMARY

[0006] There is an urgent need for alternative and effective treatments for a variety of solid tumors. The present invention addresses this need and also provides related advantages. Accordingly, disclosed herein are methods of treating a subject exhibiting a solid tumor expressing glypican-3 (GPC3). In some cases, the methods can include administering to the subject an anti-GPC3 chimeric antigen receptor immune response cell. In some cases, the administering can be after or concurrent with the subject receiving a lymphodepleting treatment. In some cases, the immune response cell can be an NK cell (anti-GPC3-CAR NK cell) or a T cell (anti-GPC3-CAR T cell). In some cases, administering to the subject an anti-GPC3-CAR T cell can be after subjecting the subject to a lymphodepleting treatment. In some cases, the amount of GPC3-CAR T cells that can be administered to the subject is at least about 5 x 10 4 cells / kg. In some cases, the amount of GPC3-CAR T cells administered to the subject is about 5 x 10 4 to about 1 x 10 12The administration can be effective to reduce tumor size by at least 30%, as measured by computed tomography (CT) scan. In some cases, the administration can be effective to stabilize tumor size, meaning a change in baseline measurement of tumor lesion diameter as measured by computed tomography (CT) scan of less than 10%. In some cases, the administration of the anti-GPC3-CAR T cells in combination with the lymphodepleting treatment can synergistically extend the median survival time of the subject by at least about 6 months compared to the administration of the anti-GPC3-CAR T cells alone. In some cases, the solid tumor can be a liver cancer, a stomach cancer, a thyroid cancer (e.g., a thyroid tumor), a lung cancer, a breast cancer, a head and neck cancer, an ovarian cancer, a kidney cancer, a bladder cancer, a cervical cancer, a pancreatic cancer, a liposarcoma, a testicular noneminomatous germ cell cancer, a melanoma, an adrenal adenoma, a schwannoma, a malignant fibrous histiocytoma, or an esophageal cancer. In some cases, the anti-GPC3 chimeric antigen receptor can comprise an antigen binding unit that can specifically bind to a C-terminus of GPC3. In some cases, the antigen binding unit can comprise a sequence that exhibits at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or up to about 100% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8. In some cases, the anti-GPC3-CAR can comprise a sequence that exhibits at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or up to about 100% sequence identity to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, or SEQ ID NO: 30.The anti-GPC3-CAR can comprise a sequence that exhibits at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or up to about 100% sequence identity to any one of SEQ ID NOs 28-30. In some cases, the anti-GPC3-CAR T cell can comprise at least two intracellular signaling domains. In some cases, the anti-GPC3-CAR T cell can comprise at least three intracellular signaling domains. The intracellular signaling domains can be selected from a signaling domain derived from CD3, CD28, 4-1BB, OX40, DAP10, or ICOS. In some cases, the lymphodepletion therapy can comprise reducing the amount of regulatory T cells in the subject. Reducing the amount of regulatory T cells can comprise reducing the amount of regulatory T cells by at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more, as measured by flow cytometric analysis of circulating CD4. + and CD25 + cells in the subject. In some cases, the lymphodepletion therapy can comprise administering radiation or a biologic agent to the subject. The lymphodepletion therapy can also comprise administering chemotherapy to the subject. Administering chemotherapy to the subject can comprise administering a chemotherapeutic agent selected from the group consisting of cyclophosphamide, fludarabine, etoposide, cytarabine, methotrexate, vincristine, doxorubicin, and any combination thereof. In some cases, the subject can be administered at least one chemotherapeutic agent prior to administration of the anti-GPC3-CAR T cells. In some cases, the lymphodepletion therapy can reduce the amount of lymphocytes by at least about 20%, as measured by complete blood count (CBC) analysis.

[0007] Also disclosed herein can be a method further comprising administering to the subject a second administration of anti-GPC3-CAR T cells. In some cases, the subject can have refractory, persistent, or progressive disease. The anti-GPC3-CAR T cells can be autologous or allogeneic with respect to the subject.

[0008] Also disclosed herein can be a method further comprising administering to the subject at least one immunostimulatory agent concurrently with or after administration of the anti-GPC3 chimeric antigen receptor immune response cells. The immunostimulatory agent can be selected from the group consisting of aldesleukin (IL-2), IL-3, IL-6, IL-11, GM-CSF, and any combination thereof. The biologic agent can be an antibody directed against an antigen expressed on a lymphocyte.

[0009] Disclosed herein is a kit for administering anti-GPC3-CAR immune response cells to a subject exhibiting a solid tumor, comprising: an effective amount of anti-GPC3-CAR immune response cells; a chemotherapeutic agent effective to reduce lymphocytes present in the subject; and instructions for administering the anti-GPC3-CAR immune response cells to the subject after or concurrently with the chemotherapeutic agent. In some cases, the anti-GPC3-CAR immune response cells can be NK cells or T cells (anti-GPC3-CAR T cells). The chemotherapeutic agent can be selected from the group consisting of cyclophosphamide, fludarabine, etoposide, cytarabine, methotrexate, vincristine, doxorubicin, and any combination thereof. The kit can further comprise about 60 mg / kg to about 80 mg / kg cyclophosphamide or about 25 mg / m 2 to about 35 mg / m 2 fludarabine formulated for administration to a subject in need thereof. In some cases, the kit can comprise about 1 x 10 4 cells to about 1 x 10 12 In some cases, the instructions can provide a procedure for administering the anti-GPC3-CAR T cells at least 12 hours after administration of the chemotherapeutic agent. In some cases, the instructions can provide a procedure for administering the anti-GPC3-CAR T cells at least 24 hours after administration of the chemotherapeutic agent. The anti-GPC3-CAR T cells can be formulated for intravenous injection. The anti-GPC3-CAR T cells can be formulated for intra-arterial injection into the liver of a subject that can comprise a solid tumor.

[0010] In particular, the present application provides the following technical solutions:

[0011] 1. A method of treating a subject having a solid tumor expressing glypican-3 (GPC3), the method comprising administering to the subject anti-GPC3 chimeric antigen receptor immune response cells, wherein the administration is after or concurrent with subjecting the subject to a lymphodepleting treatment.

[0012] 2. The method of item 1, wherein the immune response cells are NK cells (anti-GPC3-CAR NK cells) or T cells (anti-GPC3-CAR T cells).

[0013] 3. The method of item 2, wherein the administration of the anti-GPC3-CAR T cells to the subject is after the subject receives a lymphodepleting treatment.

[0014] 4. The method of item 2, wherein the administration of the anti-GPC3-CAR T cells to the subject is in an amount of at least about 5 x 104 cells / kg.

[0015] 5. The method of item 2, wherein the anti-GPC3-CAR T cell amount administered to the subject is about 5 x 10 4 to about 1 x 10 12 cells / kg.

[0016] 6. The method of item 1, wherein the administration is effective to reduce tumor size by at least 30% as measured by computed tomography (CT) scan.

[0017] 7. The method of item 1, wherein the administration is effective to stabilize tumor size as measured by a change of less than 10% in baseline measurement of tumor lesion diameter by computed tomography (CT) scan.

[0018] 8. The method of item 2, wherein the administration of anti-GPC3-CAR T cells in combination with lymphodepleting therapy synergistically extends the median survival time of the subject by at least about 6 months compared to administration of the anti-GPC3-CAR T cells alone.

[0019] 9. The method of item 1, wherein the solid tumor is a liver cancer, a stomach cancer, a lung cancer, a breast cancer, a head and neck cancer, an ovarian cancer, a thyroid cancer, a kidney cancer, a bladder cancer, a cervical cancer, a pancreatic cancer, a liposarcoma, a testicular non-seminoma germ cell cancer, a melanoma, an adrenal adenoma, a schwannoma, a malignant fibrous histiocytoma, or an esophageal cancer.

[0020] 10. The method of item 1, wherein the anti-GPC3 chimeric antigen receptor comprises an antigen binding unit that specifically binds to the C-terminus of GPC3.

[0021] 11. The method of item 10, wherein the antigen binding unit comprises a sequence that exhibits at least 90% sequence homology to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8.

[0022] 12. The method of item 1, wherein the anti-GPC3-CAR comprises a sequence that exhibits at least 90% sequence identity to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, or SEQ ID NO: 30.

[0023] 13. The method of item 1, wherein the anti-GPC3-CAR comprises a sequence that exhibits at least 90% sequence identity to any one of SEQ ID NO 28, SEQ ID NO 29, and SEQ ID NO 30.

[0024] 14. The method of item 2, wherein the anti-GPC3-CAR T cell comprises at least two intracellular signaling domains.

[0025] 15. The method of item 2, wherein the anti-GPC3-CAR T cell comprises at least three intracellular signaling domains.

[0026] 16. The method of item 14 or 15, wherein the intracellular signaling domain is selected from the group consisting of a signaling domain of CD3, CD28, 4-1BB, OX40, DAP10, or ICOS.

[0027] 17. The method of item 1, wherein the lymphodepleting treatment comprises reducing the amount of regulatory T cells in the subject.

[0028] 18. The method of item 17, wherein the reducing the amount of regulatory T cells comprises reducing at least about 30% of the regulatory T cells, the amount of regulatory T cells measured by flow cytometry analysis of circulating CD4 + and CD25 + cells in the subject.

[0029] 19. The method of item 1, wherein the lymphodepleting treatment further comprises administering radiation or a biologic agent to the subject.

[0030] 20. The method of item 1, wherein the lymphodepleting treatment further comprises administering additional chemotherapy to the subject.

[0031] 21. The method of item 20, wherein administering an additional chemotherapy to the subject comprises administering a chemotherapeutic agent selected from the group consisting of cyclophosphamide, fludarabine, etoposide, cytarabine, methotrexate, vincristine, doxorubicin, and any combination thereof.

[0032] 22. The method of item 21, wherein the chemotherapeutic agent is administered to the subject at least once prior to administering the anti-GPC3-CAR T cells.

[0033] 23. The method of item 1, wherein the lymphodepleting therapy reduces the amount of lymphocytes by at least about 20%, as measured by a complete blood count (CBC) analysis.

[0034] 24. The method of item 2, further comprising administering the anti-GPC3-CAR T cells to the subject a second time.

[0035] 25. The method of item 1, wherein the subject has refractory, persistent, or progressive disease.

[0036] 26. The method of item 2, wherein the anti-GPC3-CAR T cells are autologous or allogeneic with respect to the subject.

[0037] 27. The method of item 1, further comprising administering at least one immunostimulatory agent to the subject concurrently with or after administering the anti-GPC3 chimeric antigen receptor immune response cells.

[0038] 28. The method of item 27, wherein the immunostimulatory agent is selected from the group consisting of aldesleukin (IL-2), IL-3, IL-6, IL-11, GM-CSF, and any combination thereof.

[0039] 29. The method of item 19, wherein the biological agent is an antibody that targets an antigen expressed on lymphocytes.

[0040] 30. A kit for administering anti-GPC3-CAR immune response cells to a subject exhibiting a solid tumor, comprising:

[0041] (a) an effective amount of anti-GPC3-CAR immune response cells;

[0042] (b) a chemotherapeutic agent effective to reduce lymphocytes present in a subject; and

[0043] (c) instructions for administering anti-GPC3-CAR immune response cells to the subject after or concurrently with the chemotherapeutic agent.

[0044] 31. The kit of item 30, wherein the anti-GPC3-CAR immune response cells are NK cells or T cells (anti-GPC3-CAR T cells).

[0045] 32. The kit of item 30, wherein the chemotherapeutic agent is selected from the group consisting of cyclophosphamide, fludarabine, etoposide, cytarabine, methotrexate, vincristine, doxorubicin, and any combination thereof.

[0046] 33. The kit of item 30, further comprising about 60 mg / kg to about 80 mg / kg cyclophosphamide or about 25 mg / m 2 to about 35 mg / m 2 fludarabine formulated for administration to a subject in need thereof.

[0047] 34. The kit of item 31, comprising about 1 x 10 8 to about 1 x 10 11 anti-GPC3-CAR T cells.

[0048] 35. The kit of item 31, wherein the instructions provide a procedure for administering the anti-GPC3-CAR T cells after administration of the chemotherapeutic agent.

[0049] 36. The kit of item 31, wherein the instructions provide a procedure for administering the anti-GPC3-CAR T cells at least 12 hours after administration of the chemotherapeutic agent.

[0050] 37. The kit of item 31, wherein the instructions provide a procedure for administering the anti-GPC3-CAR T cells at least 24 hours after administration of the chemotherapeutic agent.

[0051] 38. The kit of item 31, wherein the anti-GPC3-CAR T cells are formulated for intravenous injection.

[0052] 39. The kit of item 31, wherein the anti-GPC3-CAR T cells are formulated for intra-arterial injection into the liver of the subject comprising the solid tumor. INCORPORATION BY REFERENCE

[0053] All publications, patents, and patent applications mentioned herein are incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. In the event of a conflict between the terminology, definitions, and / or other statements of terms in this document and those of any incorporated reference, the terminology, definitions, and / or other statements of terms in this document control. BRIEF DESCRIPTION OF DRAWINGS

[0054] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure can be utilized, and the accompanying drawings of which:

[0055] FIG. 1 A second generation CAR-T vector encoding a chimeric antigen receptor targeting GPC3 is shown.

[0056] FIG. 2 The ratio of lymphocytes in individuals H01, H02, or H03 treated with cyclophosphamide and / or fludarabine relative to baseline levels is shown.

[0057] FIG. 3 Magnetic resonance imaging (MRI) scans of liver sections pre- and post-treatment are shown.

[0058] FIG. 4A CytoTox 96® non-radioactive cytotoxicity assays performed on 33-28BBZ, 92-28BBZ, and 4-28BBZ co-cultured with control cells SK-HEP-1 are shown. non-radioactive cytotoxicity assays, and FIG. 4B CytoTox 96® non-radioactive cytotoxicity assays performed on 33-28Z, 92-28Z, 92-BBZ, and 92-28BBZ co-cultured with a second control cell line, CHO-K1 are shown. non-radioactive cytotoxicity assays, effector:target ratios of 3:1, 1:1, or 1:3.

[0059] FIG. 5A CytoTox 96® non-radioactive cytotoxicity assays performed on 33-28BBZ, 92-28BBZ, and 4-28BBZ co-cultured with GPC3 positive hepatocellular carcinoma cells, Huh-7 are shown. non-radioactive cytotoxicity assays, and FIG. 5B CytoTox 96® non-radioactive cytotoxicity assays performed on 33-28BBZ, 92-28BBZ, and 4-28BBZ co-cultured with control cells transduced to express GPC3, CHO-K1-GPC3+ are shown, effector:target ratios of 3:1, 1:1, or 1:3.

[0060] FIG. 6A CytoTox 96® non-radioactive cytotoxicity assays performed on anti-GPC3 CAR-T cells 92-28Z, 92-BBZ, 92-28BBZ, or empty vector co-cultured with HepG2 (HCC) are shown. non-radioactive cytotoxicity assays. FIG. 6B CytoTox 96® non-radioactive cytotoxicity assays performed on anti-GPC3 CAR-T cells 92-28Z, 92-BBZ, 92-28BBZ, or empty vector co-cultured with Hep3B (HCC) are shown. Non-radioactive cytotoxicity assay, FIG. 6C CytoTox 96® assays performed on anti-GPC3 CAR-T cells 92-28Z, 92-BBZ, 92-28BBZ or empty vector co-cultured with PLC / PRF / 5 (liver cancer) Non-radioactive cytotoxicity assay.

[0061] FIG. 7A CytoTox 96® assays performed on anti-GPC3 CAR-T cells 33-28Z or 33-28BBZ co-cultured with Huh-7 cells Non-radioactive cytotoxicity assay (effector: target ratio of 3: 1, 1: 1 or 1:3). FIG. 7B CytoTox 96® assays performed on anti-GPC3 CAR-T cells 92-28Z or 92-28BBZ co-cultured with gastric cancer cell line KATO-III cells Non-radioactive cytotoxicity assay (effector: target ratio of 3: 1, 1: 1 or 1:3).

[0062] FIG. 8A Tumor images showing mice treated with second generation CAR-T 92-28Z also had significantly reduced tumor size compared to mice treated with third generation CAR-T 92-28BBZ or saline. FIG. 8B Tumor images showing mice treated with second generation CAR-T 92-28Z also had significantly reduced tumor size compared to mice treated with third generation CAR-T 92-28BBZ or saline. FIG. 8C Tumor images showing mice treated with second generation CAR-T 92-28Z also had significantly reduced tumor size compared to mice treated with third generation CAR-T 92-28BBZ or saline. FIG. 8D Tumor images showing mice treated with second generation CAR-T 92-28Z also had significantly reduced tumor size compared to mice treated with third generation CAR-T 92-28BBZ or saline.

[0063] FIG. 9 CytoTox 96® assays performed on various second and third generation anti-GPC3 CAR constructs 4-28Z, 4-28BBZ, 4-4-28BBZ, 4-14-28BBZ, 4-20-28BBZ, 4-35-28BBZ, 4-42-28BBZ co-cultured with Huh7 (HCC) cells Specific lysis results of non-radioactive cytotoxicity assays, effector: target ratio of 3: 1 or 1: 1.

[0064] FIG. 10ACytoTox 96® assays performed on anti-GPC3 CAR-T cells 33-28Z, 92-28Z, 92-BBZ, 92-28BBZ or empty vector co-cultured with A431 (GPC3 negative) are shown. Non-radioactive cytotoxicity assays. FIG. 10B CytoTox 96® assays performed on anti-GPC3 CAR-T cells 33-28Z, 92-28Z, 92-BBZ, 92-28BBZ or empty vector co-cultured with Huh-7 (GPC3 positive) are shown. Non-radioactive cytotoxicity assays. CytoTox assays were performed at an effector: target ratio of 3: 1, 1: 1 or 1:3.

[0065] FIG. 11A Results from a xenograft mouse model are shown, where mice treated with second generation CAR-T 92-28Z had significantly reduced tumor volume (mm 3 ) compared to mice treated with third generation CAR-T 92-28BBZ or empty vector. FIG. 11B Results from a xenograft mouse model are shown, where mice treated with second generation CAR-T 92-28Z had significantly reduced tumor volume (mm 3 ) compared to mice treated with third generation CAR-T 92-28BBZ or empty vector. FIG. 11C Tumor images from mice treated with empty vector, 92-28BBZ or 92-28Z CAR-T are shown. DETAILED DESCRIPTION

[0066] The following description and examples detail embodiments of the present disclosure. It should be understood that the present disclosure is not limited to the particular embodiments described herein and as such can vary. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many alternatives to the specific embodiments described herein. Any embodiment disclosed herein can be combined with any other embodiment disclosed herein.

[0067] As used herein, some inventive embodiments herein contemplate numerical ranges. Various aspects of the present invention can be presented in a range format. It is to be understood that the description in range format is merely for convenience and brevity and that one of skill in the art would understand that the ranges are to be construed as having been preceeded by the words "about" or "approximately." It is to be further understood that all junctions, whole or partial, between numerical values described herein are to be construed as mutually and infinitely DEFINITIONS

[0068] As used herein, the article "a" means one or more, unless otherwise specified.

[0069] As used herein, unless otherwise specified, terms such as "comprise", "comprising", "include", "including", "contain", "containing", or variations thereof, mean "including but not limited to".

[0070] The term "activation" and its grammatical equivalents as used herein can refer to the process by which a cell transitions from a quiescent state to an active state. This process can include a response to an antigen, migration, and / or a phenotypic or genetic change to a functionally active state. For example, the term "activation" can refer to the stepwise process of T cell activation. For example, a T cell can require at least two signals to become fully activated. The first signal can occur upon engagement of the TCR by an antigen-MHC complex, and the second signal can occur through engagement of a costimulatory molecule (Table 3). In vitro, anti-CD3 can mimic the first signal and anti-CD28 can mimic the second signal. For example, an engineered T cell can be activated by an expressed CAR. As used herein, "T cell activation" or T cell priming can refer to the state of a T cell that has been sufficiently stimulated to induce detectable cell proliferation, cytokine production, and / or detectable effector function.

[0071] The term "antigen binding unit" as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules (i.e., molecules that contain an antigen binding site that specifically binds to ("immunoreacts with") an antigen). The term "antigen binding unit" also includes immunoglobulin molecules of various species origin, including invertebrates and vertebrates. Structurally, the simplest naturally occurring antibody (e.g., IgG) comprises four polypeptide chains: two heavy chains (H) and two light chains (L) interconnected by disulfide bonds. Immunoglobulins represent a large family of molecules including several classes of molecules such as IgD, IgG, IgA, IgM, and IgE. The term "immunoglobulin molecule" includes, for example, hybrid antibodies or altered antibodies and fragments thereof. It has been shown that the antigen binding function of an antibody can be performed by fragments of a naturally occurring antibody. These fragments are collectively referred to as "antigen binding units". The term "antigen binding unit" also includes any molecular structure containing polypeptide chains with a specific shape that fits and recognizes an epitope, wherein one or more non-covalent binding interactions stabilize the complex between the molecular structure and the epitope.

[0072] An antigen binding unit "specifically binds to" or "immunoreacts with" an antigen if it binds to the antigen with greater affinity or avidity than it does to other reference antigens, including polypeptides or other substances.

[0073] As used herein, "antigen" refers to a substance that is specifically recognized and bound by an antigen binding unit. Antigens can include peptides, proteins, glycoproteins, polysaccharides, and lipids; portions thereof; and combinations thereof. Non-limiting exemplary antigens include GPC3 from human, murine, and other homologues. "Antigen" can also refer to a molecule that elicits an immune response. This immune response can involve antibody production or activation of specific immunocompetent cells or both. The skilled artisan will appreciate that any macromolecule, including virtually all proteins or peptides, can serve as an antigen.

[0074] The term "immunoglobulin" or "Ig" as used herein can refer to a class of proteins that function as antibodies. Antibodies expressed by B cells are sometimes referred to as chimeric antigen receptors or antigen receptors. This class of proteins includes five members, IgA, IgG, IgM, IgD, and IgE, of which IgG is the most common circulating antibody. It is the most efficient immunoglobulin in agglutination, complement fixation, and other antibody reactions, and is vital in defense against bacteria and viruses. For example, a CAR can recognize a tumor cell antigen.

[0075] The term "anti-GPC3 antibody" can refer to an antibody or antibody binding site that is capable of binding GPC3 with sufficient affinity so that the antibody is useful in distinguishing GPC3 from other antigens expressed by the cell. The extent of binding of an anti-GPC3 antibody to an unrelated, non-GPC3 protein is less than about 10% of the binding of the antibody to GPC3, for example, as measured by radioimmunoassay (RIA). In certain embodiments, an antibody that binds to GPC3 can have a dissociation constant (Kd) of <1 μΜ, <100 nM, <10 nM, <5 nM, <4 nM, <3 nM, <2 nM, <1 nM, <0.1 nM, <0.01 nM, or <0.001 nM (e.g., 10 -8 M or less, e.g., 10 -8 M to 10 - 13 M, e.g., 10 -9 M to 10 -13 M) In certain embodiments, an anti-GPC3 antibody binds to an epitope of GPC3 that is conserved among GPC3 from different species.

[0076] The term "autologous" and its grammatical equivalents as used herein can refer to something that originates from the same organism. For example, a sample (e.g., a cell) can be removed, manipulated, and returned to the same subject (e.g., a patient) at a later time. An autologous procedure is distinguished from an allogeneic procedure, in which the donor and recipient are different subjects.

[0077] As used herein, "xenotransplant" and grammatical equivalents thereof can include any procedure involving the transplantation, implantation, or infusion of cells, tissues, or organs into a recipient, wherein the recipient and the donor are different species. Transplantation of cells, organs, and / or tissues described herein can be for xenotransplantation into a human. Xenotransplantation includes, but is not limited to, vascularized xenotransplantation, partially vascularized xenotransplantation, non-vascularized xenotransplantation, xenodressing, xenobandage, and xenosturcture.

[0078] As used herein, "allogeneic transplant" and grammatical equivalents thereof (e.g., allogeneic transplantation) can include any procedure involving the transplantation, implantation, or infusion of cells, tissues, or organs into a recipient, wherein the recipient and the donor are different individuals of the same species. Transplantation of cells, organs, and / or tissues described herein can be for allogeneic transplantation into a human. Allogeneic transplantation includes, but is not limited to, vascularized allogeneic transplantation, partially vascularized allogeneic transplantation, non-vascularized allogeneic transplantation, allodressing, allobandage, and allostructure.

[0079] As used herein, "autologous transplant" and grammatical equivalents thereof (e.g., autologous transplantation) can include any procedure involving the transplantation, implantation, or infusion of cells, tissues, or organs into a recipient, wherein the recipient and the donor are the same individual. Transplantation of cells, organs, and / or tissues described herein can be for autologous transplantation into a human. Autologous transplantation includes, but is not limited to, vascularized autologous transplantation, partially vascularized autologous transplantation, non-vascularized autologous transplantation, autodressing, autobandage, and autosturcture.

[0080] The term "chimeric antigen receptor" or "CAR" as used herein refers to an engineered molecule that can be expressed by an immune cell, including but not limited to a T cell. When expressed in a T cell, a CAR can re-direct the T cell to induce killing of a target cell with the specificity dictated by the artificial receptor. The extracellular binding domain of a CAR can be derived from a murine, humanized, or fully human monoclonal antibody. An "anti-GPC3-CAR" is a CAR that is capable of binding to GPC3.

[0081] The term "epitope" and grammatical equivalents thereof as used herein can refer to a portion of an antigen that can be recognized by an antibody, B cell, T cell, or engineered cell. For example, an epitope can be a cancer epitope that is recognized by a TCR. Multiple epitopes within an antigen can also be recognized. Epitopes can also be mutated.

[0082] The term "engineered" and its grammatical equivalents as used herein can refer to one or more alterations of a nucleic acid (e.g., a nucleic acid within the genome of an organism). The term "engineered" can refer to alterations, additions, and / or deletions of genes. An engineered cell can also refer to a cell with added, deleted, and / or altered genes.

[0083] The term "cell" or "engineered cell" and its grammatical equivalents as used herein can refer to a cell of human or non-human animal origin. An engineered cell can also refer to a cell that expresses a CAR.

[0084] The term "good manufacturing practice" (GMP) and its grammatical equivalents as used herein can refer to a product that is safe, effective, or pure according to the FDA. GMP can also sometimes be referred to as "cGMP." The "c" stands for "current." Manufacturers of products can employ the latest techniques and systems to comply with regulations for GMP products. GMP compliant products are often used in clinical settings as opposed to research settings.

[0085] The term "transfection" as used herein refers to the introduction of foreign nucleic acid into a eukaryotic cell. Transfection can be accomplished by a variety of means known in the art, including calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, and biolistics.

[0086] The term "stable transfection" or "stably transfected" refers to the introduction and integration of foreign nucleic acid, DNA or RNA, into the genome of a transfected cell. The term "stable transfectant" refers to a cell that has stably integrated foreign DNA into the genomic DNA.

[0087] The terms "coding nucleic acid molecule," "coding DNA sequence," and "coding DNA" as used herein refer to the order or sequence of deoxyribonucleotides along a deoxyribonucleic acid chain. The order of these deoxyribonucleotides determines the order of amino acids along a polypeptide (protein) chain. Thus, a nucleic acid sequence encodes an amino acid sequence.

[0088] The term "subject" as used herein refers to any animal, such as a mammal or a marsupial. Subjects of the present invention include, but are not limited to, humans, non-human primates (e.g., rhesus or other types of macaques), mice, pigs, horses, donkeys, cows, sheep, rats, and any species of poultry.

[0089] The term "recipient" and its grammatical equivalents as used herein can refer to a human or non-human animal that receives a therapy or treatment.

[0090] The term“peripheral blood lymphocyte” (PBL) and its grammatical equivalents as used herein can refer to a lymphocyte circulating in the blood (e.g., peripheral blood). Peripheral blood lymphocytes can refer to lymphocytes that are not located in an organ. Peripheral blood lymphocytes can include T cells, NK cells, B cells, or any combination thereof.

[0091] The term“immune responsive cell” can refer to a cell capable of eliciting an immune response, including, but not limited to, T cells, B cells, and NK T cells, their respective precursor cells, and progeny thereof. Immune responsive cells can also refer to cells of the lymphoid or myeloid lineage.

[0092] The term“T cell” and its grammatical equivalents as used herein can refer to a T cell from any origin. For example, a T cell can be a primary T cell, e.g., an autologous T cell, a cell line, etc. A T cell can also be human or non-human.

[0093] The term“T cell activation” or“T cell priming” and its grammatical equivalents as used herein can refer to the state of a T cell that has been sufficiently stimulated to induce detectable cell proliferation, cytokine production, and / or detectable effector function. In some cases,“full T cell activation” can be analogous to priming of a T cell for cytotoxicity. T cell activation can be measured using various assays known in the art. Assays can be ELISA for measuring cytokine secretion, ELISPOT, flow cytometry assays for measuring intracellular cytokine expression (CD 107), flow cytometry assays for measuring proliferation, and cytotoxicity assays for determining target cell elimination (51Cr release assay). The assays typically use a control (non-engineered cell) for comparison to the engineered cell (CAR T) to determine the relative activation of the engineered cell compared to the control. Additionally, the assays can compare the engineered cell incubated or contacted with a target cell that does not express the target antigen. For example, CD19-CAR T cells can be compared to incubation with a target cell that does not express CD 19.

[0094] The term“sequence” and its grammatical equivalents when used in reference to a nucleotide sequence can include DNA or RNA; and can be single-stranded or double-stranded. A nucleic acid sequence can be mutated. A nucleic acid sequence can be of any length, e.g., 2 to 1,000,000 or more nucleotides in length (or any integral value therein or thereby), e.g., about 100 to about 10,000 nucleotides, or about 200 to about 500 nucleotides. METHOD OF USE

[0095] In one aspect, disclosed herein are methods of treating a subject exhibiting a solid tumor expressing Glypican-3 (GPC3). The subject methods generally include the step of administering to the subject an anti-GPC3 chimeric antigen receptor immune response cell, wherein the administration is performed after or concurrently with subjecting the subject to a lymphodepleting treatment.

[0096] The subject treated by the methods disclosed herein can exhibit a cancer or a solid tumor. Generally, the cancer or solid tumor cells express one or more tumor antigens. Generally, the tumor antigen is Glypican-3 (GPC3). The subject exhibiting a cancer or solid tumor expressing GPC-3 can be referred to as exhibiting a GPC3-positive cancer.

[0097] Cancers expressing GPC3 include, but are not limited to, liver cancer, gastric cancer, esophageal cancer, lung cancer, breast cancer, head and neck cancer, ovarian cancer, kidney cancer, bladder cancer, cervical cancer, pancreatic cancer, liposarcoma, testicular non-seminoma germ cell cancer, melanoma, adenoma, adrenal cancer, schwannoma, malignant fibrous histiocytoma, or any combination thereof. The subject methods are suitable for treating squamous cell carcinoma or adenocarcinoma, gastrointestinal neuroendocrine cancer, or any other cancer disclosed in “Glypican-3 expression in gastrointestinal and pancreatic epithelial neoplasms. (2013) 44, 542-550 Human Pathology.” In addition, the immune response cells disclosed herein, such as the anti-GPC3-CAR-Ts disclosed herein, can be used to target ovarian cancer, cholangiocarcinoma, mesothelioma, breast cancer, lung squamous cell carcinoma, cervical intraepithelial neoplasia, cervical squamous cell carcinoma, intrahepatic and extrahepatic carcinoma, gallbladder carcinoma, invasive ductal carcinoma, clear cell carcinoma, large oncocytic tumor, papillary carcinoma, adenocarcinoma, papillary carcinoma, and breast lobular and medullary carcinoma. Other targets for anti-GPC3 therapy can include those found in “Glypican 3 expression in human neoplastic, preneoplastic, and neoplastic tissues. (2008) 129:899-906 Am J Clin Pathol.”

[0098] In some cases, GPC3 expression by the cancer or tumor cells can be assessed by flow cytometry or immunohistochemistry. The level of GPC3 on the cancer or tumor cells can be classified as low, medium, or high.

[0099] In some cases, a cancer or tumor cell can express GPC3 on the cell surface. For example, expression of GPC3 on the cell surface can be determined using an antibody against GPC3 in a method such as immunohistochemistry or flow cytometry analysis. Alternatively, GPC3 mRNA expression can be considered to correlate with GPC3 expression on the cell surface, and can be determined by a method selected from in situ hybridization and RT-PCR.

[0100] In some cases, GPC3 is encoded by a gene comprising a nucleic acid sequence that exhibits at least 50% sequence identity to a reference gene in Table 2. GPC3 can be encoded by a gene comprising a nucleic acid sequence that exhibits at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or up to about 100% sequence identity to a reference gene in Table 2.

[0101] In some embodiments, an anti-GPC3 chimeric antigen receptor immune response cell is administered to a subject exhibiting a solid tumor expressing GPC3 after or concurrently with subjecting the subject to a lymphodepleting therapy.

[0102] A subject anti-GPC3 chimeric antigen receptor (CAR) generally comprises an extracellular antigen binding region, a transmembrane domain, and an intracellular signaling domain that controls activation of the immune response cell. In some cases, the anti-GPC3 CAR further comprises a hinge or spacer region. In some cases, the anti-GPC3 CAR further comprises one or more costimulatory domains.

[0103] A chimeric antigen receptor generally comprises an extracellular antigen binding region. In one embodiment, the extracellular antigen binding region can be fully human. In other cases, the extracellular antigen binding region can be humanized. In other cases, the extracellular antigen binding region can be murine or chimeric, where the extracellular antigen binding region is composed of amino acid sequences from at least two different animal species. In some cases, the extracellular antigen binding region can be non-human. Various antigen binding regions can be designed to target GPC3. Non-limiting examples include a single chain variable fragment (scFv) from an antibody, a fragment antigen binding region (Fab) selected from a library, a single domain fragment, or a natural ligand that engages with its cognate receptor. The extracellular antigen binding region can include a scFv, a Fab, or a natural ligand, as well as any derivatives thereof. The extracellular antigen binding region can refer to molecules other than intact antibodies, which can include portions of intact antibodies and can bind to antigens that intact antibodies can bind. Examples of antibody fragments can include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments.

[0104] An extracellular antigen-binding region (e.g., scFv, Fab, or native ligand) can be part of a CAR that determines antigen specificity. An extracellular antigen-binding region can bind to any complementary target. An extracellular antigen-binding region can be from an antibody for which the variable region sequence is known. An extracellular antigen-binding region can be from an antibody sequence obtained from a mouse hybridoma available. Alternatively, an extracellular antigen-binding region can be obtained from whole exome sequencing of a tumor cell or primary cell such as a tumor infiltrating lymphocyte (TIL).

[0105] In some cases, the binding specificity of an extracellular antigen-binding region can be determined by a complementarity determining region, or CDR, such as a light chain CDR or a heavy chain CDR. In many cases, the binding specificity can be determined by both a light chain CDR and a heavy chain CDR. A given combination of heavy and light chain CDRs can provide a given binding pocket that can confer greater affinity and / or specificity for an antigen, such as GPC3, compared to other reference antigens. For example, CDRs specific for glypican-3 can be expressed in the extracellular binding region of a CAR such that a CAR targeting GPC3 can target an immune response cell to a tumor cell expressing GPC3.

[0106] In some aspects of any of the embodiments disclosed herein, an extracellular antigen-binding region such as a scFv can comprise a light chain CDR specific for GPC3. A light chain CDR can be a complementarity determining region of a light chain of an antigen-binding unit such as a scFv of a CAR. A light chain CDR can comprise a contiguous sequence of amino acid residues, or two or more contiguous sequences of amino acid residues separated and optionally flanked by non-complementarity determining regions such as framework regions. In some cases, a light chain CDR can comprise two or more light chain CDRs, which can be referred to as light chain CDR-1, CDR-2, and so on. In some cases, a light chain CDR can comprise three light chain CDRs, which can be referred to as light chain CDR-1, light chain CDR-2, and light chain CDR-3, respectively. In some examples, a set of CDRs present on a common light chain can be collectively referred to as light chain CDRs.

[0107] In some aspects of any of the embodiments disclosed herein, an extracellular antigen-binding region such as a scFv can comprise a heavy chain CDR specific for GPC3. A heavy chain CDR can be a complementarity determining region of a heavy chain of an antigen-binding unit such as a scFv. A heavy chain CDR can comprise a contiguous sequence of amino acid residues, or two or more contiguous sequences of amino acid residues separated and optionally flanked by non-complementarity determining regions such as framework regions. In some cases, a heavy chain CDR can comprise two or more heavy chain CDRs, which can be referred to as heavy chain CDR-1, CDR-2, and so on. In some cases, a heavy chain CDR can comprise three heavy chain CDRs, which can be referred to as heavy chain CDR-1, heavy chain CDR-2, and heavy chain CDR-3, respectively. In some cases, a set of CDRs present on a common heavy chain can be collectively referred to as heavy chain CDRs.

[0108] In some cases, an extracellular antigen binding region targeting GPC3 can be expressed by an anti-GPC3 CAR immune response cell. In some cases, CDRs, light chains, and / or heavy chains that bind to GPC3 antigen can be included within an extracellular antigen binding region of a CAR immune response cell, such as a CAR T cell. In some cases, a modified anti-GPC3 CDR can be expressed on an extracellular antigen binding region of a CAR immune response cell and have from about 50% homology to about 100% homology to an original anti-GPC3 CDR. In some cases, a modified anti-GPC3 CDR can comprise about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or up to about 100% homology to an unmodified anti-GPC3 CDR.

[0109] In some cases, an scFv targeting GPC3 can be expressed by an anti-GPC3 CAR immune response cell. In some cases, CDRs, light chains, and / or heavy chains that bind to GPC3 antigen can be expressed on an scFv of a CAR immune response cell, such as a CAR T cell. In some cases, a modified anti-GPC3 CDR can be expressed on an scFv of a CAR immune response cell, such as a CAR T cell, and have from about 50% homology to about 100% homology to an original anti-GPC3 CDR. In some cases, a modified anti-GPC3 CDR can comprise about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or up to about 100% homology to an unmodified anti-GPC3 CDR. Table 1: Exemplary anti-GPC3 extracellular antigen binding regions: SEQ ID NO: 1、2、3、4、5、6、7、8

[0110] In preferred cases, the extracellular antigen binding region specifically recognizes GPC3. GPC3 can comprise a sequence that exhibits at least 80% identity to a GPC3 gene referenced in Table 2. In some cases, the extracellular antigen binding region can target the N-terminus, C-terminus, or any portion from the N-terminus to the C-terminus of GPC3. The C-terminus of GPC3 can be covalently linked to the cell membrane via a glycosylphosphatidylinositol (GPI) anchor. In some cases, the C-terminus can comprise from about 1 to about 800 bases. The C-terminus can comprise from about 1, 50, 100, 150, 300, 500, 600, up to about 800 bases from the C-terminal end. In some cases, the extracellular antigen binding region can target the GPI anchor of GPC3. Table 2: GPC3

[0111] By employing genetic engineering, the extracellular antigen binding region can be modified in various ways. In some cases, the extracellular antigen binding region can be mutated such that extracellular antigen binding regions with higher affinity for their target can be selected. In some cases, the affinity of the extracellular antigen binding region for its target can be optimized for targets that can be expressed at low levels on normal tissue. Such optimization can be performed to minimize potential toxicity. In other cases, the cloning of extracellular antigen binding regions with higher affinity for the membrane bound form of a target can be preferred over their soluble form counterparts. Such modifications can be made because some targets can also be detected at different levels in soluble form, and their targeting can cause unintended toxicity.

[0112] In some cases, the extracellular antigen binding region can have from about 50% to about 100% similarity to any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8. In some cases, the extracellular antigen binding region can comprise about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or up to about 100% homology to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8. In some cases, the extracellular antigen binding region can be murine, humanized, or fully human. The extracellular antigen binding region can be from about 1% to about 100% human. In some cases, the extracellular antigen binding region can be about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or up to about 100% human.

[0113] In some cases, the extracellular antigen binding region comprises a hinge or spacer region. The terms hinge and spacer region can be used interchangeably. The hinge can be considered a CAR moiety that serves to provide flexibility to the extracellular antigen binding region. In some cases, the hinge can be used to detect the CAR on the cell surface of a cell, particularly when the extracellular antigen binding region antibody does not work or is not available. For example, the length of the hinge from an immunoglobulin can need to be optimized depending on the location of the epitope on the target that the extracellular antigen binding region is targeting.

[0114] In some cases, the hinge may not belong to an immunoglobulin, but rather to the natural hinge of another molecule, such as the CD8α molecule. The CD8α hinge may contain cysteine ​​and proline residues known to play a role in the interaction between the CD8 co-receptor and MHC molecules. These cysteine ​​and proline residues can affect the performance of the CAR.

[0115] CAR hinges can be adjustable in size and can be compensated to some extent to normalize the orthogonal synaptic distance between CAR-responding cells and target cells. This morphology of the immune synapse between immune-responding cells and target cells also defines the distances that cannot be functionally bridged by CARs due to distal membrane epitopes on cell surface target molecules; even with short-hinge CARs, the synaptic distance cannot be brought close enough for signal transduction. Similarly, proximal membrane CAR target antigen epitopes have been described, where signal transduction output was observed only against the background of long-hinge CARs. The hinge can be adjusted according to the extracellular antigen-binding region used. The hinge can have any length.

[0116] Transmembrane domains anchor CARs to the cell's plasma membrane. The native transmembrane portion of CD28 can be used with CARs. In other cases, the native transmembrane portion of CD8α can also be used with CARs. "CD8" may refer to a protein having at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with NCBI reference number NP_001759 or its stimulatory fragment thereof. "CD8 nucleic acid molecule" may refer to a polynucleotide encoding a CD8 polypeptide. In some cases, the transmembrane region may be the native transmembrane portion of CD28. "CD28" may refer to a protein having at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with NCBI reference number NP_006130 or its stimulatory fragment thereof. "CD28 nucleic acid molecule" may refer to a polynucleotide encoding a CD28 polypeptide. In some cases, the transmembrane portion may include the CD8α region.

[0117] The intracellular signaling domain of a CAR can be responsible for activating at least one of the effector functions of an immune response cell in which the CAR has been placed. CARs can induce effector functions of T cells, such as cytotoxic activity or co-activities including cytokine secretion. Therefore, the term "intracellular signaling domain" refers to a protein portion that transduces effector function signals and directs the cell to perform specialized functions. While the entire intracellular signaling domain can usually be used, in many cases it is not necessary to use the entire chain of the signaling domain. In some cases, a truncated portion of the intracellular signaling domain is used. In some cases, the term "intracellular signaling domain" therefore means any truncated portion of the intracellular signaling domain that is sufficient to transduce effector function signals.

[0118] Preferred examples of signaling domains for CARs can include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that act in concert to initiate signal transduction upon target-receptor binding, as well as any derivatives or variants of these sequences, and any synthetic sequences having the same functional ability.

[0119] In some cases, the intracellular signaling domain can contain a signaling motif known as an immunoreceptor tyrosine-based activation motif (ITAM). Examples of ITAMs containing cytoplasmic signaling sequences include those from TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d. However, in preferred embodiments, the intracellular signaling domain is from the CD3 zeta chain.

[0120] An example of a T cell signaling domain comprising one or more ITAM motifs is the CD3 zeta domain, also known as T cell receptor T3 zeta chain or CD247. This domain is part of the T cell receptor-CD3 complex and plays an important role in coupling antigen recognition to several intracellular signal transduction pathways that have primary effector activation of T cells. As used herein, CD3 zeta is directed to human CD3 zeta and its isoforms as known from Swissprot entry P20963, including proteins with essentially the same sequence. Again, it is not required that the complete T cell receptor T3 zeta chain is part of the chimeric antigen receptor, and any derivative comprising the signaling domain of the T cell receptor T3 zeta chain is suitable, including any functional equivalent thereof.

[0121] The intracellular signaling domain can be selected from any of the domains in Table 3. In some cases, the domain can be modified such that the homology to any of the reference domains can be from about 50% to about 100%. Any of the domains of Table 3 can be modified such that the modified version can comprise about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or up to about 100% homology.

[0122] The intracellular signaling domain of the CAR can further comprise one or more costimulatory domains. The intracellular signaling domain can comprise a single costimulatory domain, such as the zeta-chain (1stgeneration CAR) or CD28 or 4-1BB (2ndgeneration CAR). In other examples, the intracellular signaling domain can comprise two costimulatory domains, such as CD28 / OX40 or CD28 / 4-1BB (3rdgeneration).

[0123] With intracellular signaling domains such as CD8, these costimulatory domains can produce downstream activation of kinase pathways that support gene transcription and functional cellular responses. Costimulatory domains of CARs can activate proximal signaling proteins associated with CD28 (phosphatidylinositol-4,5-bisphosphate-3-kinase) or 4-1BB / OX40 (TNF-receptor associated factor adaptor protein) pathways as well as MAPK and Akt activation.

[0124] In some cases, the signal generated by the CAR can be compounded with a secondary or costimulatory signal. With respect to costimulatory domains, a chimeric antigen receptor-like complex can be designed to include several possible costimulatory domains. As is well known in the art, in naive T cells, involvement of only the T cell receptor is insufficient to induce full activation of the T cell into a cytotoxic T cell. Full effective T cell activation requires a second costimulatory signal. Several receptors that have been reported to provide costimulation to T cell activation include, but are not limited to, CD28, OX40, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), 4-1BBL, MyD88, and 4-1BB. The signaling pathways utilized by these costimulatory molecules share the common property of synergizing with the primary T cell receptor activation signal. These costimulatory signaling regions provide a signal that can synergize with the primary effector activation signal derived from one or more ITAM-based motifs (e.g., CD3 zeta signaling domain) and can fulfill the requirements for activating a T cell.

[0125] In some cases, the addition of a costimulatory domain to a chimeric antigen receptor-like complex can enhance the efficacy and durability of the engineered cell. In another embodiment, the T cell signaling domain and the costimulatory domain are fused to one another, thereby composing a signaling region. Table 3. Costimulatory Domains

[0126] In some cases, a subject CAR can comprise a sequence that exhibits about 50% to about 100% sequence identity to any one of SEQ ID NOs: 9-13 of Table 4, or a portion thereof. In some cases, a subject CAR can comprise a sequence that exhibits about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or up to about 100% sequence identity to any one of SEQ ID NOs: 9-13. Table 4: CAR-T domains comprising exemplary hinge, transmembrane, intracellular domains: SEQ ID NO: 9、10、11、12、13

[0127] In some cases, a subject CAR can comprise a sequence that exhibits about 50% to about 100% sequence identity to any of SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, or SEQ ID NO: 30 (Table 5). In some cases, a subject CAR can comprise a sequence that exhibits about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or up to about 100% sequence identity to any of SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, or SEQ ID NO: 30. Table 5: Exemplary Anti-GPC3 CARs SEQ ID NO CONSTRUCT 14 4-28Z 15 4-28BBZ 16 4-4-28BBZ 17 4-4-28Z 18 4-14-28BBZ 19 4-14-28Z 20 4-20-28BBZ 21 4-20-28Z 22 4-35-28BBZ 23 4-35-28Z 24 4-42-28BBZ 25 4-42-28Z 26 33-28Z 27 33-28BBZ 28 92-28Z 29 92-BBZ 30 92-28BBZ

[0128] In some cases, an anti-GPC3 CAR can have at least one or more of the following properties in any combination: a) binds to recombinant human GPC3; b) binds to recombinant cynomolgus monkey GPC3; c) binds to endogenous GPC3 on the surface of HepG2 cells; d) binds to cynomolgus monkey GPC3 expressed on the surface of 293 cells; e) binds to endogenous GPC3 on the surface of cancer cells; f) binds to endogenous GPC3 on the surface of hepatocellular carcinoma cells; g) binds to endogenous GPC3 on the surface of cells of a cell line selected from the group consisting of HepG2, Hep3B, Huh7, and JHH-7; h) binds to an epitope within amino acids 25 to 137 of human GPC3; i) binds to an epitope spanning the furin cleavage site at amino acids R358 / S359 of human GPC3; j) binds to full-length mature human GPC3 but not to an N-terminal fragment of human GPC3 or a C-terminal fragment of human GPC3; k) binds to an epitope within amino acids 420 to 470 of human GPC3; 1) binds to an epitope within amino acids 470 to 509 of human GPC3; m) competes with antibody 7H1 for binding to human GPC3; n) competes with antibody 4G7 for binding to human GPC3; o) competes with antibody 15G1 for binding to human GPC3; binds to a C-terminal fragment of human GPC3; and / or p) competes with antibody 4A11 for binding to human GPC3.

[0129] A transgene encoding a subject anti-GPC3 CAR can be incorporated into a cell. For example, the transgene can be incorporated into an immune response cell, such as a T cell. When inserted into a cell, the transgene can be a complementary DNA (cDNA) segment, which is a copy of messenger RNA (mRNA) or the gene itself residing in its original genomic DNA region (with or without introns).

[0130] A nucleic acid (e.g., DNA) encoding a transgene sequence can be randomly inserted into a chromosome of a cell. Random integration can result from any method of introducing a nucleic acid (e.g., DNA) into a cell. For example, the method can be, but is not limited to, electroporation, sonoporation, use of a gene gun, lipofection, calcium phosphate transfection, use of dendrimers, microinjection, and use of viral vectors including adenovirus, AAV, and retroviral vectors, and / or group II ribozymes.

[0131] DNA encoding a transgene can be introduced into a cell via electroporation. DNA can also be introduced into a cell via lipofection, infection, or transformation. Electroporation and / or lipofection can be used to transfect primary cells. Electroporation and / or lipofection can be used to transfect primary hematopoietic cells. DNA can also be introduced into a cell genome without the use of homologous recombination. In some cases, the DNA can be flanked on both sides by engineered sites that are complementary to a targeted double-stranded break region in the genome. In some cases, the DNA can be excised from a polynucleic acid so that it can be inserted into a double-stranded break region without homologous recombination.

[0132] The transgene to be inserted can be flanked on both sides by engineered sites similar to a targeted double-stranded break site in the genome to excise the transgene from a polynucleic acid so that it can be inserted into a double-stranded break region.

[0133] DNA encoding a transgene can also be designed to include a reporter gene so that the presence of the transgene or its expression product can be detected via activation of the reporter gene. Any reporter gene can be used (such as those disclosed above). Cells containing the transgene can be selected by selecting for cells in cell culture in which the reporter gene has been activated.

[0134] Expression of a CAR can be verified by an expression assay (e.g., qPCR) or by measuring RNA levels. Expression levels can also be indicative of copy number. For example, if expression levels are very high, this can indicate that more than one copy of the CAR is integrated into the genome. Alternatively, high expression can indicate that the transgene is integrated in a high transcription region, for example, near a highly expressed promoter. Expression can also be verified by measuring protein levels, such as by Western blotting.

[0135] A subject anti-GPC3 CAR immune responsive cell can comprise one or more transgenes. The one or more transgenes can express a CAR protein that recognizes and binds to at least one epitope on an antigen (e.g., GPC3), or binds to a mutated epitope on an antigen. The CAR can be a functional CAR. A subject anti-GPC3 CAR immune responsive cell can also comprise one or more CARs, or it can comprise a single CAR and a secondary engineered receptor.

[0136] The transgenes can encode suicide genes. As demonstrated in many effective treatments in cancer patients, the regression of targeted tumors in response to CAR immune responder cells can be accompanied by toxicity. In some cases, CAR immune responder cells can not be able to distinguish between tumor and normal tissue when the target antigen is shared between the tumor and normal tissue (“on-target / off-tumor” toxicity). In other cases, systemic perturbations of the immune system can occur, known as cytokine release syndrome (CRS). The CRS can include systemic inflammatory response syndrome or cytokine storm, which can be a result of rapid in vivo expansion of CAR immune responder cells. CRS is a condition characterized by fever and hypotension, which in severe cases can lead to multi-organ failure. In most cases, the toxicity is associated with in vivo expansion of infused CAR immune responder cells, which can cause a general perturbation of the immune system and release high levels of pro-inflammatory cytokines, such as TNFa and IL-6.

[0137] In some cases, CAR immune responder cells can be generated that target an antigen shared with normal tissue, such that they, for example, transiently express the CAR after mRNA electroporation of the receptor. Furthermore, great efforts have been made to further engineer CAR immune responder cells with a safety switch that can allow for significant elimination of the CAR immune responder cells in the case of severe on-target toxicity. The vector encoding the CAR can be combined with a safety switch such as an inducible caspase-9 gene (activated by a dimerizing chemical inducer) or a truncated form of the EGF receptor R (activated by the monoclonal antibody cetuximab) or RQR8.

[0138] The subject anti-GPC3 CAR immune responder cells can encode a suicide gene transgene. The transgene can also include the CAR receptor or another similar receptor. The suicide gene can induce elimination of the CAR immune responder cell. The suicide gene can be any gene that induces apoptosis in the CAR immune responder cell. The suicide gene can be encoded within the viral vector along with the anti-GPC3 CAR.

[0139] The one or more transgenes can be from a different species. For example, the one or more transgenes can include a human gene, a mouse gene, a rat gene, a pig gene, a cow gene, a dog gene, a cat gene, a monkey gene, a chimpanzee gene, or any combination thereof. For example, the transgene can be from a human, which has a human gene sequence. The one or more transgenes can include a human gene. In some cases, the one or more transgenes are not an adenovirus gene.

[0140] As described above, the transgene can be inserted into the genome of the immunoresponsive cell in a random manner or in a site-specific manner. For example, the transgene can be inserted into a random locus in the genome of the immunoresponsive cell. These transgenes can be functional, e.g., fully functional if inserted at any location in the genome. For example, the transgene can encode its own promoter, or can be inserted at a location under the control of an endogenous promoter. Alternatively, the transgene can be inserted into a gene, such as an intron of a gene or an exon, promoter, or non-coding region of a gene. The transgene can be inserted such that the insertion disrupts a gene, e.g., an endogenous immune checkpoint.

[0141] Sometimes, more than one copy of the transgene can be inserted into more than one random locus in the genome. For example, multiple copies can be inserted into random loci in the genome. This can result in increased overall expression compared to the case where the transgene is inserted randomly once. Alternatively, one copy of the transgene can be inserted into a gene, and another copy of the transgene can be inserted into a different gene. The transgene can be targeted such that it can be inserted into a specific locus in the genome of the immunoresponsive cell.

[0142] In some cases, the polynucleic acid comprising a sequence encoding a subject anti-GPC3 CAR can be in the form of a plasmid vector. The plasmid vector can comprise a promoter. In some cases, the promoter can be constitutive. In some cases, the promoter can be inducible. The promoter can be or can be from CMV, U6, MND, or EF1a. In some cases, the promoter can be adjacent to the CAR sequence. In some cases, the plasmid vector further comprises a splice acceptor. In some cases, the splice acceptor can be adjacent to the CAR sequence. The promoter sequence can be a PKG or MND promoter. The MND promoter can be a synthetic promoter containing the U3 region of the modified MoMuLV LTR and the myeloblastosis-associated virus enhancer.

[0143] In some cases, the polynucleic acid encoding a subject anti-GPC3 CAR can be designed to be delivered to a cell by non-viral techniques. In some cases, the polynucleic acid can be good manufacturing practice (GMP) compatible.

[0144] Expression of the polynucleic acid encoding a subject anti-GPC3 CAR can be controlled by one or more promoters. The promoter can be ubiquitous, constitutive (a promoter that is unregulated, which allows for continuous transcription of the associated gene), tissue-specific, or inducible. Expression of a transgene inserted near or around a promoter can be regulated. For example, the transgene can be inserted around or adjacent to a ubiquitous promoter. Some ubiquitous promoters can be a CAGGS promoter, a hCMV promoter, a PGK promoter, a SV40 promoter, or a ROSA26 promoter.

[0145] The promoter can be endogenous or exogenous. For example, one or more transgenes can be inserted near or around an endogenous or exogenous ROSA26 promoter. Further, the promoter can be specific to an immune responsive cell. For example, one or more transgenes can be inserted near or around a pig ROSA26 promoter.

[0146] A tissue-specific promoter or a cell-specific promoter can be used to control where expression occurs. For example, one or more transgenes can be inserted near or around a tissue-specific promoter. The tissue-specific promoter can be a FABP promoter, a Lck promoter, a CamKII promoter, a CD19 promoter, a keratin promoter, an albumin promoter, an aP2 promoter, an insulin promoter, an MCK promoter, a MyHC promoter, a WAP promoter, or a Col2A promoter.

[0147] A tissue-specific promoter or a cell-specific promoter can be used to control where expression occurs. For example, one or more transgenes can be inserted near or around a tissue-specific promoter. The tissue-specific promoter can be a FABP promoter, a Lck promoter, a CamKII promoter, a CD19 promoter, a keratin promoter, an albumin promoter, an aP2 promoter, an insulin promoter, an MCK promoter, a MyHC promoter, a WAP promoter, or a Col2A promoter.

[0148] Inducible promoters can also be used. These inducible promoters can be turned on and off by the addition or removal of an inducing agent when needed. It is contemplated that the inducible promoter can be, but is not limited to, Lac, tac, trc, trp, araBAD, phoA, recA, proU, cst-1, tetA, cadA, nar, PL, cspA, T7, VHB, Mx, and / or Trex.

[0149] Further, while not required for expression, the transgene sequence can also include transcriptional or translational regulatory sequences, for example, a promoter, an enhancer, an insulator, an internal ribosome entry site, a sequence encoding a 2A peptide, and / or a polyadenylation signal.

[0150] In some cases, the transgene encodes a subject anti-GPC3 CAR, wherein the transgene is inserted into a safe harbor such that the anti-GPC3 CAR is expressed. In some cases, the transgene is inserted into the PD1 and / or CTLA-4 locus. In other cases, the transgene is delivered to the cell in a lentivirus for random insertion, while the PD1 or CTLA-4 specific nuclease can be provided as mRNA. In some cases, the transgene is delivered via a viral vector system such as a retrovirus, AAV, or adenovirus with mRNA encoding a nuclease specific for a safe harbor (e.g., AAVS1, CCR5, albumin, or HPRT). The cell can also be treated with mRNA encoding a PD1 and / or CTLA-4 specific nuclease. In some cases, the polynucleotide encoding the CAR is provided via a viral delivery system with mRNA encoding a HPRT specific nuclease and a PD1 or CTLA-4 specific nuclease. CARs that can be used with the methods and compositions disclosed herein can include all types of these chimeric proteins, including first, second, and third generation designs. Other agents such as CCR2 or siRNA can be applied to reduce PD-1 expression.

[0151] In some cases, a retroviral vector (gamma-retrovirus or lentivirus) can be used to introduce a transgene into an immunoresponsive cell. For example, a transgene encoding a CAR (e.g., an anti-GPC3 CAR) or any receptor or variant or fragment thereof that binds to a GPC3 antigen can be cloned into a retroviral vector and expression can be driven by its endogenous promoter, a retroviral long terminal repeat, or a promoter specific for the target cell type of interest. Non-viral vectors can also be used. Non-viral vector delivery systems can include DNA plasmids, naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes or poloxamers.

[0152] A number of viral-based systems have been developed to transfer genes into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. Techniques known in the art can be used to insert a selected gene into a vector and package it in a retroviral particle. Vectors from retroviruses such as lentivirus are suitable tools to achieve long-term gene transfer because they allow long-term, stable integration of the transgene and its propagation in daughter cells. Lentiviral vectors have the additional advantage over vectors from onco-retroviruses such as murine leukemia virus because they can transduce non-proliferating cells. They also have the additional advantage of low immunogenicity. Adenoviral vectors have the advantage of not integrating into the genome of the target cell, thereby avoiding negative integration-related events.

[0153] A cell can be transfected with a transgene encoding a CAR. The transgene concentration can be from about 100 picograms to about 50 micrograms. In some cases, the amount of nucleic acid (e.g., ssDNA, dsDNA, RNA) that can be introduced into a cell can be varied to optimize transfection efficiency and / or cell viability. For example, 1 microgram of dsDNA can be added to each cell sample for electroporation. In some cases, the amount of nucleic acid (e.g., dsDNA) required for optimal transfection efficiency and / or cell viability can be cell type specific. In some cases, the amount of nucleic acid (e.g., dsDNA) used for each sample can directly correspond to transfection efficiency and / or cell viability. For example, a range of transfection concentrations. The transgene encoded by the vector can integrate into the cell genome. In some cases, integration of the transgene encoded by the vector is forward. In other cases, integration of the transgene encoded by the vector is reverse.

[0154] In some cases, the starting cell density for viral delivery of cell modification such as a CAR can be varied to optimize transfection efficiency and / or cell viability. In some cases, the starting cell density for transfection or transduction of a cell by a viral vector can be less than about 1 x 10 5 cells. In some cases, the starting cell density for cell modification by a viral vector can be at least about 1 x 10 5 cells to at least about 5 x 10 7 cells. In some cases, the starting cell density for optimal transfection efficiency and / or cell viability can be cell type specific. For example, for macrophages, a starting cell density of 1.5 x 10 6 cells can be optimal (e.g., provide the highest viability and / or transfection efficiency). In another example, for human cells, a starting cell density of 5 x 10 6 cells can be optimal (e.g., provide the highest viability and / or transfection efficiency). In some cases, a range of starting cell densities can be optimal for a given cell type. For example, for human cells such as T cells, a starting cell density of 5.6 x 10 6 cells to 5 x 10 7 cells can be optimal (e.g., provide the highest viability and / or transfection efficiency).

[0155] The efficiency with which nucleic acid sequences encoding CARs are integrated into the cell genome using, for example, viral systems can be approximately 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or higher than 99.9%. In some cases, the CAR detection on the cell membrane of engineered cells can be or can be about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or higher, as measured by flow cytometry.

[0156] In some cases, immune response cells can be stem memory T cells composed of CD45RO(-), CCR7(+), CD45RA(+), CD62L+ (L-selectin), CD27+, CD28+ and / or IL-7Rα+. SCM The stem memory cells may also express CD95, IL-2Rβ, CXCR3, and / or LFA-1, and exhibit many functional properties different from those of the stem memory cells. Alternatively, the immune response cells may also be central memory T cells containing L-selectin and CCR7. CM Cells, including central memory cells, may secrete IL-2, but not IFNγ or IL-4. Immune response cells can also be effector memory T cells containing L-selectin or CCR7. EM Cells produce effector cytokines such as IFNγ and IL-4.

[0157] The carrier can be delivered in vivo by administration to an individual patient, typically via systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial infusion) or local administration, as described below. Alternatively, the carrier can be delivered ex vivo to cells, such as cells removed from an individual patient (e.g., lymphocytes, T cells, bone marrow aspirate, tissue biopsy), and then typically re-implanted into the patient after selection of cells in which the carrier has been incorporated. The cells can be expanded before or after selection.

[0158] Suitable immune response cells for expressing anti-GPC3-CAR can be autologous or non-autologous cells for the subject in need.

[0159] Suitable sources of immune responsive cells can be obtained from a subject. In some cases, T cells can be obtained. The T cells can be obtained from a number of sources, including PBMC, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, and tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain cases, any number of techniques known to those of skill can be used, such as Ficoll TM T cells are isolated from a blood unit collected from a subject. In one embodiment, cells from the circulating blood of an individual are obtained by apheresis. Apheresis products typically contain lymphocytes (including T cells, monocytes, granulocytes, B cells), other nucleated white blood cells, red blood cells, and platelets. In one embodiment, the cells collected by apheresis can be washed to remove the plasma fraction and place the cells in an appropriate buffer or media for subsequent processing steps.

[0160] Alternatively, the cells can be from a healthy donor, from a patient diagnosed with cancer, or from a patient diagnosed with an infection. In another embodiment, the cells can be part of a mixed cell population exhibiting different phenotypic characteristics. Cell lines can also be obtained from transformed T cells according to the foregoing methods. Cells can also be obtained from a cell therapy bank. Modified cells that are resistant to immunosuppressive therapy can be obtained by any of the methods described herein. The desired cell population can also be selected prior to modification. The engineered cell population can also be selected after modification. The engineered cells can be used for autologous transplantation. Alternatively, the cells can be used for allogeneic transplantation. In some cases, the cells are administered to the same patient whose sample was used to identify the cancer-related target sequence. In other cases, the cells are administered to a different patient than the patient whose sample was used to identify the cancer-related target sequence.

[0161] In some cases, the immune responsive cells can be primary cells, including primary T cells, stem cells, or progenitor cells. The progenitor cells can be hematopoietic progenitor cells. The cells of the present invention can be human cells. Suitable cells can be expanded ex vivo. Suitable cells can also be CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+), IL-7R alpha(+), or a combination thereof.

[0162] In some cases, suitable primary cells include peripheral blood mononuclear cells (PBMCs), peripheral blood lymphocytes (PBLs), and other blood cell subpopulations, such as, but not limited to, T cells, natural killer cells, monocytes, natural killer T cells, monocyte precursor cells, hematopoietic stem cells, or non-pluripotent stem cells. In some cases, the cells can be any immune cell, including any T cell (TIL), such as tumor-infiltrating cells, such as CD3+ T cells, CD4+ T cells, CD8+ T cells, or any other type of T cell. T cells may also include memory T cells, memory stem T cells, or effector T cells. T cells may also be selected from a bulk population, for example, T cells selected from whole blood. T cells may also be expanded from a bulk population. T cells may also be biased towards a specific population and phenotype. For example, T cells may be phenotyped as including CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+), and / or IL-7Rα(+). Suitable cells may be selected that contain one or more markers selected from the following: CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+), and / or IL-7Rα(+). Suitable cells also include stem cells, for example, such as embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells, neuronal stem cells, and mesenchymal stem cells. Suitable cells may include any number of primary cells, such as human cells, non-human cells, and / or mouse cells. Suitable cells may be progenitor cells. Suitable cells may be derived from the subject to be treated (e.g., a patient). Suitable cells may be derived from a human donor. Suitable cells may be stem memory T cells composed of CD45RO(-), CCR7(+), CD45RA(+), CD62L+ (L-selectin), CD27+, CD28+, and IL-7Rα+. SCM The stem memory cells may also express CD95, IL-2Rβ, CXCR3, and LFA-1, and exhibit many functional properties different from those of the stem memory cells. Suitable cells may be central memory T cells containing L-selectin and CCR7. CM The central memory cells may secrete, for example, IL-2, but not IFNγ or IL-4. Suitable cells may also be effector memory T cells containing L-selectin or CCR7. EM Cells produce effector cytokines such as IFNγ and IL-4.

[0163] In some cases, the method may include enriching the CD8+ of cultured T cells prior to rapid cell expansion. + T cells. After culturing T cells in IL-2, they can be isolated using, for example, CD8 microbeads (e.g., using CliniMACS).plus CD8 microbead system (Miltenyi Biotec)) to deplete CD4 + cells and enrich CD8 + cells. Without being bound by a particular theory, it is believed that CD4 + , CD25 + regulatory T cells can hinder anti-tumor responses. Thus, it is believed that enriching the T cells cultured for CD8 + T cells and reducing or eliminating CD4 + cells can improve the impact of adoptively transferred anti-tumor CD4 + cells, improve the response rate in patients, and / or reduce toxicity seen by CD4 + cytokine production. Additionally, it is believed that enriched CD8 + "young" T cells perform more reliably and more predictably in rapid expansion at a clinical scale than mixed T cells.

[0164] The cells can be good manufacturing practice (GMP) compatible reagents. The cells can be part of a combination therapy to treat a cancer, an infection, an autoimmune disorder, or graft versus host disease (GVHD) in a subject in need thereof. In some cases, the cells of the application can be administered as a monotherapy to a subject in need thereof.

[0165] In some cases, the cells expressing the subject CAR comprise a heterogeneous population of T cells. In some cases, the cells used can consist primarily of CD4 and CD8 T cells in varying proportions. The CD4 and CD8 cells can have phenotypic characteristics of circulating effector T cells. The CD4 and CD8 cells can also have phenotypic characteristics of effector-memory cells. In another embodiment, the cells can be central-memory cells.

[0166] Suitable cells that can be isolated from a donor can be at any stage of development, including but not limited to fetal, neonatal, young adult, and adult. For example, the donor immune response cells can be isolated from an adult human. The donor human immune response cells can be 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 years of age. For example, the immune response cells can be isolated from a human less than 6 years of age. The immune response cells can also be isolated from a human less than 3 years of age. The donor can be more than 10 years of age.

[0167] Methods of obtaining suitable cells can include selection based on a given marker. For example, such markers can include GFP, a resistance gene, a cell surface marker, or an endogenous tag. Cells can be selected using any endogenous marker. Suitable cell selection techniques include flow cytometry and / or magnetic columns. The selected cells can then be infused into a subject. The selected cells can also be expanded to a large number. The selected cells can be expanded prior to infusion.

[0168] The amount of cells necessary for therapeutic effectiveness in a patient can vary depending on cell viability and efficiency of genetic modification of the cells (e.g., efficiency of transgene integration into one or more cells, or expression level of a protein encoded by the transgene). In some cases, the product of cell viability following genetic modification (e.g., proliferation) and efficiency of transgene integration can correspond to a therapeutic aliquot of cells that can be used for administration to a subject. In some cases, an increase in cell viability following genetic modification can correspond to a decrease in the amount of cells necessary for therapeutic effectiveness in a patient for administration. In some cases, an increase in efficiency of transgene integration into one or more cells can correspond to a decrease in the amount of cells necessary for therapeutic effectiveness in a patient for administration. In some cases, determining the amount of cells necessary for therapeutic effectiveness can comprise determining a function corresponding to cell viability as a function of time. In some cases, determining the amount of cells necessary for therapeutic effectiveness can comprise determining a function corresponding to a change in efficiency of transgene integration into one or more cells relative to a time-dependent variable (e.g., cell culture time, electroporation time, cell stimulation time). In some cases, therapeutically effective cells can be a population of cells comprising about 30% to about 100% anti-GPC3 CAR expression on the surface of the cells. In some cases, therapeutically effective cells can express about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% to greater than about 99.9% of an anti-GPC3 CAR on the surface of the cells, as measured by flow cytometry.

[0169] As described above, various cells can be used to express the subject CARs. The anti-GPC3 CARs can be present in the plasma membrane of eukaryotic cells, e.g., mammalian cells, where suitable mammalian cells include, but are not limited to, cytotoxic cells, T lymphocytes, stem cells, progeny of stem cells, progenitor cells, progeny of progenitor cells, and NK cells.

[0170] When present in the plasma membrane of a eukaryotic cell, a CAR can be active in the presence of its binding target. For example, an anti-GPC3 CAR can be active in the presence of GPC3. A target, such as GPC3, can be expressed on a membrane. A target can also be soluble (e.g., not bound to a cell). A target can be present on the surface of a cell, such as a target cell. A target can be present on a solid surface, such as a lipid bilayer; and the like. A target can be soluble, such as a soluble antigen. A target can be an antigen. An antigen can be present on the surface of a cell, such as a target cell. An antigen can be present on a solid surface, such as a lipid bilayer; and the like. In some cases, a target can be an epitope of an antigen. In the methods disclosed herein, the antigen is typically GPC3, and the target cell expressing GPC3 is a cancer cell or a tumor cell.

[0171] In some cases, when a CAR is present on the plasma membrane of a cell, and when activated by binding its target, it can result in cytotoxic activity of the cell against a target cell expressing on its cell surface an antigen bound by the CAR binding domain. For example, in some cases, the cell can be a cytotoxic cell (e.g., an NK cell or a cytotoxic T lymphocyte), and a CAR of the disclosure, when present on the plasma membrane of the cell and when activated by binding its target, can increase cytotoxic activity of the cytotoxic cell against a target cell expressing on its cell surface an antigen bound by the CAR binding domain. For example, in some cases, the cell can be an NK cell or a T lymphocyte, and a CAR of the disclosure, when present on the plasma membrane of the cell and when activated by binding its target, can increase cytotoxic activity of the cell by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 75%, at least 2-fold, at least 2.5-fold, at least 5-fold, at least 10-fold, or more than 10-fold, as compared to the cytotoxic activity of the cell in the absence of binding target.

[0172] In some cases, when activated by binding to its target, a CAR can cause other CAR activation-related events, such as proliferation and expansion (due to increased cell division or anti-apoptotic responses). Cell proliferation can be measured visually by observing cell clustering seen under a microscope. Cell expansion can be measured by a hemocytometer measurement. In some cases, a CAR-T cell can have increased cell proliferation and expansion compared to a comparable T cell (non-CAR T cell). The increased cell expansion can be about 1-fold to about 20-fold compared to a comparable cell. The increased cell expansion can be about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or up to 20-fold compared to a comparable cell. Cell expansion can be measured over a period of time. For example, cell expansion can occur over the time period from cell collection to infusion into a subject. In other cases, cell expansion can occur from 1 day up to about 30 days after collection. Cell expansion can occur from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or up to 30 days after collection. In some cases, cells can be expanded using a rapid expansion protocol (REP) prior to infusion into a subject. In some cases, the REP can occur over a period of about 14 days.

[0173] In some cases, when activated by binding to its target, a CAR can cause other CAR activation-related events, such as intracellular signaling modulation, cell differentiation, or cell death. In some cases, expression of a CAR on a cell can alter the intracellular signaling of the cell. In other cases, expression of a CAR can alter cell differentiation.

[0174] The subject anti-GPC3 CAR immune response cells can be administered to a GPC3-expressing cancer subject or tumor subject concurrently with or after a lymphodepleting therapy.

[0175] In some aspects, the anti-GPC3 CAR immune response cells are administered after a lymphodepleting therapy. The therapy can reduce circulating lymphocytes in the treated subject, or substantially deplete circulating lymphocytes of lymphocytes (i.e., lymphodepletion). For example, the anti-GPC3 CAR immune response cells can be administered at least 1 hour to at least 1 week after the lymphodepleting therapy. For example, the anti-GPC3 CAR immune response cells can be administered at least 1 hour, 2 hours, 4 hours, 6 hours, 8 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 24 hours, 36 hours, 48 hours, 3 days, 4 days, 5 days, 6 days, or 7 days or more after the lymphodepleting therapy. In some cases, the CAR-T can be administered about 1, 2, 3, 4, 5, 6 weeks or more after the lymphodepleting therapy.

[0176] In some cases, host lymphopenia can facilitate expansion of anti-GPC3 CAR immune response cells, such as CAR T cells. In one aspect, lymphopenia can create "space" for the upcoming adoptively transferred cells, while in another aspect, it can induce homeostatic expansion of the cells. The latter effect can be mediated by chemotherapy ablation of endogenous regulatory T cells, which can normally secrete inhibitory cytokines (e.g., TGF-beta and IL-10) that can limit expansion of effector cells, such as CAR T cells. In some cases, the lymphodepleting therapy can increase in vivo expansion of anti-GPC3 CAR immune response cells by about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or up to 20-fold compared to treatment with anti-GPC3 CAR immune response cells without lymphodepleting therapy.

[0177] In addition, T cell homeostatic cytokines, such as IL-7 and IL-15, which are normally present in limited amounts, can become readily available due to less competition and increased production by lymphoid stromal cells. Thus, induction of lymphopenia can be performed prior to infusion of anti-GPC3 CAR immune response cells to increase efficacy of the anti-GPC3 CAR immune response cells in treating a subject. In some cases, the lymphodepleting therapy by tumor reduction or control measurement can increase anti-tumor efficacy by about 10% to about 100% compared to treatment without lymphodepleting therapy. For example, the lymphodepleting therapy can increase anti-tumor efficacy by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or up to 100% compared to treatment without lymphodepleting therapy.

[0178] Lymphodepletion can be performed using a variety of means. Lymphodepletion can be performed prior to administration of the anti-GPC3 CAR immune response cells using total body irradiation (TBI) or cytotoxic drugs. While these modalities can be intended to deplete the recipient's lymphoid compartment, they can also facilitate the presentation of tumor antigens by triggering tumor cell death and antigen release. Subsequently, these antigens can be taken up and presented by antigen presenting cells (APCs) to enhance activation of the anti-GPC3 CAR immune response cells.

[0179] Radiation and / or chemotherapy can cause host cell activation, leading to the release of proinflammatory cytokines such as TNF-a, IL-1, and IL-4, and upregulation of costimulatory molecules such as CD80. In some cases, lymphodepletion therapy can improve anti-GPC3 CAR immune response cell therapy by activating host cells. In some cases, lymphodepletion therapy can improve anti-GPC3 CAR immune response cell therapy by upregulating costimulatory molecules. In addition to enhanced APC function and availability, preconditioning regimens can also disrupt the integrity of mucosal barriers through radiation-induced apoptosis of these organs' lining cells. Damage to the gut can allow bacterial products such as LPS to translocate into the systemic circulation. LPS can in turn activate anti-GPC3 CAR immune response cells in vivo and can enhance anti-tumor responses. Thus, proinflammatory cytokines and microbial products provide critical "danger signals" for the activation and maturation of DCs, thereby enhancing anti-GPC3 CAR immune response cell-mediated tumor therapy.

[0180] In some cases, lymphodepletion therapy can selectively deplete cells expressing CD25 in humans, including humanized anti-Tac (anti-CD25) and ONTAK TM (dexamethasone) and IL-2 (IL-2) (with diphtheria toxin conjugated to IL-2).

[0181] In some cases, a chemotherapeutic agent can be administered to achieve lymphopenia in the subject. In some cases, the subject can receive a nonmyeloablative lymphodepleting chemotherapy. The nonmyeloablative lymphodepleting chemotherapy can be any suitable such therapy, which can be administered by any suitable route. The chemotherapy regimen can include the use of a single alkylating agent, such as cyclophosphamide or chlorambucil, or a combination, such as CVP (cyclophosphamide, vincristine, and prednisone), CHOP (CVP and doxorubicin), C-MOPP (cyclophosphamide, vincristine, prednisone, and procarbazine), CAP-BOP (CHOP plus procarbazine and bleomycin), m-BACOD (CHOP plus methotrexate, bleomycin, and leucovorin), ProMACE-MOPP (prednisone, methotrexate, doxorubicin, cyclophosphamide, etoposide, and leucovorin plus standard MOPP), ProMACE-CytaBOM (prednisone, doxorubicin, cyclophosphamide, etoposide, cytarabine, bleomycin, vincristine, methotrexate, and leucovorin), and MACOP-B (methotrexate, doxorubicin, cyclophosphamide, vincristine, fixed-dose prednisone, bleomycin, and leucovorin).

[0182] The nonmyeloablative lymphodepleting chemotherapy can include, for example, the administration of cyclophosphamide and fludarabine, particularly if the cancer is GPC3 positive, which can be metastatic. The preferred route of administration of cyclophosphamide and fludarabine can be intravenous. Likewise, any suitable dose of cyclophosphamide and fludarabine can be administered. Preferably, about 60 mg / kg of cyclophosphamide can be administered for two days, followed by about 25 mg / m2of fludarabine for about five days. 2

[0183] ​In some cases, lymphodepletion can be performed to minimize immune-mediated rejection of GPC3 CAR immune response cells. For example, a subject can be treated with cyclophosphamide (Cy) followed by fludarabine (Flu) lymphodepleting treatment. The dose of a chemotherapeutic agent such as Cy can be from about 1 mg / kg to about 200 mg / kg. The dose of Cy for a subject can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or up to about 200 mg / kg.

[0184] Alternatively, exemplary doses and regimens for Cy treatment can be about 0.5-5 g / m 2 per day, preferably 0.6-3 g / m 2 per day, more preferably 1-2 g / m 2 per day; for 1-3 days, preferably 1-2 days.

[0185] The dose of Flu for a subject can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or up to about 200 mg / m 2 .

[0186] Alternatively, exemplary dosages and regimens for fludarabine treatment can be about 20-80 mg / m 2 / day, preferably 25-70 mg / m 2 / day or 25-30 mg / m 2 / day for 2-10 days, 3-8 days, or 4, 5, 6, or 7 days.

[0187] In some cases, a combination of Cy and Flu can be applied. For example, an initial dose of Flu can be in the range of about 10-60 mg / m 2 / day or 15-50 mg / m 2 / day or 20-30 mg / m 2 / day for 2-8 days or 3-6 days, followed by Cy in an amount of about 0.2-1 mg / m 2 / day or 0.3-0.8 mg / m 2 / day or 0.4-0.6 g / m 2 / day for 1-5 days or 2-3 days.

[0188] In some cases, prior to infusion of anti-GPC3 CAR immune response cells, the subject can receive Cy and Flu treatment, 60 mg / kg Cy administered once and 25 mg / m 2Flu is administered 3 to 5 times. Prior to infusion of anti-GPC3 CAR immune responsive cells, the subject can receive about 0 to about 20 administrations of a lymphodepletant. Prior to infusion of anti-GPC3 CAR immune responsive cells, the subject can receive about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, up to 20 administrations of a lymphodepletant such as Cy or Flu. In other cases, the subject can be co-administered a lymphodepletant, such as Cy and / or Flu, concurrently with the infusion of anti-GPC3 CAR immune responsive cells. In other cases, the subject can be administered a lymphodepletant, such as Cy and / or Flu, after the administration of anti-GPC3 CAR immune responsive cells. In other cases, the subject can be administered a lymphodepletant before, concurrently with, and / or after the administration of anti-GPC3 CAR immune responsive cells. In some cases, the subject can not receive a lymphodepletion treatment. In some cases, different doses of a lymphodepletant can be used during the course of the regimen. For example, the subject can receive 60 mg / kg of Cy prior to receiving anti-GPC3 CAR immune responsive cells, and then 40 mg / kg of Cy concurrently with receiving anti-GPC3 CAR immune responsive cells. A complete blood count (CBC) can be performed to determine the extent of lymphodepletion and whether additional administrations can be necessary. In some cases, Cy can be administered alone. In other cases, Flu can be administered alone. In some cases, Cy and Flu can be used alternately during the regimen.

[0189] Lymphodepletion can improve expansion of anti-GPC3 CAR immune responsive cells. Lymphodepletion can improve persistence of anti-GPC3 CAR immune responsive cells in the blood. Anti-GPC3 CAR immune responsive cell expansion and persistence can be detected by flow cytometry analysis using anti-CAR antibodies. Anti-GPC3 CAR immune responsive cell persistence can also be measured by evaluating copy number of anti-GPC3 CAR immune responsive cells by qPCR.

[0190] In some cases, the subject can receive a reduced dose of anti-GPC3 CAR immune responsive cells if lymphodepletion treatment is performed, as compared to a subject that can not receive lymphodepletion treatment.

[0191] In some cases, the lymphodepleting treatment can be administered over a period of time. For example, the lymphodepleting treatment can be administered over a course of 1 minute to about 24 hours. The lymphodepleting treatment can be performed for 1 minute, 15 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, or up to about 24 hours. The lymphodepleting agent can be co-administered with other agents such as diluents, uroprotectants, excipients, or combinations thereof. For example, sodium 2-mercaptoethanesulfonate (mesna) can be included in the lymphodepleting treatment. In some cases, the subject can be administered cyclophosphamide at 60 mg / kg / day intravenously in 250 ml D5W for about 2 days, and mesna at 15 mg / kg / day over 1 hour for 2 days. Mesna can be co-administered with various doses of the lymphodepleting agent. For example, mesna can be administered at about 1 mg / kg / day up to about 50 mg / kg / day. Mesna can be administered at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or up to about 50 mg / kg / day. In some cases, for obese or pediatric subjects, the drug dose can be calculated using the actual weight. The actual weight can be the average of the actual weight and the ideal body weight. For example, for males, the ideal body weight can be calculated as = 50 kg + 2.3 (number of inches over 60 inches). For females, the ideal body weight can be calculated as = 45.5 kg + 2.3 (number of inches over 60 inches). In some cases, the Flu administration can be 25 mg / m 2 / day for 5 days via intravenous infusion (IVPB) for 30 minutes. In some cases, the Flu administration can be performed prior to the Cy administration. In some cases, the Flu administration can be performed concurrently with the Cy administration. In some cases, the Flu administration can be performed after the Cy administration. In some cases, the fludarabine can be administered about 1 to 2 hours after the Cy and mesna.

[0192] Total body irradiation can be a form of radiotherapy. As the name implies, TBI can involve radiation of the entire body, but in modern practice, the lungs can be partially shielded to reduce the risk of radiation-induced lung injury. Total body irradiation can be administered in various doses. For example, total body irradiation can be administered at about 10 to about 12 Gy. In some cases, total body irradiation can be fractionated, with smaller doses delivered in several fractions, rather than the entire dose delivered at once. In some cases, 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to 10 different doses of radiation can be administered.

[0193] The reported D0 value (the amount of ionizing radiation necessary to eradicate a particular cell type) for hematopoietic stem cells can be about 0.5 to about 1.4 Gy, while the D0 value for a human leukemia cell line can be about 0.8 to about 1.5 Gy, indicating that both cell types are radiosensitive. The ideal dosing regimen can depend on the patient age, disease, and type of treatment intended. Myeloablative TBI can be about 12 to about 15 Gy, given in about 8 to about 12 fractions over about 4 days, with about 2 to about 3 treatments per day. In some cases, myeloablative TBI can be about 5 to about 20 Gy. Myeloablative TBI can be about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, to about 20 Gy. In some cases, myeloablative TBI can be given in about 5 to about 20 fractions. Myeloablative TBI can be given in about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, to about 20 fractions. Myeloablative therapy can be given over about 1 day to about 10 days. Myeloablative therapy can be administered over about 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to about 10 days.

[0194] In some cases, low dose TBI can include a dose of about 2 to about 8 Gy given in about 1 to about 4 fractions. In some cases, the low dose can include about 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, or up to 8 Gy. Low dose TBI can be administered to subjects who are not tolerant of myeloablation due to age or co-morbidities.

[0195] TBI can be administered using parallel-opposed high-energy photon beam pairs, which can be about 4 to about 18 MV for TBI. In some cases, the photon beam can be about 1 to about 25 MV for TBI. The photon beam can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or up to about 25 MV. TCI can be performed using devices such as Varian Clinac iX or Siemens Artiste.

[0196] In some cases, the rate of administration can be about 5 cGy / min to about 100 cGy / min. The rate of administration can be about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 95, or up to 100 cGy / min.

[0197] In some cases, certain organs can be shielded during radiation. For example, the liver, lungs, brain, heart, or a combination thereof can be shielded during whole body irradiation. Biological agents

[0198] In some cases, biological agents such as antibodies can be used to deplete immune cells. Monoclonal antibodies (mAbs) that are lytic for lymphocytes can be an additional means to produce lymphopenia. In some cases, antibodies for T cell lymphocyte depletion that can be administered prior to anti-GPC3 CAR immune response cell infusion should be effective in vivo but transiently present to allow rapid infusion and proliferation with the infused anti-GPC3 CAR immune response cells. The antibodies used can target a marker expressed on the surface of cells such as lymphocytes. In some cases, the lymphocyte depleting antibodies can be anti-CD3, anti-CD4, anti-CD8, anti-CD45, anti-CD25, anti-CD52, and any combination thereof.

[0199] Antibodies such as alemtuzumab (Campath-1H), bortezomib, thymoglobulin (rabbit ATG, Genzyme), ATGAM (horse ATG, Pfizer), and alemtuzumab (Campath-1H) can be used. Rituximab (IDEC-C2B8), GA101, a humanized IgGl anti-CD20, XmAb5574, an Fc-engineered antibody against CD19, Alefacept (LFA3-Ig), Fingolimod (FTY720), anti-thymocyte globulin (ATG), anti-CD4 antibodies, anti-CD3 antibodies, anti-CD8 antibodies can also be used as lymphocyte depleting agents. In some cases, cladribine (2-CdA, Cladex®), fludarabine (Fludara®), cyclophosphamide (Cytoxan®), and / or mycophenolate mofetil (CellCept®) can be used. ), a purine analog similar to fludarabine. In some cases, the antibody lymphodepleting therapy can comprise a single antibody, such as alemtuzumab (anti-CD52). In other cases, the antibody-based lymphodepleting therapy can comprise at least two antibodies, such as alemtuzumab and anti-CD45. In some cases, the lymphodepleting therapy can include multiple lymphodepleting modalities, such as radiation in conjunction with antibody therapy or chemotherapy in conjunction with radiation. Chemotherapy and antibody therapy can also be used in combination.

[0200] Antibiotics, antifungals, and antivirals can be administered to the subject as prophylaxis during the lymphodepleting therapy. For example, prophylaxis can include 500 mg Altrex daily, q M W F one tablet of Dificid®, and 200 mg fluconazole daily. The medication is continued until the absolute lymphocyte count (ALC) and absolute neutrophil count (ANC) counts can return to pre-medication baseline. The biological agent can also be doxorubicin.

[0201] One or more cytokines can be introduced with the cells. Cytokines can be utilized to promote expansion of the cells (including adoptively transferred tumor-specific cells) that facilitate metastasis within the tumor microenvironment. In some cases, IL-2 can be used to promote expansion of the cells described herein. Cytokines such as IL-1) can also be used. Other relevant cytokines in the field of immunotherapy can also be utilized, such as IL-2, IL-7, IL-12, and L-21, or any combination thereof. In some cases, recombinant cytokines are used.

[0202] In some cases, a T cell growth factor can be administered. The growth factor can be administered by any suitable route. If more than one T cell growth factor is administered, they can be administered simultaneously or sequentially in any order, and by the same route or different routes. A T cell growth factor such as aldesleukin (IL-2) can be administered as an intravenous bolus. The dose of a T cell growth factor such as IL-2 is a dose that is considered high by one of ordinary skill in the art. Preferably, a dose of IL-2 of about 720,000 IU / kg can be administered three times daily until tolerance is reached. In some cases, about 5 to about 15 doses of IL-2 are administered, on average about 9 doses. The dose of a T cell growth factor can be about 0 to about 20. A T cell growth factor can be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or up to about 20 times.

[0203] IL-2 can be administered as an intravenous bolus at a dose of 720,000 IU / kg (based on total body weight). In some cases, IL-2 can be administered over a period of 15 minutes. In some cases, IL-2 can be administered over a period of 20 minutes. IL-2 can be administered by immediate injection. In some cases, IL-2 can be administered over a period of 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, 31 minutes, 32 minutes, 33 minutes, 34 minutes, 35 minutes, 36 minutes, 37 minutes, 38 minutes, 39 minutes, 40 minutes, 41 minutes, 42 minutes, 43 minutes, 44 minutes, 45 minutes, 46 minutes, 47 minutes, 48 minutes, 49 minutes, 50 minutes, 51 minutes, 52 minutes, 53 minutes, 54 minutes, 55 minutes, 56 minutes, 57 minutes, 58 minutes, 59 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, or up to 6 hours.

[0204] In some cases, IL-2 can be administered starting within 24 hours of the cell infusion and continuing for up to about 4 days (up to 12 doses). In some cases, IL-2 can be administered for up to about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 days after the initial administration.

[0205] Doses of IL-2 can be administered every 8 hours. In some cases, IL-2 can be administered within about every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours after the initial administration. In some cases, IL-2 administration can be stopped if toxicity is detected. In some cases, if a patient experiences grade 3 or 4 toxicity due to aldesleukin, the dose can be delayed or withheld, unless it is a reversible grade 3 toxicity commonly associated with aldesleukin, such as diarrhea, nausea, vomiting, hypotension, skin changes, anorexia, mucositis, dysphagia, or constitutional symptoms and laboratory changes. In some cases, if these toxicities are easily reversed within 24 hours with supportive measures, an additional dose can be given. Additionally, the decision to hold or continue dosing can be at the discretion of the treating physician.

[0206] In some cases, the anti-GPC3 CAR immune response cells can have increased anti-tumor efficacy compared to comparable immune response cells that do not express an anti-GPC3 CAR.

[0207] In some cases, anti-tumor efficacy can refer to cytotoxic activity. In other cases, anti-tumor efficacy can refer to persistence. Anti-tumor efficacy can also refer to the ability of the cells to target tumors. Various in vitro assays can be used to measure anti-tumor efficacy. For example, cytotoxic ability can be measured by ELISA measuring the release of interleukin-2 (IL-2) or interferon-gamma (IFNy). Cytotoxic activity can be measured by killing assays such as chromium-51 release assays or co-culture assays. In some cases, the anti-GPC3 CAR immune response cells can have increased anti-tumor efficacy and ability compared to comparable cells.

[0208] Anti-GPC3 CAR therapeutic efficacy can be assessed using a variety of ways. Efficacy can refer to anti-tumor efficacy that controls, reduces, or eliminates the extent of a tumor, such as a GPC3-positive tumor. Therapeutic efficacy can also refer to CAR immune response cell expansion, persistence, tumor targeting, and any combination thereof.

[0209] Subjects to whom an anti-GPC3 CAR immune response cell therapy, such as an anti-GPC3 CAR T cell therapy, can be evaluated during infusion, immediately after infusion, or years after infusion. For example, the treated subject can return to the clinic for evaluation from about 1 day to the life of the subject. The treated subject can be evaluated 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, or up to 90 years after the initial administration of the subject CAR immune response cells. In some cases, the evaluation schedule can include daily monitoring, weekly monitoring, monthly monitoring, or yearly monitoring. In some cases, the subject can be observed more frequently according to clinical indications. Evaluation can include physical examination, chemistry evaluation, complete blood count, thyroid panel, toxicity assessment, computed tomography (CT) scan of body regions, apheresis, and any combination thereof.

[0210] In some cases, apheresis can be performed about 1 week to about 10 weeks before and after administration of the subject CAR immune response cell infusion. At other time points, peripheral blood lymphocytes (PBLs) of a subject can be obtained from whole blood by purification using Ficoll gradient centrifugation. Aliquots of peripheral blood mononuclear cells (PBMCs) can be cryopreserved for immune monitoring of cell function. In some cases, various tests including evaluation of specific lysis and cytokine release, metabolomics and bioenergetics studies (using Seahorse), intracellular FACS of cytokine production, ELISA spot assays, and lymphocyte subset analysis can be used to evaluate the immunological relevance of the subject CAR immune response cell therapy. Generally, a difference of about 2 to about 3 fold in these assays can indicate a true biological difference. In some cases, a difference of about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, up to about 5 fold in in vitro assays following anti-GPC3 CAR immune response cell therapy can indicate treatment efficacy.

[0211] In some cases, the subject CAR immune response cell therapy can reduce tumor size by at least 30%, as the tumor size is measured by computed tomography (CT) scan or MRI. Anti-GPC3 CAR immune response cell therapy can reduce tumor size by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or up to about 100%. CAR-T therapy can eliminate a tumor, as measured by CT scan. In some cases, anti-GPC3 CAR immune response cell therapy can be effective to stabilize tumor size, as measured by computed tomography (CT) scan, with a change from baseline measurement of tumor lesion diameter of less than 10%. For example, the size of a tumor can not expand following administration of anti-GPC3 CAR immune response cells. In some cases, stabilization can be considered a change in tumor size of less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% compared to a measurement prior to treatment.

[0212] In some cases, anti-GPC3 CAR immune response cell efficacy can be considered in terms of subject survival time. For example, a subject treated with anti-GPC3 CAR immune response cells, such as anti-GPC3 CAR T cells, can survive for a longer time than an untreated subject or a subject treated with a different therapy.

[0213] In some cases, efficacy of anti-GPC3 CAR immune response cells can be improved by the addition of a secondary treatment, such as lymphodepleting therapy. The secondary treatment can synergize with the anti-GPC3 CAR immune response cell therapy. In some cases, the secondary treatment can produce an additive effect of the anti-GPC3 CAR immune response cell therapy. The secondary treatment can be lymphodepleting and other forms of cell therapy, antibody therapy, chemotherapy, radiation therapy, surgery, anti-angiogenic therapy, and any combination thereof.

[0214] Therapeutic response can be assessed using international criteria proposed by the revised Response Evaluation Criteria in Solid Tumors (RECIST) guidelines (version 1.1). In the case of malignant lymph nodes, changes in the maximum diameter (one-dimensional measurement) and the shortest diameter of the tumor lesion can be used in the RECIST criteria. For example, measurable lesions can be defined as those that can be accurately measured in at least one dimension (the longest diameter to be recorded) as >20 mm by chest X-ray, >10 mm by CT scan, or >10 mm by clinical examination with calipers. To be considered pathologically enlarged and measurable, lymph nodes can be >15 mm in the short axis when assessed by CT scan. All other lesions (or sites of disease) including small lesions (pathologic lymph nodes <10 mm in longest diameter or ≥10 to <15 mm in short axis) can be considered non-measurable disease. Bone lesions, leptomeningeal disease, ascites, pleural / pericardial effusion, cutaneous lymphangitic / pulmonary inflammation, inflammatory breast disease can be considered non-measurable.

[0215] All measurable lesions, up to a maximum of 2 per organ, and 5 total across the body, representing all organ involvement, can be identified as target lesions and recorded at baseline. Target lesions can be selected based on their size (the lesion with the longest diameter) representing the largest burden of disease, but in addition should be those that are suitable for reproducible repeated measurements. It can be the case that sometimes the largest lesion is not suitable for reproducible measurements, in which case the next largest lesion that can be reproducibly measured should be selected. The sum of the diameters (longest diameter for non-nodal lesions, short axis for nodal lesions) of all target lesions can be calculated and reported as the baseline sum diameters. If lymph nodes are included in the sum, only the short axis can be added to the sum. The baseline sum diameters will be used as a reference to further characterize any objective tumor regression in the measurable dimensions of disease.

[0216] In some cases, a clinical lesion can be considered measurable when it can be superficial (e.g., skin nodules and palpable lymph nodes) and has a diameter of about 10 mm assessed using calipers (e.g., skin nodules). In cases where a lesion cannot be measured using calipers, CT scans or MRI can also be used. In some cases, a CT scan can produce tissue slices of about 5 mm or less. In some cases, a CT scan can have a scan thickness of 5 mm, 4 mm, 3 mm, 2 mm, 1 mm, or 0.5 mm. If a CT scan has a slice thickness greater than 5 mm, the minimum university of a measurable lesion can be twice the slice thickness. In some cases, MRI can also be performed to evaluate a subject. Ideally, the same type of scanner should be used, and the image acquisition protocol should be as close as possible to the previous scan when determining treatment efficacy. Where possible, breath-hold scanning techniques should be used for body scans. In some cases, fluorodeoxyglucose (FDG)-positron emission tomography (PET) can be used to measure treatment efficacy.

[0217] Once a subject is evaluated, a target lesion can be classified as stable disease (SD), progressive disease (PD), partial response (PR), and / or complete response (CR). SD can be considered as having the smallest sum of diameters as reference that neither the reduction sufficient to qualify for PR nor the increase sufficient to qualify for PD. PD can be considered as having an increase of at least 20% in the sum of diameters of target lesions, taking as reference the smallest sum on study (which can include the baseline sum if that is the smallest). In some cases, in addition to the approximately 20% relative increase, the sum must also demonstrate an absolute increase of at least about 5 mm. PR can be a decrease of at least about 30% in the sum of diameters of target lesions, taking as reference the baseline sum of diameters. CR can be the disappearance of all target lesions.

[0218] In some cases, the combination of administering anti-GPC3-CAR immune responsive cells (such as anti-GPC3 CAR T cells) and lymphodepleting therapy can synergistically increase the median survival time of a subject by at least about 6 months compared to the administration of anti-GPC3 immune responsive cells alone, Table 6. In some cases, the combination of anti-GPC3-CAR immune responsive cell therapy and lymphodepleting therapy can synergistically increase the survival time of a subject by at least about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 21 years, 22 years, 23 years, 24 years, or up to about 25 years compared to the administration of anti-GPC3-CAR immune responsive cells alone. Table 6: Construct Comparison

[0219] The subject anti-GPC3 CAR immune response cells can be formulated into a medicament and used to treat a human or mammal in need thereof who has been diagnosed with a disease such as cancer. These medicaments can be co-administered to the human or mammal with one or more chemotherapeutic agents or chemotherapeutic compounds.

[0220] The subject population of CAR immune response cells, such as CAR T cells, can be formulated for administration to a subject using techniques known to those of skill in the art. Formulations comprising a population of CAR immune response cells can comprise pharmaceutically acceptable excipients. The excipients included in the formulation will serve different purposes depending, for example, on the subpopulation of T cells used and the mode of administration. Examples of excipients commonly used include, but are not limited to: saline, buffered saline, dextrose, water for injection, glycerol, ethanol, and combinations thereof, stabilizers, solubilizers and surfactants, buffers and preservatives, tonicity agents, fillers and lubricants. Formulations comprising a population of CAR immune response cells will generally be prepared and cultured in the absence of any non-human components, such as animal serum. The formulation can comprise one population of CAR immune response cells, or more than one, such as two, three, four, five, six, or more populations of CAR immune response cells. For example, the formulation can comprise one population of CAR T cells, or more than one, such as two, three, four, five, six, or more populations of CAR T cells.

[0221] Formulations comprising a population of anti-GPC3 CAR immune response cells can be administered to a subject using modes and techniques known to those of skill in the art. Exemplary modes include, but are not limited to, intravenous injection. Other modes include, but are not limited to, intratumoral, intradermal, subcutaneous (S.C., sq, sub-Q, Hypo), intramuscular (im), intraperitoneal (ip), intraarterial, intramedullary, intracardiac, intraarticular (joint), intrasynovial (joint fluid region), intracranial, intraspinal, and intrathecal (spinal fluid). Any known device useful for parenteral injection or infusion of a formulation can be used to effect such administration.

[0222] Formulations comprising a population of CAR immune response cells administered to a subject comprise a number of CAR immune response cells effective for treating and / or preventing a particular indication or disease. Thus, a therapeutically effective population of CAR immune response cells can be administered to a subject. Generally, a formulation comprising about 1 x 10 4 to about 1 x 10 10 CAR immune response cells is administered. In most cases, the formulation will include about 1 x 10 5 to about 1 x 10 9 CAR immune response cells, about 5 x 10 5 to about 5 x 10 8 CAR immune response cells, or about 1 x 10 6 to about 1 x 107 The number of CAR immune response cells administered to a subject will vary widely, depending on the location, origin, identity, extent and severity of the cancer, the age and condition of the individual to be treated, and the like. The physician will ultimately determine the appropriate dosage to be used.

[0223] The tumor targeting molecule is administered to the subject prior to, concurrently with, or after administration of the CAR immune response cells. The tumor targeting molecule binds to target cells in the subject by associating with a tumor-associated antigen or a tumor-specific antigen. The tumor targeting molecule can be formulated for administration to the subject using techniques known to those of skill in the art. Formulations of the tumor targeting molecule can include pharmaceutically acceptable excipients. Examples of excipients that are commonly used include, but are not limited to: saline, buffered saline, dextrose, water for injection, glycerol, ethanol, and combinations thereof, stabilizers, solubilizers and surfactants, buffers and preservatives, tonicity agents, fillers and lubricants.

[0224] The tumor targeting molecule can be administered to the subject using modalities and techniques known to those of skill in the art. Exemplary modalities include, but are not limited to, intravenous, intraperitoneal, and intratumoral injection. Other modalities include, but are not limited to, intradermal, subcutaneous (S.C., sq, sub-Q, Hypo), intramuscular (im), intraarterial, intramedullary, intracardiac, intraarticular (joint), intrasynovial (joint fluid space), intracranial, intraspinal, and intrathecal (spinal fluid). In some cases, CAR-Ts can be administered locally at a tumor lesion, such as a liver lesion. Any known device useful for parenteral injection or infusion formulations can be used to effect such administration.

[0225] The formulation comprising the tumor targeting molecule is administered to the subject in an amount effective to treat and / or prevent the particular indication or disease. Generally, a formulation comprising at least about 0.1 mg / kg body weight to about 100 mg / kg body weight of the tumor targeting molecule is administered to a subject in need of treatment. In most cases, the dosage is about 1 mg / kg to about 100 mg / kg body weight of the marker protein per day, taking into account the route of administration, the symptoms, and the like. The physician will determine the appropriate dosage to be used.

[0226] In one embodiment, the chimeric antigen receptor is used to stimulate an immune response mediated by the immune response cell. For example, a T cell-mediated immune response is an immune response involving T cell activation. Activated antigen-specific cytotoxic T cells are capable of inducing apoptosis in target cells that display an epitope of a foreign antigen on their surface, such as cancer cells that display a tumor antigen. In another embodiment, the chimeric antigen receptor is used to provide an anti-tumor immunity in a mammal. As a result of the T cell-mediated immune response, the subject will develop an anti-tumor immunity.

[0227] In certain instances, methods of treating a subject having a cancer can include administering to a subject in need of treatment one or more preparations of tumor-targeting molecules, wherein the molecules bind to cancer cells, and one or more therapeutically effective populations of subject CAR immune response cells, wherein the CAR immune response cells can bind to the tumor-targeting molecules and induce cancer cell death. Another embodiment can relate to methods of treating a subject having a cancer, which include administering to a subject in need of treatment one or more therapeutically effective populations of subject anti-GPC3 CAR immune response cells, wherein the CAR immune response cells bind to cancer cells, thereby inducing cancer cell death.

[0228] The frequency of administration of the two preparations comprising anti-GPC3 CAR immune response cells and anti-GPC3 CAR immune response cells in combination with tumor-targeting molecules will vary depending on factors including the disease being treated, the elements comprising the CAR immune response cells and tumor-targeting molecules, and the mode of administration, among others. Each preparation can be administered independently 4 times, 3 times, 2 times, or 1 time per day; once every other day, once every three days, once every four days, once every five days, once every six days, once every week, once every eight days, once every nine days, once every ten days, once every two weeks, once every month, and once every two months.

[0229] As used herein, "chemotherapeutic agent" or "chemotherapeutic compound" and their grammatical equivalents can be a chemical compound useful in the treatment of cancer. Chemotherapeutic cancer agents that can be used in combination with the disclosed CAR immune response cells include, but are not limited to, mitotic inhibitors (vinca alkaloids). These include vincristine, vinblastine, vindesine, and Navelbine TM (vinorelbine, 5'-nor- desmethyldihydrovinblastine). In other embodiments, cancer chemotherapeutic agents include topoisomerase I inhibitors, such as camptothecin compounds. As used herein, "camptothecin compounds" include Camptosar TM (irinotecan hydrochloride), Hycamtin TMand other compounds from the camptothecin and its analogs. Another class of chemotherapeutic cancer agents that can be used in the methods and compositions disclosed herein are the epipodophyllotoxin derivatives such as etoposide, teniposide, and mitozolomide. The present disclosure also includes other chemotherapeutic cancer agents known as alkylating agents, which alkylate genetic material in tumor cells. These include, but are not limited to, cisplatin, cyclophosphamide, nitrogen mustard, trimethylolomethane, carmustine, busulfan, chlorambucil, belustine, uramustine, chlomaphazin, and dacarbazine. The present disclosure includes antimetabolites as chemotherapeutic agents. Examples of these types of agents include cytosine arabinoside, fluorouracil, methotrexate, mercaptopurine, azathioprine, and procarbazine. Another class of cancer chemotherapeutic agents that can be used in the methods and compositions disclosed herein includes antibiotics. Examples include, but are not limited to, doxorubicin, bleomycin, dactinomycin, daunorubicin, mithramycin, mitomycin, mitomycin C, and daunomycin. There are many liposomal formulations of these compounds that are commercially available. The present disclosure also includes other cancer chemotherapeutic agents including, but not limited to, anti-tumor antibodies, dacarbazine, azacitidine, amsacrine, melphalan, ifosfamide, and mitoxantrone.

[0230] The subject anti-GPC CAR immune response cells can be administered in combination with other anti-tumor agents, including cytotoxic / anti-tumor agents and anti-angiogenic agents. Cytotoxic / anti-tumor agents can be defined as agents that attack and kill cancer cells. Some cytotoxic / anti-tumor agents can be alkylating agents, which alkylate genetic material in tumor cells, for example, cisplatin, cyclophosphamide, nitrogen mustard, trimethylolomethane, carmustine, busulfan, chlorambucil, belustine, uramustine, chlomaphazin, and dacarbazine. Other cytotoxic / anti-tumor agents can be antimetabolites of tumor cells, for example, cytarabine, fluorouracil, methotrexate, mercaptopurine, azathioprine, and procarbazine. Other cytotoxic / anti-tumor agents can be antibiotics, for example, doxorubicin, bleomycin, dactinomycin, daunorubicin, mithramycin, mitomycin, mitomycin C, and daunomycin. There are many liposomal formulations of these compounds that are commercially available. Other cytotoxic / anti-tumor agents can be mitotic inhibitors (vinca alkaloids). These include vincristine, vinblastine, and etoposide. Other cytotoxic / anti-tumor agents include paclitaxel and its derivatives, L-asparaginase, anti-tumor antibodies, dacarbazine, azacitidine, amsacrine, melphalan, VM-26, ifosfamide, mitoxantrone, and vindesine.

[0231] Anti-angiogenic agents can also be used. Suitable anti-angiogenic agents for use in the disclosed methods and compositions include anti-VEGF antibodies, including humanized and chimeric antibodies, anti-VEGF aptamers, and antisense oligonucleotides. Other angiogenesis inhibitors include angiostatin, endostatin, interferons, interleukin 1 (including alpha and beta), interleukin 12, retinoic acid, and tissue inhibitors of metalloproteinases-1 and -2 (TIMP-1 and TIMP-2). Small molecules can also be used, including topoisomerase enzymes such as razoxane, topoisomerase II inhibitors with anti-angiogenic activity.

[0232] Other anticancer agents that can be used in combination with the target anti-GPC3 CAR immune response cells include, but are not limited to: acivitine; doxorubicin; acodazole hydrochloride; acroline; adorine; interleukin; hexamethylmelamine; ampicillin; ametrine acetate; aminoglutethimide; acridine; anastrozole; atrazomycin; asparaginase; triamcinolone; avastin; azacitidine; azatiprine; azotocin; palmastat; benzoxetine; bicalutamide; and bisaminoglycan hydrochloride. ; Dermaclofen; Bleomycin sulfate; Buquina sodium; Brompirimidine; Busulfan; Actinomycin C; Calotestosterone; Carbetamide; Carbetin; Carboplatin; Carmustine; Carrubicin hydrochloride; Carzelazoline; Sildenafil; Chlorisac; Siroxam; Cisplatin; Cladribine; Clinapordine mesylate; Cyclophosphamide; Cytarabine; Dacarbazine; Actinomycin D; Daunorubicin hydrochloride; Decitabine; Dextromethorphan; Dezadazidine Ning; Dezaguanine Mesylate; Diaconazole; Docetaxel; Doxorubicin; Doxorubicin Hydrochloride; Droloxifen; Droloxifen Citrate; Drotadazole Propionate; Dazomycin; Edatraxa; Eflunomide Hydrochloride; Exalucin; Enloplatin; Enpromethazine; Epilapidil; Epirubicin Hydrochloride; Ibuproazole; Exorubicin Hydrochloride; Estradiol; Estradiol Sodium Phosphate; Ethamidazole; Etoposide; Etoposide Phosphate; Etoposide; Fatamicin Hydrochloride Trazodazole; Fazarabine; Fenivel Aamine; Fluorouracil; Fludarabine Phosphate; Fluorouracil; Flucitabine; Phosphorione; Fostracin Sodium; Gemcitabine; Gemcitabine Hydrochloride; Hydroxyurea; Idarubicin Hydrochloride; Ifosfamide; Imofocin; Interleukin II (including recombinant interleukin II or rIL2); Interferon α-2a; Interferon α-2b; Interferon α-n1; Interferon α-n3; Interferon β-I; Interferon γ-I b; Isopropylplatin; Irinotecan hydrochloride; Lanreotide acetate; Letrozole; Leuprorelin acetate; Riazol hydrochloride; Lometraxo sodium; Lomustine; Loxoanthraquinone hydrochloride; Masrophenone; Metformin; Nitrogen mustard hydrochloride; Medroxyprogesterone acetate; Meropenem; Minoril; Mercaptopurine; Methotrexate; Methotrexate sodium; Chlorpheniramine; Metotepazole; Mibutalamine; Mitocarcin; Mitocoromin; Mitocelin; Mitomacin C; Mitosperidone; Mitotane; Mitoanthraquinone hydrochloride; Mycophenolic acid; Nocodazole; Nogamycin; Omar Platinum; Oxysulex; Paclitaxel; Pegaspargase; Peribacin; Pendimethalin; Pelosinomycin Sulfate; Pephosphonamide; Piperabromide; Piperabromide; Pirroanthraquinone Hydrochloride; Procainamide; Promethene; Porphyromycin Sodium; Pofibromycin; Prednisone; Procarbazine Hydrochloride; Puromycin; Puromycin Hydrochloride; Pyrazosulfan; Lipoadenosine; Rogulam; Safungo; Safungo; Semustine; Citricazone; Sodium Phosphatidylcholine; Sparmycin; Spiromustine; Spiroplatin; Streptomycin; Streptozotocin; Sulfonamide; Tadalafil; Ticogallan Sodium; Tegafur; Tiloanthraquinone Hydrochloride; Temopofen;Teniposide; Tiroxicon; Testrolide; Thiomipurine; Thioguanine; Thiotepa; Tiazofurin; Tirazamine; Toremifen citrate; Tritoprolone acetate; Tricerebin phosphate; Trimethotraxa; Trimethotraxa glucuronide; Triptorelin; Tobaccochloride hydrochloride; Uramustine; Uretepa; Vapotetide; Vertepofen; Vincristine sulfate; Vincristine sulfate; Vincristine sulfate; Vincristine sulfate; Vinpicidin sulfate; Vincristine sulfate; Vincristine sulfate; Vinrocin sulfate; Vinorelbine tartrate; Vinrodine sulfate; Vinorelin sulfate; Vorticillium sulfate; Zonipram; Netostatin; Zorubicin hydrochloride. Other anticancer drugs include, but are not limited to: 20-epi-1,25-dihydroxyvitamin D3; 5-ethynyluracil; abiraterone; ararubicin; acylfulvin; adenocyclopentol; adoretin; interleukin; ALL-TK antagonists; hexamethylmelamine; amimastatin; amidox; amifostine; aminolevulinic acid; ararubicin; acridine; anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D; antagonist G; antraloxetine; anti-dorsalizing morphogenetic protein-1; antiandrogens; prostate cancer; antiestrogens; antitumor ketones; antisense oligonucleotides; glycine afedipine; apoptosis gene regulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase; asulacrine; atamestane; altretamine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; batadiazon; bengamides; batabulin; benzochlorin; benzopyrimanthrin; beta-alethine; beta-clamycin B; betulinic acid; bFGF inhibitor; bicalutamide; bexarotene; bisantrene; bisaziridinyl spermine; bisnafide; bistratene A; bizelesin; breflate; brostallicin; budotitan; buthionine sulfoximine; calcipotriol; camptothecin derivatives; canarypox IL-2; capecitabine; carboxyamidotriazole; CaRest M3; CARN 700; cartilage-derived inhibitor; carzilin; casein kinase inhibitor (ICOS); castanospermine; cecropin B; cetuximab; chlorins; chloroquinox; ciclanef; cisplonin; cladribine; clomifene analogues; clotrimazole; collismycin A; collismycin B; combretastatin A4; combretastatin analogues; conagenin; cram bescidin 816; crinaxen; cryptophycin 8; cryptophycin A derivatives; curacin A; cyclopentanperynes; cycloplatam; cypemycin; cytarabine ocfosfate; cytochalasin; cytotel; dacloxafine; dehydrodidox; dehydrofilmycin B; deslorelin; dexamethasone; dexifosfamide; dexrazoxane; dexverapamil; diaziquone; didox; diethylornidazole; dihydro-5-azacytidine; 9-dihydrotaxol; dioxamycin; diphenylspiromustine; docetaxel; dolasetron; doxifluridine; droloxifene; drometrizole; duocarmycin SA; edelfosine; edelfosine; edotreotide; edrecolomab; efaproxiral; eleutherobin; elliptinium acetate; epirubicin; epitiostanol; estramustine analogue; estrogen agonists; estrogen antagonists; ethenzamide; etoglucid; etoposide phosphate; exemestane; fadrozole; fazarabine; fenretinide; filgrastim; finasteride; flavopiridol; fluastatins; fludarabine; fluorodaunorunicin hydrochloride; fosteresene; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine;Ganirelix; Gelatinase inhibitor; Gemcitabine; Glutathione inhibitor; Hepsulfam; Modulin; Hexamethylene diacetamide; Hypericin; Ibandronic acid; Idarubicin; Edoxifen; Igamonone; Imofocin; Ilomasta; Imidazolidine; Imiquimod; Immunostimulatory peptides; Insulin-like growth factor-1 receptor inhibitors; Interferon agonists; Interferon; Interleukin; Iodobenzylguanidine; Iodoxorubicin; 4-Sweet potato picrol; Iloprapra; Isopridine; Isobengazole; Isohomohalicondrin B; Itasetron; Jasplakinolide; Kahalalide F F); spirotin triacetate; lanreotide; ranamycin; levofloxacin; lentinan sulfate; leptolstatin; letrozole; leukemia inhibitory factor; leukocyte alpha interferon; leuprorelin + estrogen + progesterone; leuprorelin; levamisole; riazol; linear polyamine analogs; lipophilic disaccharide peptides; lipophilic platinum compounds; lissoclinamide 7; lobaplatin; earthworm phospholipids; lometroxoline; chlordamine; loxoanthraquinone; lovastatin; loxoribin; letopecan; lutetium Tetraphyrin; Lysofylline; Dissolving peptide; Metformin; Manostatin A; Malimastastatin; Masorofol; Mammary serine; Matrix dissolving factor inhibitor; Matrix metalloproteinase inhibitor; Minoliqui; Merbarone; Avorelin; Methioninase; Metoclopramide; MIF inhibitor; Mifepristone; Mitefocin; Mililastine; Mismatched double-stranded RNA; Mitoguanidine; Dibromoceramide; Mitomycin analogue; Mitonaphthylamine; Mitotoxin fibroblast growth factor-saponin; Mitoxantrone; Mofarotin; Moraxillamine; Human chorionic gonadotropin monoclonal antibody; Monophospholipid A+ Mycobacterium cell wall SK; Mopidamine; Multidrug resistance gene inhibitor; Therapy based on multiple tumor suppressor gene 1; Nitrogen mustard anticancer agent; Indian Ocean sponge B (mycaperoxide) B); Mycobacterium cell wall extract; myriaporone; N-acetyldinarin; N-substituted benzamide; nafarilin; nagrestip; naloxone + pentazocine; napavin; napterpin; natosine; nedaplatin; nemorubicin; neridonic acid; neutral endopeptidase; nilumethicone; nisamycin; nitric oxide regulator; nitrooxidant; nitrullyn; O6-benzylguanine; octreotide; okicenone; oligonucleotide; onapristone; ondansetron; ondansetron; oracin; oral cytokine induc; ormaplatin; oxaliplatin; oxaunomycin; paclitaxel; paclitaxel analog; paclitaxel derivative; palauamine; palmitoyl dehydrogenase; pamidronic acid; panaxytriol; panidronic; parabactin; pazelline; pegaspargase; peldesine; pentostatin; pentoxazalline; perfluorobutane; perfosfamide; phenazinomycin; phenazocine; phenylacetate; phosphosetase inhibitor; picibanil; pilocarpine hydrochloride; pirarubicin; piritrexim; placetin A; placetin B; plasminogen activator inhibitor; platinum complex; platinum compounds; platinum-triamine complex; porfimer sodium; porfiromycin; prednisone; preformed aryl hydrocarbon receptor agonist; procarbazine; prodelphinidin B; progesterone; protein A-based immunomodulator; protein kinase C inhibitor; protein kinase C inhibitor (mitragynine); protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitor; purpurins; pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylene conjugate; raf antagonist; raltitrexed; ramosetron; ras farnesyl protein transferase inhibitor; ras inhibitor; ras-GAP inhibitor; recombinant alginate lyase; recombinant humanized anti-p160 antibody; retinoic acid receptor agonist; retinoid receptor agonists; rhenium Re 186 etidronate; rhizoxin; ribozyme; RII amyloid; rohitukine; romurtide; roquinimex; rubiginone B1; ruboxyl; safingol; saintopin; SarCNU; sasipan; sargramostim; Sdi 1 mimetic; semustine; senescence derived inhibitor 1; sense oligonucleotide; signal transduction inhibitor; signal transduction modulator; single chain antigen binding protein; sizofiran; sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; somatomedin binding protein; sonermin; sparfosic acid; spicamycin D; spiromustine; splenopentin; spongistatin 1; squaramine; stem cell inhibitor; stem cell-division inhibitor; stipiamide; stromelysin inhibitor; sulfinosine; super oxide dismutase mimetic; suradista; suramin; swainsonine; synthetic glycosaminoglycan; talisomycin; tamoxifen methiodide; taurolidine; tazarotene; tecogalan sodium; tegafur; tellurapyrylium; telomerase inhibitor; temoporfin; temozolomide; teniposide; tetrachlorodecaoxide; tetrazomine; thaliblastine; thalidomide;thymopoietin receptor agonists; thymotrinan; thyrotropin; ethylisopropylpyridinium tin; tirapazamine; titanocene dichloride; toptsentin; toremifene; totipotent stem cell factor; translation inhibitors; tretinoin; trichothene; trimetrexate; triptorelin; tropisetron; turosteride; tyrosine kinase inhibitors; tyrosine phosphorylation inhibitors; UBC inhibitors; ubenimex; urogenital sinus-derived growth inhibitory factor; urokinase receptor antagonist; vaponeomab; violarin B; red blood cell gene therapy vector system; verlarde; veratramine; verdins; verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole; zanoterone; zebularine; and zinecard. In one embodiment, the anti-cancer drug is 5-fluorouracil, paclitaxel, or folinic acid.

[0233] In some cases, the subject anti-GPC3 CAR immune response cells can be introduced by injection, catheter, etc. In some cases, an immunostimulant can also be included, including but not limited to interleukins (e.g., IL-2, IL-3, IL-6, and IL-11, among other interleukins), colony stimulating factors (such as G-CSF, M-CSF, and GM-CSF), interferons (e.g., gamma-interferon), and erythropoietin. In some cases, a subject can be treated with a CAR-T, an immune depleting agent, and an immune stimulant. A subject can be treated with IL-2 to promote performance of the CAR-T cell product. In some cases, the immune stimulant can be a recombinant protein. The immune stimulant can also include an active portion of a protein. In some cases, the immune stimulant can include only a portion of a protein. The portion of a protein can be about 50%, 60%, 70%, 80%, 90%, or up to about 100% of the protein.

[0234] Compositions comprising the subject anti-GPC3 CAR immune response cells, such as CAR T cells, can conveniently be presented as a sterile liquid formulation, such as an isotonic aqueous solution, suspension, emulsion, dispersion, or viscous composition, which can be buffered to a selected pH. Liquid formulations are generally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, particularly by injection. Viscous compositions, on the other hand, can be formulated within an appropriate viscosity range to provide longer contact time with particular tissues. Liquid or viscous compositions can include a carrier, which can be a solvent or dispersion medium containing, for example, water, saline, phosphate buffered saline, polyhydric alcohol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, and the like), and suitable mixtures thereof. A sterile injectable solution can be prepared by incorporating the genetically modified CAR immune response cells for use in practicing the application in the required amount of the appropriate solvent with various amounts of the other desired ingredients, as required. Such compositions can be mixed with suitable carriers, diluents, or excipients such as sterile water, physiological saline, glucose, dextrose, and the like. The compositions can also be lyophilized. The compositions can contain auxiliary substances to aid in wetting, dispersing, or emulsifying, such as methylcellulose, pH buffers, gelling, or viscosity enhancing additives, preservatives, flavoring agents, color, and the like, depending on the route of administration and the preparation desired. Suitable formulations can be prepared according to standard texts, such as "REMINGTON'S PHARMACEUTICAL SCIENCE", 17th Ed., 1985, which is incorporated herein by reference, without undue experimentation. Various additives can be included in the compositions to enhance stability and sterility, including antimicrobial preservatives, antioxidants, chelating agents, and buffers. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. Prolonged absorption of injectable pharmaceutical forms can be brought about by the use of agents delaying absorption, such as aluminum monostearate and gelatin. However, any carrier, diluent, or additive used in accordance with the present application must be compatible with the genetically modified CAR immune response cells or progenitors thereof.

[0235] In some cases, the compositions can be isotonic, i.e., they can have the same osmotic pressure as blood and tears. The desired isotonicity of the compositions of the present application can be accomplished using sodium chloride or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol, or other inorganic or organic solutes. Sodium chloride is preferred, particularly for buffers containing sodium ions. If desired, the viscosity of the composition can be maintained at a selected level using a pharmaceutically acceptable thickening agent. Methylcellulose is preferred because it is readily and economically obtained and is easy to use. Other suitable thickening agents include, for example, xanthan gum, carboxymethylcellulose, hydroxypropylcellulose, carbomer, and the like. The preferred concentration of the thickening agent will depend on the agent selected. It is important that the amount used will achieve the selected viscosity. Obviously, the choice of suitable carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form, e.g., whether the composition will be formulated as a solution, suspension, gel, or another liquid form, such as a time-release form or a liquid-filled form.

[0236] In some cases, e.g., in compositions, formulations, and methods of treating cancer, the unit dose of the composition or formulation administered can be 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 mg. In some cases, the total amount of the composition or formulation administered can be 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 g.

[0237] In some cases, the pharmaceutical compositions comprising the subject anti-GPC3 CAR immune response cells, e.g., CAR T cells, can be administered alone or with a pharmaceutically acceptable carrier or excipient by any route, and such administration can be carried out in single or multiple doses. More specifically, the pharmaceutical compositions can be combined with various pharmaceutically acceptable inert carriers such as tablets, capsules, troches, lozenges, handcandy, powders, sprays, aqueous suspensions, injectable solutions, elixirs, syrups, and the like. Such carriers include solid diluents or fillers, sterile aqueous media and various non-toxic organic solvents, etc. Moreover, such oral pharmaceutical formulations can be suitably sweetened and / or flavored to a degree that is acceptable with the various types of agents commonly used for such purposes.

[0238] For example, the cells can be administered to a patient (e.g., prior to, concurrently with, or subsequent to) with any number of related therapeutic modalities, including but not limited to treatment with agents such as anti-viral therapies, cidofovir and interleukin-2, or cytarabine (also known as ARA-C). In some cases, the engineered cells can be used in combination with chemotherapy, radiation, immunosuppressive agents such as cyclosporin, azathioprine, methotrexate, mycophenolate, and FK506, antibodies or other immune ablative agents such as CAMPATH, anti-CD3 antibodies or other antibody therapies, cytotoxins, fludaribine, cyclosporin, FK506, rapamycin, mycophenolic acid, steroids, FR901228, cytokines, and radiation. The engineered cell compositions can also be administered to a patient (e.g., prior to, concurrently with, or subsequent to) with bone marrow transplantation and T cell ablative therapies using chemotherapeutic agents such as fludaribine, external radiation therapy (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH. In some cases, the engineered cell compositions can be administered following B cell ablative therapies with agents such as those that react with CD20, e.g., Rituxan. For example, a subject can undergo standard therapy of high dose chemotherapy followed by peripheral blood stem cell transplantation. In certain embodiments, following transplantation, the subject can receive an infusion of engineered cells, such as expanded engineered cells. Additionally, expanded engineered cells can be administered prior to or following surgery. The engineered cells obtained by any of the methods described herein can be used to treat a patient in need thereof for host versus graft (HvG) rejection and graft versus host disease (GvHD). Thus, contemplated are methods for treating a patient in need thereof for host versus graft (HvG) rejection and graft versus host disease (GvHD), comprising treating the patient by administering to the patient an effective amount of genetically engineered cells comprising inactivated TCRa and / or TCRP. Pharmaceutical kit

[0239] A kit can be disclosed herein to comprise a composition. A kit can also be disclosed herein for treating or preventing cancer, pathogen infection, immune disorder, or allogeneic transplant. In one embodiment, a kit can comprise a therapeutic or prophylactic composition in unit dosage form containing an effective amount of cells comprising one or more anti-GPC3 CARs. In some embodiments, a kit comprises a sterile container, which can contain a therapeutic or prophylactic vaccine; such container can be a box, ampoule, bottle, vial, tube, bag, pouch, blister pack, or other suitable container form known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments. In some cases, the subject anti-GPC3 CAR immune response cells, such as CAR T cells, can be provided with instructions for administering the CAR immune response cells to a subject having or at risk of having cancer, pathogen infection, immune disorder, or allogeneic transplant. The instructions will typically include information related to the use of the composition for treating or preventing cancer, pathogen infection, immune disorder, or allogeneic transplant. In some cases, a kit can comprise about 1 x 10 4 cells to about 1 x 10 12 cells. In some cases, a kit can comprise at least about 1 x 10 5 cells, at least about 1 x 10 6 cells, at least about 1 x 10 7 cells, at least about 4 x 10 7 cells, at least about 5 x 10 7 cells, at least about 6 x 10 7 cells, at least about 6 x 10 7 cells, at least about 8 x 10 7 cells, at least about 9 x 10 7 cells, at least about 1 x 10 8 cells, at least about 2 x 10 8 cells, at least about 3 x 10 8 cells, at least about 4 x 10 8 cells, at least about 5 x 10 8 cells, at least about 6 x 10 8 cells, at least about 6 x 10 8 cells, at least about 8 x 10 8 cells, at least about 9 x 10 8 cells, at least about 1 x 10 9 cells, at least about 2 x 10 9 cells, at least about 3 x 10 9 cells, at least about 4 x 10 9 cells, at least about 5 x 109 about 6 x 10 9 about 6 x 10 9 about 8 x 10 9 about 9 x 10 9 about 1 x 10 10 about 2 x 10 10 about 3 x 10 10 about 4 x 10 10 about 5 x 10 10 about 6 x 10 10 about 6 x 10 10 about 8 x 10 10 about 9 x 10 10 about 1 x 10 11 about 2 x 10 11 about 3 x 10 11 about 4 x 10 11 about 5 x 10 11 about 6 x 10 11 about 6 x 10 11 about 8 x 10 11 about 9 x 10 11 about 1 x 10 12 about 1 x 10 10 about 5 x 10 6 about 3 x 10 10 about 5 x 10

[0240] In some cases, the kit can comprise allogeneic cells. In some cases, the kit can comprise cells that can have a genomic modification. In some cases, the kit can comprise "off-the-shelf" cells. In some cases, the kit can comprise cells that can be expanded for clinical use. In some cases, the kit can comprise contents for research purposes.

[0241] In some cases, the instructions contain at least one of the following: a description of the therapeutic agent; a dosage regimen and administration for treating or preventing a neoplasia, pathogen infection, immune disorder, or allogeneic transplant, or a symptom thereof; precautions; warnings; indications; contraindications; overdosage information; adverse reactions; animal pharmacology; clinical studies; and / or references. The instructions can be printed directly on the container, if present, or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied with the container. In some cases, the instructions provide a procedure for administering the anti-GPC3 CAR immune response cells, such as anti-GPC3 CAR T cells, after administration of the chemotherapeutic agent. In some cases, the instructions provide a procedure for administering the anti-GPC3 CAR immune response cells before administration of the chemotherapeutic agent. In some cases, the instructions provide a procedure for administering the anti-GPC3 CAR immune response cells concurrently with administration of the chemotherapeutic agent. In some cases, the instructions provide a procedure for administering the anti-GPC3 CAR immune response cells at least 12 hours after administration of the chemotherapeutic agent. In some cases, the instructions provide a procedure for administering the anti-GPC3 CAR immune response cells at least about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours, 27 hours, 28 hours, 29 hours, 30 hours, or up to 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days after administration of the chemotherapeutic agent. In some cases, the instructions provide a procedure for administering the anti-GPC3 CAR immune response cells at least 24 hours after administration of the chemotherapeutic agent. The anti-GPC3 CAR immune response cells can be formulated for intravenous injection. The anti-GPC3 CAR immune response cells can be formulated for intra-arterial injection in the liver of a subject that can contain a solid tumor.

[0242] In some cases, the kit can contain cyclophosphamide and / or fludarabine formulated for administration at about 60 mg / kg to about 80 mg / kg and about 25 mg / m 2 about 35 mg / m 2 to a subject in need thereof. In some cases, the kit can contain a pediatric dose of the product.

[0243] Recombinant methods are well known in the art. Unless otherwise indicated, the practice of the present application employs conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual", second edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (Gait, ed., 1984); "Animal Cell Culture" (Freshney, ed., 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology" (Wei and Blackwell, eds.); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, eds., 1987); "Current Protocols in Molecular Biology" (Ausubel et al., eds., 1987); "PCR: The Polymerase Chain Reaction" (Mullis et al., eds., 1994); and "Current Protocols in Immunology" (Coligan et al., eds., 1991). These techniques are applicable to the production of polynucleotides and polypeptides, and thus can be considered in making and practicing the present application. Particularly useful techniques are discussed in the following sections. Other Applications

[0244] Effective adoptive cell transfer-based immunotherapy (ACT) can be used to treat patients with cancer (e.g., metastatic cancer). For example, autologous peripheral blood lymphocytes (PBLs) can be modified using the non-viral or viral methods disclosed herein to express an anti-GPC3 chimeric antigen receptor (CAR) that recognizes GPC3 on cancer or tumor cells, and can be used in the disclosed methods and kits. The present application can be directed to compositions and methods for immunotherapy, including but not limited to for cancer, using human or humanized chimeric antigen receptors following or concurrent with lymphodepleting treatment of a subject. The chimeric antigen receptors utilize human or humanized chimeric antigen receptor constructs following or concurrent with lymphodepleting treatment of a subject.

[0245] These compositions and methods can provide cancer therapies with a number of advantages. In some cases, the methods can include modifying the immune responsive cells to make the immune responsive cells substantially independent of the presence or activity of major histocompatibility complex (MHC). In some cases, the polynucleic acids described herein can encode a chimeric antigen receptor. Methods of making immune responsive cells expressing a chimeric antigen receptor, such as an anti-GPC3 CAR, are also disclosed. Therapeutic methods can also be disclosed, in which anti-GPC3 CAR immune responsive cells can be administered to a patient having a cancer or disease.

[0246] Described herein are methods of treating a disease (e.g., a cancer) in a recipient, including transplanting one or more of the subject anti-GPC3 CAR immune responsive cells to the recipient after or concurrently with a lymphodepleting therapy.

[0247] Autologous lymphocyte infusions can be used for treatment. Autologous peripheral blood mononuclear cells (PBMCs) can be collected from a patient in need of treatment, and T cells can be activated and expanded using methods described herein and known in the art, and then infused back into the patient. In other cases, allogeneic cells can be used to treat a patient. The subject CAR immune responsive cell populations can be formulated for administration; and wherein the subject is administered using techniques known to those of skill in the art. The expanded cells can then be grown under similar conditions as unmodified cells, whereby the modified cells can be expanded and used for various purposes.

[0248] The methods disclosed herein can include a transplant. The transplant can refer to an adoptive transfer of a cell product. The transplant can be an autologous transplant, an allogeneic transplant, a xenogeneic transplant, or any other transplant. For example, the transplant can be a xenogeneic transplant. The transplant can also be an allogeneic transplant.

[0249] In some cases, about 5 x 10 10 of the subject anti-GPC3 CAR immune responsive cells are administered to the subject. In some embodiments, about 5 x 10 10 cells represent a median cell amount administered to the subject. In some embodiments, about 5 x 10 10 cells are necessary to affect a therapeutic response in the subject. In some embodiments, at least about 1 x 10 7 cells, at least about 2 x 10 7 cells, at least about 3 x 10 7 cells, at least about 4 x 10 7 cells, at least about 5 x 10 7 cells, at least about 6 x 10 7 cells, at least about 7 x 10 7 cells, at least about 8 x 10 7 cells, at least about 9 x 10 7about 1 x 10 8 about 2 x 10 8 about 3 x 10 8 about 4 x 10 8 about 5 x 10 8 about 6 x 10 8 about 7 x 10 8 about 8 x 10 8 about 9 x 10 8 about 1 x 10 9 about 2 x 10 9 about 3 x 10 9 about 4 x 10 9 about 5 x 10 9 about 6 x 10 9 about 7 x 10 9 about 8 x 10 9 about 9 x 10 9 about 1 x 10 10 about 2 x 10 10 about 3 x 10 10 about 4 x 10 10 about 5 x 10 10 about 6 x 10 10 about 7 x 10 10 about 8 x 10 10 about 9 x 10 10 about 1 x 10 11 about 2 x 10 11 about 3 x 10 11 about 4 x 10 11 about 5 x 10 11 about 6 x 10 11 about 7 x 10 11 about 8 x 10 11 about 9 x 10 11 about 1 x 10 12 about 1 x 10 10 about 5 x 10 6 about 3 x 10 10 about 5 x 10Individual cells are then administered to the subject. In some cases, the cells are expanded to a sufficient number for treatment. For example, 5 x 102 7 Individual cells can undergo rapid expansion to produce a sufficient number for therapeutic use. In some cases, a sufficient number for therapeutic use may be 5 x 10-1. 10 Any number of cells can be infused for therapeutic purposes. For example, a subject can be infused with 1x10 cells. 6 Up to 5x10 12 The number of cells (including end values). Patients may be infused with as many cells as can be generated for them. In some cases, not all cells infused into a patient are engineered. For example, at least 90% of the cells infused into a patient may be engineered. In other cases, at least 40% of the cells infused into a patient may be engineered. In some embodiments, the method may include calculating the amount of engineered cells necessary to influence a treatment response in a subject and / or administering them to the subject. In some embodiments, calculating the amount of engineered cells necessary to influence a treatment response includes cell viability and / or the efficiency with which the anti-GPC3 CAR transgene has been integrated into the cell's genome. In some embodiments, the cells administered to the subject to influence a treatment response may be live cells. In some embodiments, in order to achieve a therapeutic response in a subject, at least about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, at least about 50%, at least about 45%, at least about 40%, at least about 35%, at least about 30%, at least about 25%, at least about 20%, at least about 15%, and at least about 10% of the cells are live cells. In some embodiments, in order to influence a therapeutic response in a subject, the cells applied to the subject may be cells having one or more transgenes successfully integrated into the cell's genome. In some implementations, in order to achieve a therapeutic response in subjects, at least about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, at least about 50%, at least about 45%, at least about 40%, at least about 35%, at least about 30%, at least about 25%, at least about 20%, at least about 15%, and at least about 10% of the cells have one or more CAR transgenes successfully integrated into the cell genome.

[0250] In some cases, a subject can be administered a subject anti-GPC3 CAR immune response cell, where the CAR immune response cell that can be administered can be about 1 day to about 35 days old. For example, the cells that are administered can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or up to 40 days old. The age of the CAR immune response cell can be considered from the time of stimulation. The age of the CAR immune response cell can be considered from the time of apheresis. The age of the CAR immune response cell can be considered from the time of transduction. In some embodiments, the CAR immune response cell that can be administered to a subject is about 10 days to about 14 days or about 20 days old. In some cases, the "age" of a CAR immune response cell can be determined by the length of the telomeres. For example, a "young" CAR immune response cell can have a longer telomere length than a "spent" or "old" CAR immune response cell. Without being bound by a particular theory, it can be considered that an immune response cell loses about 0.8 kb of telomere length per week in culture, and a young CAR immune response cell culture can have a telomere that is about 1.4 kb longer than an immune response cell that is about 44 days old. Without being bound by a particular theory, it is considered that a longer telomere length can be associated with a positive objective clinical response in a patient and persistence of the cells in the body.

[0251] In some cases, the cells are isolated from a subject organism, transfected with a nucleic acid (e.g., a gene or cDNA), and reinfused back into the subject organism (e.g., a patient).

[0252] The cells (e.g., engineered cells or engineered primary T cells) can function before, after, and / or during transplantation. For example, the transplanted cells can function for at least or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or 100 days after transplantation. The transplanted cells can function for at least or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months after transplantation. The transplanted cells can function for at least or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 years after transplantation. In some cases, the transplanted cells can function for up to the lifetime of the recipient.

[0253] In addition, the transplanted cells can perform 100% of their normal expected function. The transplanted cells can also perform 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or up to about 100% of their normal expected function.

[0254] The transplanted cells can also perform more than 100% of their normal expected function. For example, the transplanted cells can perform 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or up to about 5000% of their normal expected function.

[0255] The transplant can be performed by any type of transplant. The site can include, but is not limited to, a subcapsular space of the liver, a subcapsular space of the spleen, a subcapsular space of the kidney, the omentum, the gastric or intestinal submucosa, a segment of small intestine blood vessel, a venous pouch, the testes, the brain, the spleen, or the cornea. For example, the transplant can be a subcapsular transplant. The transplant can also be an intramuscular transplant. The transplant can be an intra-portal vein transplant.

[0256] The transplant rejection can be improved after treatment (e.g., any of the treatments disclosed herein) compared to transplanting one or more wild-type cells into the recipient. For example, the transplant rejection can be hyperacute rejection. The transplant rejection can also be acute rejection. Other types of rejection can include chronic rejection. The transplant rejection can also be cell-mediated rejection or T-cell mediated rejection. The transplant rejection can also be natural killer cell-mediated rejection.

[0257] Improving the transplant can mean reducing hyperacute rejection, which can include a reduction, lessening, or weakening of adverse effects or symptoms. The transplant can refer to the adoptive transfer of a cell product.

[0258] Another indication of successful transplantation can be the number of days the recipient does not require immunosuppression therapy. For example, the recipient can not require immunosuppression therapy for at least or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more days after the treatment (e.g., transplantation) provided herein. This can indicate that the transplantation was successful. This can also indicate that the transplanted cells, tissues, and / or organs are not rejected.

[0259] In some cases, the recipient can not require immunosuppression therapy for at least 1 day. The recipient can also not require immunosuppression therapy for at least 7 days. The recipient can not require immunosuppression therapy for at least 14 days. The recipient can not require immunosuppression therapy for at least 21 days. The recipient can not require immunosuppression therapy for at least 28 days. The recipient can not require immunosuppression therapy for at least 60 days. Furthermore, the recipient can not require immunosuppression therapy for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more years.

[0260] Another indication of successful transplantation can be the number of days the recipient requires reduced immunosuppression therapy. For example, the recipient can require reduced immunosuppression therapy for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more days after the treatment provided herein. This can indicate that the transplantation was successful. This can also indicate that the transplanted cells, tissues, and / or organs are not rejected or have minimal rejection.

[0261] In some cases, the recipient can require reduced immunosuppression therapy for at least 1 day. The recipient can also require reduced immunosuppression therapy for at least 7 days. The recipient can require reduced immunosuppression therapy for at least 14 days. The recipient can require reduced immunosuppression therapy for at least 21 days. The recipient can require reduced immunosuppression therapy for at least 28 days. The recipient can require reduced immunosuppression therapy for at least 60 days. Furthermore, the recipient can require reduced immunosuppression therapy for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more years.

[0262] Reduced immunosuppression therapy can refer to less immunosuppression therapy compared to the immunosuppression therapy required when transplanting one or more wild-type cells into a recipient.

[0263] Immunosuppressive therapy can include any treatment that suppresses the immune system. Immunosuppressive therapy can help alleviate, minimize, or eliminate transplant rejection in a recipient. For example, immunosuppressive therapy can include immunosuppressive drugs. Immunosuppressive drugs that can be used before, during, and / or after transplantation are not limited to MMF (Cellcept), ATG (anti-thymocyte globulin), anti-CD154 (CD40L), anti-CD40 (2C10, ASKP1240, CCFZ533 X2201), alemtuzumab (Campath), anti-CD20 (rituximab), anti-IL-6R antibody (tocilizumab, Actemra), anti-IL-6 antibody (sarilumab, olokizumab), CTLA4-Ig (abatacept / Orencia), belatacept (LEA29Y), sirolimus (Rapimune), everolimus, tacrolimus (Prograf), dalizumab (Zenapax), basiliximab (Simulect), infliximab (Remicade), cyclosporine, deoxyspergualin, soluble complement receptor 1, cobra venom factor, compstatin, anti-C5 antibody (eculizumab / Soliris), methylprednisolone, FTY720, everolimus, leflunomide, anti-IL-2R-Ab, rapamycin, anti-CXCR3 antibody, anti-ICOS antibody, anti-OX40 antibody, and anti-CD122 antibody. In addition, one or more immunosuppressive agents / drugs can be used together or sequentially. One or more immunosuppressive agents / drugs can be used for induction therapy or for maintenance therapy. The same or different drugs can be used in the induction and maintenance phases. In some cases, dalizumab (Zenapax) can be used for induction therapy, while tacrolimus (Prograf) and sirolimus (Rapimune) can be used for maintenance therapy. Dalizumab (Zenapax) can also be used for induction therapy, while low-dose tacrolimus (Prograf) and low-dose sirolimus (Rapimune) can be used for maintenance therapy. Immunosuppression can also be achieved using non-drug regimens, including but not limited to total body irradiation, thymic irradiation, and total and / or partial splenectomy. These techniques can also be used in combination with one or more immunosuppressive drugs. EMBODIMENTS

[0264] The present application is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the present application should in no way be construed as being limited to the following examples, but rather should be construed to encompass any and all variations which become evident as a result of the teaching provided herein. Example 1: Construction of Anti-GPC3 CAR Vectors

[0265] An exemplary lentiviral plasmid vector was constructed using a third generation self-inactivating lentiviral vector system. The system comprises a packaging plasmid pMDLg RRE (Addgene) encoding Gag / Pol, a packaging plasmid pRSV-REV (Addgene) encoding Rev, an envelope plasmid pCMV-VSV-G (Addgene) encoding VSV-G, and a recombinant expression vector encoding CAR gene based on the empty vector pRRLSIN-cPPT.PGK-GFP.WPRE (Addgene). This system can effectively reduce the risk of forming replication-competent lentivirus (RCL) particles.

[0266] The empty vector pRRLSIN-cPPT.PGK-GFP.WPRE contains a promoter of elongation factor-1 alpha (EF-1 alpha) and a Mlu I cleavage site is inserted between the promoter and the CD8 alpha sp signal peptide. Specifically, the pWPT-EGFP vector (Addgene) was double digested with Clal / Sall (NEB) to reobtain a 1.1 Kb DNA fragment, which was then ligated with T4 DNA ligase to pRRLSIN-cPPT.PGK-GFP.WPRE double digested with Clal / Sall (NEB). The ligation mixture was then transformed into host cells TOP10. Positive clones were identified by colony PCR and confirmed by sequencing, giving the recombinant plasmid pRRLSIN-cPPT.EF-1 alpha-EGFP.WPRE. The EF-1 alpha promoter (SEQ ID NO: 33, including the Mlu I cleavage site) of the CD8 alpha signal domain (also referred to as fragment 1, 442 bp) was amplified with the upstream primer 5'- gcaggggaaagaatagtagaca-3' (SEQ ID NO: 31), the downstream primer 5'- CGGCCTGGCGGCGTGGAG-3' (SEQ ID NO: 32) and using pRRLSIN-cPPT.EF-1 alpha-EGFP.WPRE as template, under the following conditions: initial denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 53°C for 30 s, extension at 68°C for 30 s; and after 25 cycles, extension at 68°C for 10 min. The amplified band was confirmed to have the expected fragment size by agarose gel electrophoresis.

[0267] Humanized antibody 35 has been described in Chinese patent application no. CN201510481235.1, which is capable of specifically recognizing humanized GPC3 protein. To construct the 35-CAR lentivirus plasmid, the following conditions were used in the amplification to provide the heavy chain variable domain fragment: a fragment containing the heavy chain variable domain 35 (SEQ ID NO: 80 in CN201510481235.1) as a template, an upstream primer 5'-ctccacgccgccaggccggaggtgcagctggtgcag-3' (SEQ ID NO: 34), and a downstream primer 5'- GCGGTGTCCTCGCTCCGCAGGCTGCTCAGCTCCATGTAGGCG GTG-3' (SEQ ID NO: 35); the following conditions were used to provide the light chain variable domain fragment: a fragment containing the light chain variable domain 35 (SEQ ID NO: 79, CN201510481235.1) as a template, an upstream primer 5'-GCGGAGCGAGGACACCGCCGTGTACTACTGCGCCCGGTTCT ACAGCTAC-3' (SEQ ID NO: 36), and a downstream primer 5'-CGGCGCTGGCGTCGTGGTACGTTTGATCTCCAGCTTGGTG-3' (SEQ ID NO: 37). The heavy chain and light chain variable domain primers were amplified with bridge PCR to provide a 35 scFv fragment (SEQ ID NO: 38, also referred to as fragment 2, 765 bp) containing a sequence repeated with an upstream CD8a signal peptide and a downstream hinge region. PCR amplification was performed under the following conditions: initial denaturation at 94 °C for 4 min; denaturation at 94 °C for 40 s, annealing at 58 °C for 40 s; extension at 68 °C for 40 s; and after 25 cycles, extension at 68 °C for 10 min. The amplified band was confirmed to have the expected fragment size by agarose gel electrophoresis.

[0268] Hinge-28Z (SEQ ID NO: 41, fragment 3, 703 bp) with an internal Sail cleavage site) was amplified using upstream primer 5'-accacgacgccagcgccg-3' (SEQ ID NO: 39) and downstream primer 5'-aatccagaggttgattgtcgacctagcgagggggcagggcctgc-3' (SEQ ID NO: 40) with pWPT-eGFP-F2A-GPC3-28Z as template (see Chinese patent application CN 104140974 A). PCR amplification was performed under the following conditions: initial denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s; extension at 68°C for 30 s; and after 25 cycles, a final extension at 68°C for 10 min. The amplified band with the expected fragment size was confirmed by agarose gel electrophoresis. Iso-molar amounts (about 50 ng) of fragment 1, fragment 2, and fragment 3 were amplified by overlap PCR under the following conditions: initial denaturation at 94°C for 4 min; denaturation at 94°C for 40 s; annealing at 60°C for 40 s; extension at 68°C for 140 s; and after 5 cycles, a final extension at 68°C for 10 min. Subsequently, the mixture was supplemented with DNA polymerase, upstream primer 5'-gcaggggaaagaatagtagaca-3' (SEQ ID NO: 31), and downstream primer 5'-aatccagaggttgattgtcgacctagcgagggggcagggcctgc-3' (SEQ ID NO: 40), and amplified for 25 cycles under the following conditions: initial denaturation at 94°C for 4 min; denaturation at 94°C for 40 s; annealing at 60°C for 40 s; extension at 68°C for 140 s; and a final extension at 68°C for 10 min. The resulting 35-28Z (SEQ ID NO: 41) has a theoretical size of 1874 bp. The amplified product was confirmed by agarose gel electrophoresis and had the expected fragment size, with the sequence shown in SEQ ID NO: 23.

[0269] The vector pRRLSIN-cPPT.EF-1 alpha-EGFP.WPRE vector and 35-28Z were digested with Mlul and Sail, followed by ligation with T4 ligase and transformation into TOP10. Positive clones were identified by colony PCR and confirmed by Invitrogen sequencing, and pRRL-EF-1 alpha-35-28Z was obtained. Example 2: Packaging of Anti-GPC3-CAR lentivirus

[0270] Anti-GPC3-CAR lentivirus stocks (0.75 L) were prepared using embryonic kidney cells 293T (ATCC: CRL-11268). Specifically, 293T cells were seeded at 1.17 x 10 4 / cm 2 onto 5 layer cellstacks (Corning). Solution A was prepared on the day of transfection and contained 133.2 pg packaging plasmid pRSV-Rev, 133.2 pg pMDLg / pRRE, 51.56 pg pCMV-VSV-G and 111.7 pg pRRL-EF-1a-35-28Z, by dissolving 966 pg of all plasmids in 17 ml DMEM base medium and gently mixing. Solution B was prepared by dissolving 2.9 mg PEI (Polysciences) in 17 ml DMEM base medium, gently mixing the solution and incubating at room temperature for 5 min. Solution A was then introduced into solution B, mixed homogenously and left to stand at room temperature for 20-25 min. Subsequently, the 293T culture was transferred from the Cellstacks into a 1 L flask. The combined solution containing the plasmids and PEI was then introduced into the culture solution and gently mixed. The resulting solution was then transferred into the Cellstacks and incubated at 37 °C, 5% C02for 5 h, after which the medium was replaced with fresh growth medium DMEM supplemented with 10% FBS (Life Technology). The culture was then incubated at 37 °C, 5% C02for 48 h. Lentivirus stocks were then retrieved, filtered with a 0.45 pm (Millipore) filter, concentrated, purified using a tangential flow filtration system (Spectrum) and washed and stored with AIM-V (Life technology). Virus titration was performed according to the method described in CN104140974A. Virus titers were calculated to be about 1 x 1010 / ml. The virus was packaged at 1 x 1010 8 / ml per vial and stored at -80 °C for later use. 8 / ml per vial and stored at -80 °C for later use. Example 3: Preparation of anti-GPC3-CAR T cells and in vitro anti-tumor assay against hepatocarcinoma cells

[0271] CAR T cells were prepared in an immunocellular preparation laboratory according to cGMP standards. Specifically, human peripheral blood mononuclear cells (PBMCs) were obtained by separating peripheral blood or leukocyte-enriched blood from subjects using a COBE Spectra blood component separator via density gradient centrifugation. PBMCs were mixed with magnetic beads coated with anti-CD3 and anti-CD28 antibodies (Life Technology) at a 1:3 PMBC to magnetic bead ratio, stimulated with recombinant human IL-2 (Shanghai Hua Xin High Biotechnology Co., Ltd.) at a final concentration of 300 U / mL, and cultured for 48 h. Subsequently, activated T cells were transduced using the aforementioned lentivirus at approximately 5 MOI, with transduction efficiency enhanced by RetroNectin (Takara). Free virus was removed by medium replacement via low-speed centrifugation (100 g × 10 min) at 24 h and 48 h post-transduction. Magnetic beads were removed at 72 h post-transduction. The above centrifugation was repeated to obtain a density of 5 x 10⁻⁶ cells / mL. 5 Subcultured at / mL. Subsequently, at approximately 3 x 10⁹ / mL every other day. 5 Cells were passaged at a density of 300 U / mL, and recombinant human IL-2 was added to the lymphocyte culture medium at a final concentration of 300 U / mL.

[0272] After 10 to 12 days of in vitro culture, CAR expression in transduced CAR T cells was determined by flow cytometry. In other words, the positive transduction rate of CAR T cells was measured, and it is shown in Table 7. Furthermore, in vitro antitumor activity was assessed by co-incubating with high GPC3-expressing hepatocellular carcinoma cells (Huh-7), low GPC3-expressing PLC / PRF / 5, and GPC3-negative SK-HEP-1 cells for 18 hours, with effector-to-target ratios of 3:1, 1:1, and 1:3. Detailed procedures are described in CN104140974A. Table 8 presents the in vitro antitumor activity results at an effector-to-target ratio of 1:1.

[0273] The results showed that approximately 40% to 80% of the anti-GPC3-CAR T cells expressed CAR. Furthermore, the anti-GPC3-CAR T cells exhibited specific killing activity against GPC3-positive Huh-3 and PLC / PRF / 5 cells in a dose-dependent manner based on the effector:target ratio, while they showed no killing activity against GPC3-negative SK-HEP-1 (Table 8), indicating that the anti-GPC3-CAR T cells prepared by the subjects in this disclosure have excellent targeted killing activity.

[0274] Table 7: Overview of positive transduction rate and administration regimen of anti-GPC3-CAR T cells from subjects

[0275] Table 8: In vitro killing of anti-GPC3-CAR T cells from subjects (effector: target ratio of 3:1, 1:1 and 1:3, incubated in vitro for 18h) Example 4: Changes in lymphocytes after lymphodepletion

[0276] After confirming that no abnormalities occurred during the preparation of anti-GPC3-CAR T cells in the subjects, a comprehensive assessment of the various physical conditions of the subjects was performed to determine whether the subjects were suitable for lymphodepletion treatment in vivo. A main lymphodepletion regimen was designed to be administered to suitable subjects.

[0277] Two lymphodepletion regimens were designed: Regimen 1: cyclophosphamide (CTX) monotherapy lymphodepletion regimen with a dose of 1 g / m 2 per day x 1 day. Regimen 2: fludarabine (FLU) + cyclophosphamide combined lymphodepletion regimen with a dose of 20-30 mg fludarabine / m 2 per day x 4 days + 500 mg cyclophosphamide / m 2 per day x 2 days.

[0278] The regimen was implemented with adjustments including the following conditions: calculation of the body surface area according to the Stevenson formula (Chinese Journal of Physiology, 12:327, 1937). That is, the surface area (m 2 ) = 0.0061 x height (cm) + 0.0128 x weight (kg) - 0.1529. For example, an adult with a height of 170 cm and a weight of 60 kg has a surface area of 1.6521 m 2 Subjects who were not suitable for lymphodepletion treatment due to existing physical conditions or their own choice were assigned to a second cohort. Different lymphodepletion treatments were performed on a total of three subjects (H01, H02 and H03). One subject (H04) did not undergo ablation due to physical conditions and their own choice. The regimen is shown in Table 9.

[0279] Table 9: Overview of lymphodepletion regimens for subjects

[0280] H01 1 indicates the initial administration of anti-GPC3-CAR T cell therapy to subject H01; H01 2H01 second administration of anti-GPC3-CAR T cell therapy; and DO is defined as the day of administration of anti-GPC3-CAR T cell administration. After implementing the above lymphodepletion regimen, the absolute values of lymphocytes in the subjects varied. The result of lymphodepletion therapy with single-agent cyclophosphamide was a reduction of lymphocytes by about 40% to about 72%. In comparison to cyclophosphamide monotherapy, the lymphodepletion therapy with fludarabine and cyclophosphamide combination produced a more significant difference in lymphocyte reduction, by about 82% to about 96.5%. In particular, FIG. 2 The change in the ratio of absolute number of lymphocytes to baseline at each monitoring time point before and after lymphodepletion therapy administration is shown. The above results demonstrate that the combination therapy of fludarabine and cyclophosphamide resulted in a more optimal lymphocyte reduction compared to the cyclophosphamide monoreduction regimen. Example 5: Clinical response of subjects after ablation

[0281] About 2 days after implementing lymphodepletion, the subjects were intravenously administered anti-GPC3-CAR T cell therapy. The dose of anti-GPC3-CAR T cells administered is presented in Table 7. The clinical response of the subjects after treatment is summarized in Table 10. The results demonstrate that, so far, three subjects who received lymphodepletion had stable disease (SD) or partial disease (PR) after anti-GPC3-CAR T cell therapy. In contrast, subject H04, who did not receive lymphodepletion therapy, showed progressive disease by MRI 4 weeks after anti-GPC3-CAR T cell therapy.

[0282] As for AFP results, the prognosis of subject H02 could not be assessed from tumor markers since AFP is not sensitive. For the other two subjects, their AFP levels slightly decreased, as shown in Table 10. It should be noted that subject H03 showed an 87% decrease in AFP after lymphodepletion therapy with the combination of fludarabine and cyclophosphamide compared to baseline before treatment. At the same time, imaging showed partial clinical response at the target site. FIG. 3 MRI results of subject H03 before treatment and 10 weeks after treatment are shown.

[0283] Table 10: Summary of clinical response of subjects after anti-GPC3-CAR T cell therapy

[0284] Note: ↓ indicates a decrease in AFP level; ↑ indicates an increase in AFP level; PD indicates progressive disease; CR indicates complete response; and PR indicates partial response. Safety data and clinical observations showed that no subject developed intolerable toxicity or side effects after treatment with anti-GPC3-CAR T cells. All subjects had some degree of fever and increase in GRP. Subjects H01 and H04 had chills after administration. Subject H03 had a decrease in albumin caused by fever. Subjects had normal albumin after fever stopped by taking exogenous nutrients and albumin (Table 11).

[0285] Table 11: Summary of toxicity or side effects of subjects after administration of anti-GPC3-CAR T cells after lymphocyte reduction therapy.

[0286] In addition, cytokine release syndrome, which often occurs during the treatment of hematological cancers using CAR T cells, was not observed in this clinical study, indicating that anti-GPC3-CAR T cells are safe.

[0287] In summary, the clinical study results of the treatment of GPC3-positive hepatocellular carcinoma using CAR-GPC T cells demonstrate that subjects who received effective lymphocyte reduction therapy obtained certain clinical benefits by anti-GPC3-CAR T cell treatment, while subjects who did not receive lymphocyte reduction therapy did not obtain any clinical benefits. In addition, neither subjects who received nor subjects who did not receive lymphocyte reduction therapy exhibited intolerable toxicity or side effects, both had certain adverse reactions such as fever and CRP increase, indicating that lymphocyte reduction therapy can not have worsened the adverse reactions of subjects. In addition, the combined fludarabine and cyclophosphamide lymphocyte reduction regimen can be superior to the cyclophosphamide monotherapy lymphocyte reduction regimen in terms of the effect of lymphocyte reduction therapy and the benefits to subjects. In summary, anti-GPC3-CAR T cell treatment after effective lymphocyte reduction therapy can provide an effective therapeutic solution for the clinical treatment of GPC3-positive hepatocellular carcinoma. Example 6: Phenotype analysis

[0288] Cell surface molecule expression was determined by flow cytometry using standard methodology. The following monoclonal antibodies conjugated with phycoerythrin, fluorescein isothiocyanate, and / or peridinin chlorophyll protein were used: CD3, CD4, CD8, CD30, CCR4, CD45RA, CD45RO, CCR7, CD62L, CD56, alpha beta T cell receptor (BD Biosciences PharMingen). Anti-CAR antibody was used to detect CAR expression of T cells. Samples were analyzed using a FACSCalibur (BD Biosciences PharMingen) and data were analyzed by CellQuest Pro software (BD Biosciences, San Jose, CA). At least 10,000 positive events were measured for each sample. Example 7: Cytotoxicity Assay: Hepatocarcinoma

[0289] To assess the potential cytotoxic effects of second or third generation CAR-T transduced T cells, a CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega) was performed. Briefly, anti-GPC3 CAR-T cells 33-28BBZ, 92-28BBZ and 4-28BBZ were co-cultured with control cells SK-HEP-1 (GPC3-), and CHO-K1 (GPC3+) at effector: target ratios of 3:1, 1:1 or 1:3, target cells were 10,000 / well and incubated at 37°C for 18 hours. Visible wavelength absorbance data was collected after incubation using a standard 96 well plate reader. FIG. 4A ) and CHO-K1 ( FIG. 4B ) at effector: target ratios of 3:1, 1:1 or 1:3, target cells were 10,000 / well and incubated at 37°C for 18 hours. Visible wavelength absorbance data was collected after incubation using a standard 96 well plate reader.

[0290] To assess anti-tumor cytotoxicity, CAR-T cells 33-28BBZ, 92-28BBZ and 4-28BBZ were co-cultured with GPC3 positive hepatocarcinoma cells Huh-7 or control cells transduced to express GPC3, CHO-K1-GPC3+ at effector: target ratios of 3:1, 1:1 or 1:3, target cells were 10,000 / well and incubated at 37°C for 18 hours, respectively FIG. 5A and FIG. 5B Visible wavelength absorbance data was collected after incubation using a standard 96 well plate reader.

[0291] For all effector: target ratios, cytotoxicity was taken as the mean of 5 replicate wells. Results

[0292] Cytotoxicity data shows that 33-28BBZ, 92-28BBZ and 4-28BBZ CAR-T constructs have cytotoxicity against GPC3 expressing tumor cell lines at 3:1, 1:1 and 1:3, but not against control lines that do not express GPC3.​ Example 8: Cytotoxicity assay: Liver cancer group

[0293] To assess the potential cytotoxicity of second- or third-generation CAR-T transduced T cells, CytoTox was used. Non-radioactive cytotoxicity assay (Promega). In short, anti-GPC3 CAR-T cells were inoculated with HepG2 (HCC) at 92-28Z, 92-BBZ, 92-28BBZ or empty vector. FIG. 6A ), Hep3B(HCC)( FIG. 6B ) or PLC / PRF / 5 (liver cancer) ( FIG. 6C Co-culture was performed with an effector-to-target ratio of 3:1, 1:1, or 1:3, at a target cell density of 10,000 cells / well, and incubated at 37°C for 18 hours. To evaluate the cytotoxicity of second- and third-generation CAR-T cells, 92-28Z, 92-BBZ, 92-28BBZ, or an empty vector were co-cultured with Huh-7 liver cancer cells exhibiting high GPC3 expression for similar CytoTox assays. Measurement, FIG. 7A After incubation, absorbance data at visible wavelengths were collected using a standard 96-well plate reader. result

[0294] Cytotoxicity data showed that the second- and third-generation constructs exhibited comparable cytotoxicity across all hepatocellular carcinoma cell lines, including HCC and liver cancer cell lines, at ratios of 3:1, 1:1, and 1:3. The second- and third-generation constructs were able to target tumor cells expressing different levels of GPC3, revealing broad tumor-targeting potential. Example 9: Cytotoxicity assay: Gastric cancer

[0295] To evaluate the potential cytotoxic effects of second- or third-generation CAR-T transduced T cells in the gastric cancer tumor environment, CytoTox was used. Non-radioactive cytotoxicity assay (Promega). In short, anti-GPC3 CAR-T cells (92-28Z, 92-28BBZ, or empty vector) were co-cultured with KATO-III at an effector:target ratio of 1:3, 1:1, and 3:1, at 10,000 cells / well, and incubated at 37°C for 18 hours. result

[0296] Cytotoxicity data showed that the second- and third-generation constructs were effective against the gastric cancer tumor line KATO-III ( FIG. 7B It exhibits considerable cytotoxicity, with cells transduced with empty vectors showing no activity. Data indicate that CAR-T cells are specific to their tumor targets and do not show reactivity in tissues that do not express the GPC3 antigen. Example 10: Comparison of scFv 33 and scFv 92

[0297] To compare CAR-T with different scFv against GPC3, second or third generation CAR-T transduced T cells were used in CytoTox Non-radioactive cytotoxicity assay (Promega). Briefly, anti-GPC3 CAR-T cells 33-28Z, 92-28Z, 92-BBZ, 92-28BBZ or empty vector were co-cultured with Huh-7 cells or control cells A431 (GPC3 negative) at effector: target ratios of 3: 1, 1: 1 or 1:3, target cells were 10,000 / well and incubated at 37°C for 18 hours. Visible wavelength absorbance data was collected after incubation using a standard 96 well plate reader. Results

[0298] Cytotoxicity data showed that constructs with scFv 92 had increased cytotoxicity compared to constructs with scFv 33 at effector target ratios of 3: 1, 1: 1 and 1:3, FIG. 10B Cytotoxicity was antigen specific as no cytotoxicity was detected when co-cultured with GPC3 negative tumor cell line A431, FIG. 10A . Example 11: Comparison of second and third generation CAR-T

[0299] To compare second and third generation CAR-T, CAR-T transduced T cells were used in CytoTox Non-radioactive cytotoxicity assay (Promega). Briefly, anti-GPC3 CAR-T cells 4-28Z, 4-28BBZ, 4-4-28BBZ, 4-14-28BBZ, 4-20-28BBZ, 4-35-28BBZ, 4-42-28BBZ or empty vector transduced cells were co-cultured with Huh7 (HCC) cells at effector: target ratios of 3: 1 or 1: 1, target cells were 10,000 / well and incubated at 37°C for 18 hours. Visible wavelength absorbance data was collected after incubation using a standard 96 well plate reader. Results

[0300] Cytotoxicity data showed that second and third generation constructs were cytotoxic, 4-20-28BBZ, 4-35-28BBZ and 4-42-28BBZ were more cytotoxic as measured by increased lysis, FIG. 9 . Example 12: Proliferation assay

[0301] Proliferation of anti-GPC3 CAR-T following exposure to target cells (Huh-7, GPC3+) or control cells (SK-HEP-1, GPC3-) was determined by carboxyfluorescein succinimidyl ester dilution assay.

[0302] One week post-transduction, control T lymphocytes and anti-GPC3 CAR-T cells were labeled with 1.5 μmol / L carboxyfluorescein diacetate succinimidyl ester (CFSE; Invitrogen) and plated with irradiated tumor targets (GPC3 positive and GPC3 negative lines) at an effector:target (E:T) ratio of 5: 1. CFSE dilution on CD4 + and CD8 + T cells was measured by flow cytometry on day 4 of co-culture. Example 13: Tumor engraftment murine model from patient and lymphodepletion

[0303] NOD / SCID mice were each engrafted with a 2x2x2 mm lung cancer tumor. At approximately day 27 post-engraftment or when tumor size reached 220 mm 3 , the mice were intravenously administered cyclophosphamide and intraperitoneally administered 1x10 7 empty vector, hu92-28Z, or hu92-28BBZ CAR-T cells. A subsequent second administration was performed on day 34. Tumor volume was measured approximately every 3-7 days using caliper measurements until day 52 post-tumor inoculation. Results

[0304] At day 51 post-tumor inoculation, mice treated with second generation CAR-T 92-28Z had significantly reduced tumor size, FIG. 8A and FIG. 8B compared to mice treated with third generation CAR-T 92-28BBZ or saline, FIG. 8C Mice treated with second generation CAR-T 92-28Z also had significantly reduced tumor weight, FIG. 8D compared to mice treated with third generation CAR-T 92-28BBZ or saline. Example 14: Xenograft HCC murine model

[0305] NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ (NSG) mice (Bar Harbor, ME) at the left flank were engrafted with 0.5x10 6Huh-7 tumor cells. Seven days after tumor inoculation, mice were treated with 1 x 10 7 Results

[0306] Treatment with hu92-28Z and hu92-28BBZ had significant anti-tumor activity compared to mice treated with T cells transduced with an empty vector. FIG. 11A Mice treated with hu92-28Z or hu92-28BBZ had significantly reduced tumor volume at day 35 after tumor cell inoculation. FIG. 11B Mice treated with hu92-28Z or hu92-28BBZ had significantly smaller tumors compared to mice treated with T cells transduced with an empty vector, as evidenced by their reduced weight. FIG. 11C Images of xenograft tumors are shown. Example 15: Clinical expansion of anti-GPC3 CAR T cells

[0307] To generate large quantities of transduced T cells, cells were induced to proliferate using a rapid expansion protocol (REP). Prior to use in the REP, T cells were first cultured with anti-CD3, anti-CD28, and IL-2, and transduced the day after initiation of culture as described above. Cells were cultured in 75 cm 2 flasks at 37°C and 5% C02. Cells were counted every 2 days and suspended at a concentration of 0.5 x 10 6 cells / mL in fresh T cell media with 300 IU / mL IL-2, and they were maintained in culture for the remainder of the time. Example 16: Clinical trial:

[0308] Patients with assessable liver cancer undergo apheresis to isolate peripheral blood mononuclear cells. Lymphocytes are isolated, transduced with an anti-GPC3 CAR virus, expanded, and aliquots are taken for immunological testing. On days -7 and -6 prior to CAR-T administration, patients undergo a 1 hour intravenous cyclophosphamide pretreatment regimen of 60 mg / kg / day x 2 days. On days -7 and -3 prior to CAR-T administration, patients undergo a 30 minute daily 5 day pretreatment regimen of 25 mg / m 2 / day via intravenous infusion (IVPB) fludarabine. During the pretreatment regimen, patients undergo a complete blood count (CBC) test daily.

[0309] In the first part of the Phase I study, one patient per cohort begins dose escalation, with each patient starting at a dose of 10​9 individuals with half-log increments. Thus, the following doses will be used: 10 9 cells, 3x10 9 cells, 10 10 cells, 3x 10 10 cells, and up to 1x 10 11 cells. Autologous anti-GPC3 CAR-T will be administered intravenously over 20 to 30 minutes via a non-filtering line.

[0310] All patients will return to the clinic for evaluation 6 weeks after administration of the CAR-T cell product.

[0311] Table 12: Sequences

Claims

1. A method for treating a subject with a solid tumor expressing phosphatidylinositol proteoglycan-3 (GPC3), the method comprising administering anti-GPC3 chimeric antigen receptor immune response cells to the subject, wherein the administration is performed after or concurrently with lymphopenia treatment received by the subject, wherein the lymphopenia treatment comprises administering cyclophosphamide and fludarabine to the subject.

2. The method according to claim 1, wherein the immune response cells are NK cells (anti-GPC3-CAR NK cells) or T cells (anti-GPC3-CAR T cells).

3. The method of claim 2, wherein the administration of the anti-GPC3-CAR T cells to the subject is performed after the subject has received lymphopenia treatment.

4. The method of claim 2, wherein the amount of anti-GPC3-CAR T cells administered to the subject is at least about 5 × 10⁻⁶. 4 per kg.

5. The method of claim 2, wherein the amount of anti-GPC3-CAR T cells administered to the subject is approximately 5 × 10⁻⁶. 4 To approximately 1×10 12 per kg.

6. The method of claim 1, wherein the application effectively reduces the tumor size by at least 30%, the tumor size being measured by computed tomography (CT) scan.

7. The method of claim 1, wherein the application effectively stabilizes tumor size, wherein the stabilized tumor size is a baseline measurement of the tumor lesion diameter as measured by computed tomography (CT) scan with a change of less than 10%.

8. The method of claim 2, wherein the combination of administration of anti-GPC3-CAR T cells and lymphopenia treatment synergistically extends the median survival of the subject by at least about 6 months compared to administration of the anti-GPC3-CAR T cells alone.

9. The method according to claim 1, wherein the solid tumor is liver cancer, gastric cancer, lung cancer, breast cancer, head and neck cancer, ovarian cancer, thyroid cancer, kidney cancer, bladder cancer, cervical cancer, pancreatic cancer, liposarcoma, testicular non-seminomatous germ cell cancer, melanoma, adrenal adenoma, schwannoma, malignant fibrous histiocytoma, or esophageal cancer.

10. The method of claim 1, wherein the anti-GPC3 chimeric antigen receptor comprises an antigen-binding unit that specifically binds to the C-terminus of GPC3.

11. The method of claim 10, wherein the antigen-binding unit comprises a sequence selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:

8.

12. The method of claim 1, wherein the anti-GPC3-CAR comprises a sequence selected from SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:

30.

13. The method of claim 1, wherein the anti-GPC3-CAR comprises a sequence selected from SEQ ID NO 28, SEQ ID NO 29 or SEQ ID NO 30.

14. The method of claim 2, wherein the anti-GPC3-CAR T cell comprises at least two intracellular signal transduction domains.

15. The method of claim 2, wherein the anti-GPC3-CAR T cell comprises at least three intracellular signal transduction domains.

16. The method of claim 14, wherein the intracellular signal transduction domain is selected from the signal transduction domains of CD3, CD28, 4-1BB, OX40, DAP10, or ICOS.

17. The method of claim 1, wherein the lymphopenia treatment comprises reducing the amount of regulatory T cells in the subject.

18. The method of claim 17, wherein reducing the amount of regulatory T cells comprises reducing the number of said regulatory T cells by at least about 30%, the amount of said regulatory T cells being determined by the amount of circulating CD4+ in the subject. + and CD25 + Flow cytometry analysis of cells.

19. The method of claim 1, wherein the lymphopenia treatment further comprises administering radiation or a biological agent to the subject.

20. The method of claim 1, wherein the lymphopenia treatment further comprises administering other chemotherapy to the subject.

21. The method of claim 20, wherein administering other chemotherapy to the subject comprises administering a chemotherapeutic agent selected from etoposide, cytarabine, methotrexate, vincristine, doxorubicin, and any combination thereof.

22. The method of claim 21, wherein the chemotherapeutic agent is administered to the subject at least once prior to the administration of the anti-GPC3-CAR T cells.

23. The method of claim 1, wherein the lymphopenia treatment reduces the number of lymphocytes by at least about 20%, the number of lymphocytes being measured by complete blood count (CBC) analysis.

24. The method of claim 2, further comprising administering the anti-GPC3-CART cells to the subject a second time.

25. The method of claim 1, wherein the subject suffers from a refractory, persistent, or progressive disease.

26. The method of claim 2, wherein the anti-GPC3-CAR T cells are autologous or allogeneic relative to the subject.

27. The method of claim 1, further comprising administering at least one immunostimulant to the subject concurrently with or after the administration of the anti-GPC3 chimeric antigen receptor immune response cells.

28. The method of claim 27, wherein the immunostimulant is selected from interleukin-2 (IL-2), IL-3, IL-6, IL-11, GM-CSF, and any combination thereof.

29. The method of claim 19, wherein the biological agent is an antibody that targets an antigen expressed on lymphocytes.

Citation Information

Patent Citations

  • Nucleic acid for coding GPC-3 (glypican-3) chimeric antigen receptor protein and T lymphocytes for expression of GPC-3 chimeric antigen receptor protein

    CN104140974A

  • annular gap magnet system

    FR901228A

  • Apparatus for electrically heating liquids

    US1685210A

  • Charles bild

    US595690A