SIRNAS, MODIFICATIONS, CONJUGATES TARGETING THE REGULATION OF THE EXPRESSION OF THE FXI GENE AND USES THEREOF

By designing siRNA sequences modified with specific templates and coupling them with GalNAc, the expression of the FXI gene is targeted and regulated, which solves the problems of bleeding risk and low compliance of existing anticoagulant drugs and achieves a highly efficient and long-lasting FXI inhibition effect.

CN121109397BActive Publication Date: 2026-05-08BEIJING YUEKANGKECHUANG PHARM TECH CO LTD
View PDF 14 Cites 0 Cited by

Patent Information

Application Number
CN202511659072.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2025-05-08
Filing Date
2025-11-13
Publication Date
2026-05-08
Estimated Expiration
2045-11-13

AI Technical Summary

Technical Problem

Existing anticoagulants may inhibit hemostasis while inhibiting thrombus formation, leading to bleeding risk. Moreover, most of them require frequent administration, resulting in low patient compliance, especially for patients with impaired renal function.

Method used

Design specific template-modified siRNA sequences and couple them with N-acetylgalactosamine (GalNAc) to target and regulate FXI gene expression. The siRNA duplexes are synthesized through recombinant vectors or recombinant cells to form conjugates, which are used to inhibit FXI gene expression.

Benefits of technology

It significantly inhibits FXI expression, reduces the risk of bleeding, improves patient compliance, and the siRNA conjugate remains effective in vivo for at least 49 to 84 days, reducing the risk of renal impairment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
  • Figure SMS_4
    Figure SMS_4
Patent Text Reader

Abstract

The present disclosure provides siRNAs, modifications, conjugates targeting the regulation of expression of coagulation factor XI (FXI) gene and uses thereof. The present disclosure designs a series of siRNAs based on the FXI messenger ribonucleic acid (mRNA) sequence, and performs alternating modification and modification using a specific set of modification templates. The results of cell and animal experiments show that some oligonucleotide sequences with alternating modification and specific template modification can significantly inhibit the expression of the FXI gene, and can be used for the development of anticoagulant drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure pertains to the field of biomedicine and specifically relates to siRNAs, modifications, conjugates, and their uses that target and regulate the expression of the FXI gene, such as their application in regulating FXI gene expression or in anticoagulation. Background Technology

[0002] The coagulation cascade is completed through both intrinsic and extrinsic coagulation pathways. The intrinsic coagulation pathway includes coagulation factors FXI and FXII. In the classical model, upon contact with collagen, RNA, or polyphosphates, FXII is activated. FXIIa further activates downstream FXI, producing FXIa. Through downstream coagulation factors such as FIX and FX, thrombin is ultimately generated via a common pathway. Thrombin initiates fibrin formation while simultaneously activating FXI, creating a positive feedback loop that amplifies the coagulation process. Thrombus formation is primarily triggered by the intrinsic pathway.

[0003] The extrinsic coagulation pathway is typically triggered by tissue factor (TF), which activates FVII and subsequently the common pathway, playing a crucial role in hemostasis. When a blood vessel is damaged, FVII or FVIIa in the blood binds to extravascular tissue factor TF. The FVIIa-TF complex converts FX to FXa, which then converts a limited amount of prothrombin into thrombin. During hemostasis, FXI is converted to FXIa by thrombin, and FXIa subsequently activates FIX and its downstream pathways, leading to clot coagulation, but its overall effect is relatively small. In summary, FXI, a key molecule in the intrinsic coagulation pathway, plays a vital role in regulating the physiological processes of thrombosis, but it is almost entirely absent from pathological processes such as bleeding, which are primarily regulated by extrinsic pathways. Therefore, it could potentially serve as a novel target for antithrombotic therapy.

[0004] Currently marketed anticoagulants include vitamin K antagonists (VKAs), which primarily inhibit prothrombin and FX, and heparin and oral anticoagulants (DOACs), which primarily inhibit FXa and thrombin. These drugs may inhibit hemostasis associated with the extrinsic coagulation pathway while inhibiting thrombus formation, thus posing a certain risk of bleeding during treatment. Conversely, in this study, the target FXI had a minimal effect on hemostasis but played a fundamental role in thrombus formation, effectively separating the hemostasis and thrombus formation processes, thereby reducing the risk of bleeding while simultaneously providing anticoagulation. Furthermore, the fully modified siRNA drug conjugated with GalNAc exhibits excellent long-term efficacy, allowing for once-every-six-month dosing with sustained therapeutic effects, significantly improving patient compliance. Summary of the Invention

[0005] The problem the invention aims to solve:

[0006] Currently, among commonly used anticoagulants in clinical practice, vitamin K antagonists mainly inhibit prothrombin and FX, while heparin and oral anticoagulants (DOACs) mainly inhibit FXa and thrombin. These drugs may inhibit hemostasis related to the extrinsic coagulation pathway while inhibiting thrombus formation, thus posing a certain risk of bleeding during treatment. Furthermore, many small-molecule anticoagulant inhibitors under development require daily administration, leading to low patient compliance. Additionally, for patients with impaired renal function, drugs metabolized by the kidneys have a significant impact on renal function. Therefore, there is an urgent need to develop anticoagulants that can reduce the risk of bleeding and improve patient compliance.

[0007] Solution:

[0008] This disclosure describes the design of a series of siRNA sequences targeting the FXI mRNA sequence, followed by specific template modification to couple N-acetylgalactosamine (GalNAc).

[0009] This disclosure modifies the designed siRNA sequences to screen out some alternating and specific modification sequences that have a significant inhibitory effect on FXI gene expression.

[0010] On the one hand, this disclosure provides an siRNA duplex comprising an oligonucleotide duplex composed of a sense strand and an antisense strand paired together.

[0011] On the other hand, this disclosure provides a conjugate for reducing the expression of FXI, comprising the above-mentioned siRNA duplex and a conjugate group attached thereto.

[0012] On the other hand, this disclosure provides a nucleic acid protein composition comprising the double-stranded region of the above-mentioned siRNA double-stranded form or the antisense strand of the double-stranded region, and a nuclease.

[0013] On the other hand, this disclosure provides a recombinant vector comprising a nucleic acid molecule encoding the above-mentioned siRNA double strand.

[0014] In some embodiments, the vector backbone of the recombinant vector is selected from recombinant viroid-derived circular RNA vectors, tRNA, rRNA scaffolds, and chimeric tRNA / pre-miRNA vectors.

[0015] On the other hand, this disclosure provides a recombinant cell that synthesizes and secretes the above-mentioned siRNA double strand.

[0016] In some embodiments, the recombinant cells are selected from *Pseudomonas thiophile* and *Corynebacterium glutamicum* deficient in ribonuclease III.

[0017] On the other hand, this disclosure provides a method for preparing siRNA duplexes, including culturing the above-mentioned recombinant cells or chemical synthesis.

[0018] On the other hand, this disclosure provides a pharmaceutical composition comprising the above-described siRNA double strand, the above-described conjugate, or the above-described nucleic acid protein composition, and a pharmaceutically acceptable carrier.

[0019] On the other hand, this disclosure provides a method for inhibiting FXI gene expression, comprising contacting the above-mentioned siRNA double strand, the above-mentioned conjugate, the above-mentioned nucleic acid protein composition, or the above-mentioned pharmaceutical composition with target cells.

[0020] In some implementations, the method is for non-diagnostic or non-therapeutic purposes.

[0021] In some implementations, the method is in vivo or in vitro.

[0022] On the other hand, this disclosure provides the use of the above-mentioned siRNA double strand, the above-mentioned conjugate, the above-mentioned nucleic acid protein composition, or the above-mentioned pharmaceutical composition in the preparation of a medicament for treating diseases related to FXI gene expression.

[0023] The FXI gene expression-related diseases are selected from diseases caused by FXI protein overexpression, pathogenic mutations in the FXI gene, abnormal FXI protein metabolism, and abnormal interactions between FXI and another substance.

[0024] In some implementations, the FXI gene expression-related diseases are selected from thrombotic diseases including deep vein thrombosis, venous or arterial thrombosis, ischemic stroke, pulmonary embolism, myocardial infarction, stroke, Alzheimer's disease, and thrombosis associated with chronic kidney disease or end-stage renal disease.

[0025] On the other hand, this disclosure provides the above-mentioned siRNA double strand, the above-mentioned conjugate, the above-mentioned nucleic acid protein composition, or the above-mentioned pharmaceutical composition for the treatment of diseases related to FXI gene expression, such as atrial fibrillation stroke prevention, end-stage renal disease dialysis, and knee replacement anticoagulation.

[0026] On the other hand, this disclosure provides a method for treating diseases related to FXI gene expression, comprising administering an effective amount of the above-mentioned siRNA duplex, the above-mentioned conjugate, the above-mentioned nucleic acid protein composition, or the above-mentioned pharmaceutical composition to a subject in need.

[0027] On the other hand, this disclosure provides the use of the above-mentioned siRNA double strand, the above-mentioned conjugate, the above-mentioned nucleic acid protein composition, or the above-mentioned pharmaceutical composition in the preparation of a drug for treating cardiovascular and cerebrovascular diseases.

[0028] On the other hand, this disclosure provides the above-mentioned siRNA double strand, the above-mentioned conjugate, the above-mentioned nucleic acid protein composition, or the above-mentioned pharmaceutical composition for the treatment of cardiovascular and cerebrovascular diseases.

[0029] On the other hand, this disclosure provides a method for treating cardiovascular and cerebrovascular diseases, comprising administering an effective amount of the above-mentioned siRNA double strand, the above-mentioned conjugate, the above-mentioned nucleic acid protein composition, or the above-mentioned pharmaceutical composition to a subject in need.

[0030] Invention effects:

[0031] The beneficial effects achieved by this disclosure are at least as follows:

[0032] (1) The sequences modified by alternating fluorine and oxygen and the template modified by the present invention can significantly inhibit the expression level of the target gene FXI in HepG2 cells. The inhibition rate is significantly higher than that of the high-activity sequences in the published patents.

[0033] (2) The siRNA conjugate of the present invention coupled with the GalNAc conjugate group G101 showed a high inhibition rate of the expression of the target gene FXI in mice in vivo experiments, and the duration was at least 49 days.

[0034] (3) The siRNA conjugate of the present invention coupled with the GalNAc conjugate group G101 showed a high inhibitory effect on the expression level and activity of the target gene FXI and a prolongation effect on APTT (activated partial thromboplastin time) in cynomolgus monkeys, and the duration was at least 84 days.

[0035] (4) Some basic sequences, using multiple modified templates, all have a high inhibition rate on the target gene FXI. Detailed Implementation

[0036] To make this disclosure easier to understand, certain terms are first defined. Furthermore, it should be noted that whenever a range of values ​​or parameters is enumerated, the purpose is to indicate that intermediate values ​​and ranges of these referenced values ​​are also intended to be part of this disclosure.

[0037] The articles “a” and “an” as used in this article refer to one or more (i.e., at least one) grammatical objects of the article. By way of example, “an element” refers to one element or more elements, such as multiple elements.

[0038] The term “including” is used here to refer to the phrase “including but not limited to” and is used interchangeably with it.

[0039] The term “or” is used here to mean and / or the term “and / or” and is used interchangeably with it, unless the context clearly indicates otherwise.

[0040] As used herein, the term “about” or “approximately” when applied to one or more target values ​​means a value similar to the reference value. In some embodiments, unless otherwise stated or otherwise apparent from the context, the term “approximately” or “about” means a range of values ​​falling within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the reference value in any direction (unless such a number would exceed 100% of the possible value).

[0041] As used in this article, "FXI" refers to the gene encoding coagulation factor 11 or the protein expressed by that gene.

[0042] The term "FXI gene" can refer to the wild-type FXI gene or a mutant FXI gene with sequence variations. Many sequence variations in the FXI gene have been identified and can be found in, for example, NCBIdbSNP and UniProt (see, for example, ncbi.nlm.nih.gov / snp).

[0043] “G,” “C,” “A,” and “U” typically represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. “T” and “dT” are used interchangeably herein and refer to deoxyribonucleotides in which the nucleobase is thymine, such as deoxyribothymine, 2'-deoxythymidine, or thymidine. However, it should be understood that the terms “ribonucleotide,” “nucleotide,” or “deoxyribonucleotide” can also refer to a modified nucleotide (as detailed further below) or an alternative substitution. Those skilled in the art will readily recognize that guanine, cytosine, adenine, and uracil can be substituted with other parts without substantially altering the base-pairing properties of an oligonucleotide (including a nucleotide with such a substitution). For example, and not limited to, nucleotides containing inosine as a base can pair with nucleotides containing adenine, cytosine, or uracil. Therefore, nucleotides containing uracil, guanine, or adenine can be substituted in the nucleotide sequence of this disclosure with a nucleotide containing, for example, inosine. Sequences containing such substitution moieties are applicable to, but are not limited to, double-stranded ribonucleic acids, double-stranded ribonucleic acid modifications, double-stranded ribonucleic acid conjugates, pharmaceutical compositions, and methods of this disclosure.

[0044] The terms “complementary,” “fully complementary,” and “substantially complementary” are used herein to refer to base pairing between the sense and antisense strands of siRNA, or between the antisense strand of siRNA and the target sequence, as can be understood from the context in which they are used. In some embodiments herein, a first nucleotide sequence is considered complementary to a second nucleotide sequence if the first nucleotide sequence exhibits sequence complementarity of at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%. In one exemplary embodiment, 18 out of 20 nucleobases of the first nucleotide sequence pair with the corresponding region of the second nucleotide sequence, achieving 90% complementarity. The terms “double-stranded ribonucleic acid,” “double-stranded RNA (dsRNA) molecule,” “dsRNA,” and “ribonucleic acid duplex” are used interchangeably and specifically refer to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel, complementary, or substantially complementary nucleic acid strands, with “sense” and “antisense” orientations relative to a target gene, such as the FXI gene. In some embodiments, double-stranded ribonucleic acid (dsRNA) triggers the degradation of target RNA, such as mRNA, through a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi).

[0045] In this document, in some cases, "siRNA double strand" and "double-stranded RNAi agent" typically refer to the technical meanings implied by the above definitions. As is well known in the art, the terms "siRNA double strand," "double-stranded RNAi agent," "RNAi agent," "small interfering RNA," or "siRNA" refer to small interfering RNA (siRNA) molecules. It is a class of double-stranded RNA molecules, also known in the art as short interfering RNA or silent RNA. siRNA typically comprises a sense strand (also called a guest strand) and an antisense strand (also called a leader strand), each strand being 17 to 30 nucleotides in length, typically 19 to 25 nucleotides in length, wherein the antisense strand is complementary to the target nucleic acid (suitably a mature mRNA sequence) (e.g., at least 95% complementary, e.g., completely complementary), and the sense strand is complementary to the antisense strand, such that the sense and antisense strands form a double strand or a double-stranded region. The sense and antisense strands of siRNA can form blunt-ended duplexes or duplexes with 3' overhangs, for example, 1, 2, or 3 nucleotides in length, similar to the products produced by Dicer, and can form RISC substrates in vivo. Efficient extended forms of Dicer substrates have been described in US 8349809 and US 8513207, which are incorporated herein by reference. In some embodiments, both the sense and antisense strands have 3' overhangs of 2 nucleotides in length. Therefore, the length of the duplex region can be, for example, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, such as 19, 20, 21, 22, or 23 nucleotides in length.

[0046] Furthermore, in this document, "siRNA" sometimes also refers to "basic sequence." Specifically, "basic sequence" refers to an siRNA double helix in which each nucleotide is an unmodified nucleotide, and is also referred to as "motif," "siRNA motif," etc., throughout the document. Therefore, in this document, "siRNA," "basic sequence," "motif," and "siRNA motif" are used interchangeably, and their meanings also include the corresponding nucleotide sequence of the siRNA double helix they refer to. Those skilled in the art can clearly understand their precise technical meaning based on the context. Additionally, the 5' terminal nucleotide of the antisense strand of the motif may be linked to a 5' phosphate group or a 5' phosphate-derived group, or may not be linked to a 5' phosphate group or a 5' phosphate-derived group.

[0047] In this document, "siRNA modifier" refers to a double-stranded ribonucleic acid containing at least one modified nucleotide, and in some cases, it is also referred to as "double-stranded ribonucleic acid modifier". In this document, siRNA motifs are modified in different ways to prepare corresponding siRNA modifiers. For example, in some embodiments, the motif is modified using an alternating modification method to obtain alternatingly modified siRNA modifiers. In other embodiments, the motif is modified using a specific modification template to obtain siRNA modifiers modified with that specific modification template. In still other embodiments, the motif is modified using the off-target prevention modification method described herein to obtain off-target prevention modified siRNA modifiers. In some cases, multiple different modification methods can be used simultaneously to modify the same siRNA motif to obtain corresponding siRNA modifiers with multiple modification methods.

[0048] In this document, "siRNA conjugate" refers to a double-stranded ribonucleic acid conjugate or a conjugate of a double-stranded ribonucleic acid modification obtained by attaching a conjugate group to a double-stranded ribonucleic acid modification. Preferably, "siRNA conjugate" refers to a conjugate of a double-stranded ribonucleic acid modification.

[0049] In some instances herein, "siRNA" refers not only to the unmodified siRNA double strand (or siRNA motif) described above, but may also refer to its corresponding siRNA modifiers and / or siRNA conjugates. For example, in contexts involving, but not limited to, treatment methods and therapeutic agents, siRNA generally refers to at least one of siRNA motifs, siRNA modifiers, and / or siRNA conjugates. The specific technical meaning will be clearly understood by those skilled in the art in the context.

[0050] The term “antisense strand” refers to a strand of double-stranded ribonucleic acid (such as the RNA double helix in this document) that includes a region substantially complementary to the target sequence. When used herein, the term “complementary region” refers to a region on the antisense strand that is substantially complementary to a sequence defined herein (such as the target sequence). When the complementary region is not perfectly complementary to the target sequence, mismatches can occur within the molecule or in terminal regions. Typically, the most permissible mismatches are in terminal regions, for example, within 5, 4, 3, 2, or 1 nucleotides at the 5' and / or 3' ends.

[0051] When used herein, the term “sense chain” refers to a double-stranded RNA chain that includes regions substantially complementary to the regions of the antisense chain (as defined herein).

[0052] The term "alternating modification" refers to a modification method in which nucleotides are modified with 2'-methoxy (2'-OMe) and 2'-fluorine (2'-F) according to the nucleotide sequence of the double-stranded RNA. For example, in the antisense strand of siRNA, odd-numbered positions (i.e., positions 1, 3, 5, 7, 11, 13, 15, 17, 19, 21, and 23) are modified with 2'-methoxy, and even-numbered positions (i.e., positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22) are modified with 2'-fluorine. For the sense strand complementary to this antisense strand, the corresponding position on the antisense strand that is modified with 2'-methoxy is modified with 2'-fluorine; and the complementary pairing position on the sense strand that is modified with 2'-fluorine on the antisense strand is modified with 2'-methoxy.

[0053] For RNA interference (RNAi), the suppression of target genes is achieved by loading the antisense strand of siRNA onto the AGO2 protein and forming a silencing complex (RISC), which then cleaves the gene's transcript mRNA. Loading the RISC requires phosphorylation of the 5' end of the antisense strand. This 5' phosphorylation can occur naturally within the cell via cleavage and polyadenylation factor I subunit 1 (Clp1), or it can be achieved through chemical synthesis. The terms "natural 5' phosphorylation" or "simple and direct 5' phosphorylation" refer to siRNA antisense strand phosphorylation occurring within the cellular environment, rather than through chemical synthesis.

[0054] In this document, "conjugation group" refers to a GalNAc derivative attached to an oligonucleotide. In some cases, the conjugation group includes a targeting group (also referred to as a ligand), and optionally also includes a linker, such as a GalNAc derivative attached to the oligonucleotide via a divalent, trivalent, or tetravalent branched linker arm, or, for example, a GalNAc derivative attached to the oligonucleotide via a monovalent linker arm. In most cases, "ligand" and "conjugation group" have meanings known in the art.

[0055] The term "inhibition" as used herein may be used interchangeably with "reduction," "silence," "downregulation," "suppression," and other similar terms, and includes any level of inhibition. In some instances, "regulation" in this document refers to "inhibition," the specific meaning of which will be readily apparent to those skilled in the art from the context.

[0056] As used herein, the phrase “inhibit FXI expression” includes inhibiting the expression of any FXI gene (such as, for example, the mouse FXI gene, the rat FXI gene, the monkey FXI gene, or the human FXI gene) and variants (e.g., naturally occurring variants) or mutants of the FXI gene. Therefore, the FXI gene can be a wild-type FXI gene, a mutant FXI gene, or, in the case of genetically manipulated cells, cell groups, or organisms, a transgenic FXI gene.

[0057] "Inhibition of FXI gene expression" includes inhibition of the FXI gene at any level, such as at least partial inhibition of FXI gene expression, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0058] FXI gene expression can be assessed based on the levels of any variable associated with FXI gene expression, such as FXI mRNA or FXI protein levels. Inhibition of FXI gene expression can be assessed by a reduction in the absolute or relative level of one or more of these variables compared to a control level. A control level can be any type of control level utilized in the art, such as baseline levels before administration or levels determined from similar untreated or controlled (e.g., buffer-only or inert control) subjects, cells, or samples.

[0059] In this article, in some cases, "regulation" can refer to the same meaning as "inhibition"; correspondingly, "regulating LPA gene expression" can mean "inhibiting LPA gene expression". Those skilled in the art will understand the specific technical meaning clearly in the context.

[0060] As used herein, "patient" or "subject" is intended to include humans or non-human animals, preferably mammals such as monkeys. More preferably, the subject or patient is a human.

[0061] As used herein, “FXI-related disease” is intended to include any disease associated with the FXI gene or protein. Such disease can be caused, for example, by overproduction of the FXI protein, mutations in the FXI gene, abnormal cleavage of the FXI protein, or abnormal interactions between FXI and other proteins or other endogenous or exogenous substances. Exemplary FXI-related diseases include thrombotic disorders such as deep vein thrombosis, venous or arterial thrombosis, ischemic stroke, pulmonary embolism, myocardial infarction, stroke, Alzheimer's disease, and thrombosis associated with chronic kidney disease or end-stage renal disease.

[0062] As used herein, “therapeutic effective dose” is intended to include the amount of RNAi agent that, when administered to a patient for the treatment of an FXI-related disease, is sufficient to achieve therapeutic effect on the disease (e.g., by attenuating, improving, or maintaining the existing disease or symptoms of one or more diseases). This “therapeutic effective dose” can vary depending on the RNAi agent, how the agent is administered, the disease and its severity, and medical history, age, weight, family history, genetic composition, stage of the pathological process mediated by FXI expression, type of prior or concomitant treatment (if any), and other individual characteristics of the patient to be treated.

[0063] As used herein, “preventive effective dose” refers to an amount of RNAi agent sufficient to prevent or improve the disease or one or more symptoms of the disease when administered to a subject who has not yet experienced or exhibited symptoms of an FXI-related disease but may be susceptible to it. Improving the disease includes slowing its progression or reducing the severity of subsequent disease development. This “preventive effective dose” can vary depending on the RNAi agent, how it is administered, the risk level for the disease, and medical history, age, weight, family history, genetic makeup, type of prior or concomitant treatment (if any), and other individual characteristics of the patient to be treated.

[0064] "Therapeutic effective amount" or "prophylactic effective amount" also includes the amount of RNAi agent that produces a desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The RNAi agent used in the methods of this disclosure can be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.

[0065] As used herein, the term "sample" includes similar fluids, cells, or tissues isolated from a subject, as well as a collection of fluids, cells, or tissues present in a subject. Examples of biological fluids include blood, serum and serous fluids, plasma, cerebrospinal fluid, ocular fluid, lymph, urine, saliva, etc. Tissue samples may include samples from tissues, organs, or localized regions. For example, a sample may originate from a specific organ, a portion of an organ, or fluids or cells within those organs. In some embodiments, a sample may originate from the liver (e.g., the entire liver or segments of the liver, or certain types of cells in the liver, such as hepatocytes). In a preferred embodiment, "sample derived from a subject" refers to blood or plasma drawn from that subject. In other embodiments, "sample derived from a subject" refers to liver tissue (or a subcomponent thereof) derived from that subject.

[0066] In this article, unless otherwise specified, when referring to any nucleotide position of any strand of siRNA motif, siRNA modifier, siRNA conjugate, siRNA duplex, etc., it means the 5' to 3' orientation.

[0067] In one aspect, this disclosure provides a siRNA duplex that targets and regulates the expression of the FXI gene, comprising a sense strand and an antisense strand forming an inverse complementary duplex region, wherein the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides complementary to a target sequence having the nucleotide sequence TTTCAGGATGATTTTCTTATATCAAGT (SEQ ID NO: 773) or ACTTCAGTTTCTGGTGAATGT (SEQ ID NO: 774).

[0068] The target sequence mentioned above was derived from Homo sapiens coagulation factor XI (F11), transcript variant 1, with accession number NM_000128.4 in the NCBI database.

[0069] In some embodiments, the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotide fragments or modified fragments thereof in sequences such as those shown in any of SEQ ID NO: 114-118, 121-123, and 139.

[0070] In some implementations, the length of the reverse complementary double-stranded region is 17 to 21 bp, for example 20 or 21 bp.

[0071] In some embodiments, the positive chain comprises at least 15, 16, 17, 18, or 19 consecutive nucleotide fragments or modified fragments thereof in any of the sequences shown in SEQ ID NO: 8-12, 15-17, and 33.

[0072] In some embodiments, the lengths of the sense strand and the antisense strand each independently comprise 19-23 nucleotides; preferably, the sense strand comprises 19-21 nucleotides and the antisense strand comprises 21-23 nucleotides.

[0073] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes composed of positive and negative strands, optionally wherein each of the positive and negative strands independently comprises at least one modified nucleotide:

[0074] (1) The positive chain has a sequence or a fragment thereof as shown in SEQ ID NO: 8; and the negative chain has a sequence or a fragment thereof as shown in SEQ ID NO: 114;

[0075] (2) The sense chain has a sequence or a fragment thereof as shown in SEQ ID NO: 9; and the antisense chain has a sequence or a fragment thereof as shown in SEQ ID NO: 115;

[0076] (3) The positive chain has a sequence or a fragment thereof as shown in SEQ ID NO: 10; and the negative chain has a sequence or a fragment thereof as shown in SEQ ID NO: 116;

[0077] (4) The positive chain has a sequence or a fragment thereof as shown in SEQ ID NO: 11; and the negative chain has a sequence or a fragment thereof as shown in SEQ ID NO: 117;

[0078] (5) The positive chain has a sequence or a fragment thereof as shown in SEQ ID NO: 12; and the negative chain has a sequence or a fragment thereof as shown in SEQ ID NO: 118;

[0079] (6) The positive chain has a sequence or a fragment thereof as shown in SEQ ID NO: 15; and the negative chain has a sequence or a fragment thereof as shown in SEQ ID NO: 121;

[0080] (7) The positive chain has a sequence or a fragment thereof as shown in SEQ ID NO: 16; and the negative chain has a sequence or a fragment thereof as shown in SEQ ID NO: 122;

[0081] (8) The positive chain has a sequence or a fragment thereof as shown in SEQ ID NO: 17; and the negative chain has a sequence or a fragment thereof as shown in SEQ ID NO: 123;

[0082] (9) The positive chain has a sequence or a fragment thereof as shown in SEQ ID NO: 33; and the negative chain has a sequence or a fragment thereof as shown in SEQ ID NO: 139.

[0083] In some implementations, the siRNA duplex is an RNAi agent used to inhibit the expression of the FXI gene.

[0084] In some implementations, the positive strand differs from any of the sequences in SEQ ID NO: 8-12, 15-17 and 33 by 1-3 nucleotides.

[0085] In some embodiments, the antisense strand differs from any of the sequences in SEQ ID NO: 114-118, 121-123 and 139 by 1-3 nucleotides.

[0086] In some implementations, the number of nucleotides in the sense strand may be the same as or different from the number of nucleotides in the antisense strand.

[0087] In some implementations, the sense strand has 19 nucleotides and the antisense strand has 19 nucleotides.

[0088] In some implementations, the sense strand has 19 nucleotides and the antisense strand has 21 nucleotides.

[0089] In some implementations, the sense strand has 20 nucleotides and the antisense strand has 20 nucleotides.

[0090] In some implementations, the sense strand has 20 nucleotides and the antisense strand has 22 nucleotides.

[0091] In some implementations, the sense strand has 21 nucleotides and the antisense strand has 21 nucleotides.

[0092] In some implementations, the sense strand has 21 nucleotides and the antisense strand has 23 nucleotides.

[0093] In some implementations, the sense strand has 23 nucleotides and the antisense strand has 23 nucleotides.

[0094] In some implementations, the sense strand and the antisense strand each independently contain at least one modified nucleotide.

[0095] In some embodiments, at least one modified nucleotide is selected from any or a combination of at least two of the following: deoxy-nucleotides, 3'-terminal deoxy-thymidine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, non-locked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholinyl nucleotides, aminophosphates, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphate groups, nucleotides containing 5'-phosphate groups, and nucleotides containing 5'-phosphate mimics.

[0096] In some implementations, at least one strand contains a 3' overhang of at least one nucleotide.

[0097] In some implementations, at least one strand contains a 3' overhang of at least two nucleotides.

[0098] In some embodiments, the length of the double-stranded region of the siRNA double strand is 15-30 pairs of nucleotides.

[0099] In some embodiments, the double-stranded region of the siRNA double strand is 17-25 pairs of nucleotides in length.

[0100] In some embodiments, the double-stranded region of the siRNA double strand is 19-23 pairs of nucleotides in length.

[0101] In some embodiments, the double-stranded region of the siRNA double strand is 21 nucleotide pairs in length.

[0102] In some implementations, each chain has 15-30 nucleotides.

[0103] In some trial designs, each chain has 19-25 nucleotides.

[0104] In some implementations, all nucleotides on the sense and antisense strands are modified by modifying the 2' position of the nucleotide ribose.

[0105] In some embodiments, the modification at the 2' position of the nucleotide ribose is selected from any one or a combination of several of the following: 2'-methoxy modification, 2'-methoxyethyl modification, 2'-fluoro modification, 2'-benzyloxy modification, 2'-methylcarbonylamino modification, and 2'-pyridinemethoxy modification.

[0106] In some embodiments, the modification at the 2' position of each nucleotide ribose is selected from a combination of 2'-methoxy modification and 2'-fluoro modification.

[0107] In some embodiments, the modification at the 2' position of each nucleotide ribose is selected from an alternating combination of 2'-methoxy and 2'-fluoro modifications.

[0108] In some implementations, the chemical modification of the 2' position of each nucleotide ribose is as follows: the odd-numbered positions of the antisense strand are all modified with 2'-methoxy, and the even-numbered positions are all modified with 2'-fluoride; the relative position of the 2'-methoxy modification on the sense strand and the antisense strand is 2'-fluoride, and the relative position of the 2'-fluoride modification is 2'-methoxy.

[0109] In some implementations, when the length of the sense strand is an odd number of nucleotides, the 2' position of the ribose of each nucleotide is modified as follows: the odd positions of the sense strand are all 2'-fluorinated, and the even positions are all 2'-methoxyinated; and the odd positions of the antisense strand are all 2'-methoxyinated, and the even positions are all 2'-fluorinated.

[0110] In some implementations, when the length of the sense strand is an even number of nucleotides, the 2' position of the ribose of each nucleotide is modified as follows: the odd-numbered positions of the sense strand are all 2'-methoxy modified, and the even-numbered positions are all 2'-fluorinated modified; and the odd-numbered positions of the antisense strand are all 2'-methoxy modified, and the even-numbered positions are all 2'-fluorinated modified.

[0111] In some implementations, nucleotides are linked to each other by 3',5'-phosphodiester bonds.

[0112] In some implementations, nucleotides are linked to each other by 3',5'-phosphothioester bonds.

[0113] In some embodiments, the first two nucleotides at the 3' and / or 5' ends of the sense and / or antisense strands of the siRNA modifier are connected by a 3',5'-phosphothioester bond; for example, in some embodiments, a chiral pure 3',5'-phosphothioester bond is formed. In some embodiments, one, two, or three 3',5'-phosphothioester bonds may be present between the first four nucleotides at the 5' end of the sense and / or antisense strands, and one, two, or three 3',5'-phosphothioester bonds may be present between the first four nucleotides at the 3' end of the antisense strand.

[0114] In some embodiments, a 3',5'-thiophosphate bond is formed between the first and second nucleotides at the 5' end of the sense strand, and between the second and third nucleotides at the 5' end; a 3',5'-thiophosphate bond is also formed between the first and second nucleotides at the 5' end of the antisense strand, and between the second and third nucleotides at the 3' end of the antisense strand. In some specific embodiments, the sense strand and / or the antisense strand has an alternating fluorine-oxygen modification.

[0115] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes composed of sense and antisense strand pairings:

[0116] (1) The sense chain has the sequence shown in SEQ ID NO: 220; the antisense chain has the sequence shown in SEQ ID NO: 326;

[0117] (2) The sense chain has the sequence shown in SEQ ID NO: 221; the antisense chain has the sequence shown in SEQ ID NO: 327;

[0118] (3) The sense chain has the sequence shown in SEQ ID NO: 222; the antisense chain has the sequence shown in SEQ ID NO: 328;

[0119] (4) The sense chain has the sequence shown in SEQ ID NO: 223; the antisense chain has the sequence shown in SEQ ID NO: 329;

[0120] (5) The sense chain has the sequence shown in SEQ ID NO: 224; the antisense chain has the sequence shown in SEQ ID NO: 330;

[0121] (6) The sense chain has the sequence shown in SEQ ID NO: 227; the antisense chain has the sequence shown in SEQ ID NO: 333;

[0122] (7) The sense chain has the sequence shown in SEQ ID NO: 228; the antisense chain has the sequence shown in SEQ ID NO: 334;

[0123] (8) The sense chain has the sequence shown in SEQ ID NO: 229; the antisense chain has the sequence shown in SEQ ID NO: 335;

[0124] (9) The sense chain has a sequence as shown in SEQ ID NO: 245; the antisense chain has a sequence as shown in SEQ ID NO: 351.

[0125] In some embodiments, the oligonucleotide has alternating fluorine-oxygen modification or template modification.

[0126] In some embodiments, phosphorylation of the 5' carbon atom of the modified antisense 5'-terminal nucleotide glycoside includes, but is not limited to, the following 5'-phosphorylating groups: 5'-vinylphosphonate group (5'-E-VP), 5'-methylphosphonate group (5'-MP), 5'-C-methylphosphate group, 5'-thiophosphate group (5'-PS), and 5'-phosphate group (5'-P). The modified nucleotide structure is illustrated below:

[0127] ;

[0128] Where R represents hydrogen, hydroxyl, amino, or C. 1-4 Alkyl, aromatic, C 1-4 Alkoxy, C 1-4 Alkyl carbonyl amino or halogen;

[0129] The bases are selected from any one of adenine, guanine, cytosine, thymine, and uracil.

[0130] In some implementations, the antisense strand of the siRNA modifier has any one of the following modification methods A to H:

[0131]

[0132]

[0133] And / or, the justice chain adopts any of the following modifications:

[0134]

[0135] Where 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; 2'-Deoxy represents 2'-deoxy; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

[0136] In some implementations, the antisense chain is modified by modification method A, and the justice chain is modified by modification method a.

[0137] In some implementations, the antisense chain is modified by modification method B, and the justice chain is modified by modification method a.

[0138] In some implementations, the antisense chain is modified by modifier C, and the justice chain is modified by modifier a.

[0139] In some implementations, the antisense chain is modified by modifier C, and the justice chain is modified by modifier b.

[0140] In some implementations, the antisense chain is modified by modifier D, and the justice chain is modified by modifier b.

[0141] In some implementations, the antisense chain is modified by modifier E, and the justice chain is modified by modifier b.

[0142] In some implementations, the antisense chain is modified by modifier F, and the justice chain is modified by modifier b.

[0143] In some implementations, the antisense chain is modified by the modifier G, and the justice chain is modified by the modifier b.

[0144] In some implementations, the antisense chain is modified with the modifier H, and the justice chain is modified with the modifier c.

[0145] In some implementations, the antisense strand of the siRNA modifier has any one of the following modifications A' to G':

[0146]

[0147]

[0148]

[0149] And / or, the justice chain is modified in the following manner: a' or b':

[0150]

[0151] Where 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; 2'-Deoxy represents 2'-deoxy; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

[0152] In some implementations, the antisense chain is modified by the modifier A', and the justice chain is modified by the modifier a'.

[0153] In some implementations, the antisense chain is modified by modifier B', and the justice chain is modified by modifier a'.

[0154] In some implementations, the antisense chain is modified by the modifier C', and the justice chain is modified by the modifier a'.

[0155] In some implementations, the antisense chain is modified by modifier C', and the justice chain is modified by modifier b'.

[0156] In some implementations, the antisense chain is modified by the modifier D', and the justice chain is modified by the modifier b'.

[0157] In some implementations, the antisense chain is modified by the modifier E', and the justice chain is modified by the modifier b'.

[0158] In some implementations, the antisense chain is modified by the modifier F', and the justice chain is modified by the modifier b'.

[0159] In some implementations, the antisense chain is modified by the modifier G', and the justice chain is modified by the modifier b'.

[0160] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes composed of sense and antisense strand pairings:

[0161] (1) The sense chain has the sequence shown in SEQ ID NO: 426; and the antisense chain has the sequence shown in SEQ ID NO: 552;

[0162] (2) The sense chain has the sequence shown in SEQ ID NO: 427; and the antisense chain has the sequence shown in SEQ ID NO: 553;

[0163] (3) The sense chain has a sequence as shown in SEQ ID NO: 429; and the antisense chain has a sequence as shown in SEQ ID NO: 555;

[0164] (4) The sense chain has the sequence shown in SEQ ID NO: 430; and the antisense chain has the sequence shown in SEQ ID NO: 556;

[0165] (5) The sense chain has the sequence shown in SEQ ID NO: 431; and the antisense chain has the sequence shown in SEQ ID NO: 557;

[0166] (6) The sense chain has the sequence shown in SEQ ID NO: 435; and the antisense chain has the sequence shown in SEQ ID NO: 561;

[0167] (7) The sense chain has the sequence shown in SEQ ID NO: 439; and the antisense chain has the sequence shown in SEQ ID NO: 565;

[0168] (8) The sense chain has the sequence shown in SEQ ID NO: 440; and the antisense chain has the sequence shown in SEQ ID NO: 566;

[0169] (9) The sense chain has the sequence shown in SEQ ID NO: 442; and the antisense chain has the sequence shown in SEQ ID NO: 568;

[0170] (10) The sense chain has the sequence shown in SEQ ID NO: 443; and the antisense chain has the sequence shown in SEQ ID NO: 569;

[0171] (11) The sense chain has the sequence shown in SEQ ID NO: 444; and the antisense chain has the sequence shown in SEQ ID NO: 570;

[0172] (12) The sense chain has the sequence shown in SEQ ID NO: 445; and the antisense chain has the sequence shown in SEQ ID NO: 571;

[0173] (13) The sense chain has the sequence shown in SEQ ID NO: 446; and the antisense chain has the sequence shown in SEQ ID NO: 572;

[0174] (14) The sense chain has the sequence shown in SEQ ID NO: 447; and the antisense chain has the sequence shown in SEQ ID NO: 573;

[0175] (15) The sense chain has the sequence shown in SEQ ID NO: 448; and the antisense chain has the sequence shown in SEQ ID NO: 574;

[0176] (16) The sense chain has the sequence shown in SEQ ID NO: 449; and the antisense chain has the sequence shown in SEQ ID NO: 575;

[0177] (17) The sense chain has the sequence shown in SEQ ID NO: 450; and the antisense chain has the sequence shown in SEQ ID NO: 576;

[0178] (18) The sense chain has the sequence shown in SEQ ID NO: 454; and the antisense chain has the sequence shown in SEQ ID NO: 580;

[0179] (19) The sense chain has the sequence shown in SEQ ID NO: 455; and the antisense chain has the sequence shown in SEQ ID NO: 581;

[0180] (20) The sense chain has the sequence shown in SEQ ID NO: 456; and the antisense chain has the sequence shown in SEQ ID NO: 582;

[0181] (21) The sense chain has the sequence shown in SEQ ID NO: 468; and the antisense chain has the sequence shown in SEQ ID NO: 594;

[0182] (22) The sense chain has the sequence shown in SEQ ID NO: 471; and the antisense chain has the sequence shown in SEQ ID NO: 597;

[0183] (23) The sense chain has the sequence shown in SEQ ID NO: 477; and the antisense chain has the sequence shown in SEQ ID NO: 603;

[0184] (24) The sense chain has the sequence shown in SEQ ID NO: 478; and the antisense chain has the sequence shown in SEQ ID NO: 604;

[0185] (25) The sense chain has the sequence shown in SEQ ID NO: 479; and the antisense chain has the sequence shown in SEQ ID NO: 605;

[0186] (26) The sense chain has the sequence shown in SEQ ID NO: 480; and the antisense chain has the sequence shown in SEQ ID NO: 606;

[0187] (27) The sense chain has the sequence shown in SEQ ID NO: 529; and the antisense chain has the sequence shown in SEQ ID NO: 655;

[0188] (28) The sense chain has the sequence shown in SEQ ID NO: 530; and the antisense chain has the sequence shown in SEQ ID NO: 656;

[0189] (29) The positive chain has a sequence as shown in SEQ ID NO: 532; and the negative chain has a sequence as shown in SEQ ID NO: 658.

[0190] In some embodiments, the nucleotides from position 2 to position 8 of the antisense strand starting from the 5' end are each independently modified nucleotides, wherein the modified nucleotides are UNA or GNA; or, the nucleotides from position 2 to position 8 of the antisense strand starting from the 5' end are each independently DNA, wherein the structures of UNA and GNA are as follows:

[0191]

[0192] The bases are selected from any one of adenine, guanine, cytosine, thymine, and uracil.

[0193] In some embodiments, the 3' end of the sense or antisense strand is a reverse-modified nucleotide, or the 6th or 7th nucleotide at the 5' end of the sense strand is a reverse-modified nucleotide, wherein the modified nucleotide is selected from dAinV, dTinV, dGinV, and dCinV with the following structures:

[0194]

[0195] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes composed of sense and antisense strand pairings:

[0196] (1) The positive chain has the sequence shown in SEQ ID NO: 677; and the negative chain has the sequence shown in SEQ ID NO: 686;

[0197] (2) The sense chain has the sequence shown in SEQ ID NO: 678; and the antisense chain has the sequence shown in SEQ ID NO: 687;

[0198] (3) The sense chain has a sequence as shown in SEQ ID NO: 683; and the antisense chain has a sequence as shown in SEQ ID NO: 693;

[0199] (4) The positive chain has a sequence as shown in SEQ ID NO: 680; and the negative chain has a sequence as shown in SEQ ID NO: 689.

[0200] The double-stranded ribonucleic acid (BRNA) and its modified counterparts disclosed herein can optionally be linked to one or more conjugating groups to form a BRNA conjugate. The conjugating group can be attached to the sense strand, antisense strand, or both strands at the 3' end, 5' end, or both ends. For example, the conjugating group can be attached to the sense strand. In a preferred embodiment, the conjugating group is attached to the 3' end of the sense strand. In one embodiment, the conjugating group has any GalNAc structure.

[0201] This disclosure provides an siRNA conjugate comprising a double-stranded siRNA as described herein, and a conjugation group attached to the double-stranded siRNA.

[0202] In some embodiments, the conjugation group is attached to the 3'-end or 5'-end of the positive chain, preferably to the 3'-end.

[0203] In some embodiments, the conjugating group is one or more GalNAc or derivatives thereof attached using divalent or trivalent branched connecting arms.

[0204] Typically, the conjugation group comprises at least one pharmaceutically acceptable target group, or further comprises a linker, and the siRNA, the linker, and the target group are sequentially linked. In some embodiments, there are 1-6 target groups. In some embodiments, there are 2-4 target groups. In some embodiments, there are 3 target groups. The conjugation group can be covalently or non-covalently linked to the siRNA molecule, and the linking site can be at the 3' or 5' end of the siRNA's sense strand, at the 5' end of the antisense strand, or within the siRNA's internal sequence. In some embodiments, the linking site is at the 3' end of the siRNA's sense strand.

[0205] In some implementations, the pharmaceutically acceptable targeting group may be a conventional ligand in the field of siRNA delivery, such as the various ligands described in WO2009082607A2, which are incorporated herein by reference in their entirety.

[0206] In some embodiments, each ligand is independently selected from a ligand capable of binding to a cell surface receptor. In some embodiments, at least one ligand is capable of binding to a hepatocyte surface receptor. In some embodiments, at least one ligand is capable of binding to a mammalian cell surface receptor. In some embodiments, at least one ligand is capable of binding to a human hepatocyte surface receptor. In some embodiments, at least one ligand is capable of binding to the liver surface desialylate glycoprotein receptor (ASGPR). The types of these ligands are well known to those skilled in the art, and their function is generally to bind to specific receptors on the surface of target cells, mediating the delivery of ligand-linked siRNA to the target cells.

[0207] In some embodiments, the pharmaceutically acceptable targeting group in the siRNA conjugate can be galactose or N-acetylgalactosamine, wherein the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent. That is, after the siRNA molecule forms an siRNA conjugate with a conjugate group containing a galactose or N-acetylgalactosamine molecule as a targeting group, the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate is 1:1, 1:2, 1:3, or 1:4. In some embodiments, when the siRNA is conjugated with a conjugate group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0208] The targeting group can be linked to the siRNA molecule via a suitable adapter. Those skilled in the art can select a suitable adapter based on the specific type of the targeting group. For details on these adapters, the types of targeting groups, and the connection methods with siRNA, please refer to the disclosure of WO2015006740A2, which is incorporated herein by reference in its entirety.

[0209] In some embodiments, the structure of the conjugating group is, for example:

[0210] ,

[0211] Wherein, X is a hydroxyl protecting group or H, the hydroxyl protecting group being selected from acetyl, benzoyl or isobutyryl; Y is an amine protecting group or H, the amine protecting group being selected from formyl, acetyl, propionyl, n-butyryl or isobutyryl; n is an integer from 0 to 20; q, r and s are independently integers from 1 to 7.

[0212] In some embodiments, the structure of the conjugating group is, for example:

[0213] .

[0214] In some embodiments, the structure of the conjugating group is, for example:

[0215]

[0216] Where X is oxygen, -N(Y)-, or sulfur;

[0217] Y is C 1-4 Alkyl or C 6-10 Aryl;

[0218] R1 is oxygen or sulfur;

[0219] R2 represents hydrogen, -NH2, or C. 1-4 Alkyl, C 6-10 Aryl, C 1-4 Alkoxy or halogen;

[0220] A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d - where a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5;

[0221] B is -(CH2) e -, where e is an integer between 0 and 7;

[0222] L is either -CONH- or -NHCO-;

[0223] X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5;

[0224] X2 is -(CH2) g - g is an integer from 1 to 6;

[0225] X3 is oxygen or sulfur;

[0226] Y1 is either 0 or 1;

[0227] Y2 is 0, 1, or 2;

[0228] When Y3 is 1, X4 is CH2; when Y3 is 2, X4 is CH; when Y3 is 3, X3 is carbon.

[0229] m is an integer between 0 and 4;

[0230] n is an integer between 0 and 4.

[0231] In some embodiments, the conjugating group has, for example, any of the following structures:

[0232] ,

[0233] ,

[0234] ,or

[0235] .

[0236] In some embodiments, the siRNA conjugate has, for example, any of the following structures:

[0237] ,

[0238] ,

[0239] ,

[0240] ,and

[0241] .

[0242] In some embodiments, the conjugating group has, for example, the following structure:

[0243]

[0244] Where X is oxygen, -N(Y)-, or sulfur;

[0245] Y is C 1-4 Alkyl or C 6-10 Aromatic group;

[0246] R1 is oxygen or sulfur;

[0247] R2 represents hydrogen, -NH2, or C. 1-4 Alkyl, C 6-10 Aryl, C 1-4 Alkoxy or halogen;

[0248] A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d - where a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5;

[0249] B is -(CH2) e -, where e is an integer between 0 and 7;

[0250] L is either -CONH- or -NHCO-;

[0251] X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5;

[0252] X2 is -(CH2) g - g is an integer from 1 to 6;

[0253] X3 is oxygen or sulfur;

[0254] Y1 is either 0 or 1;

[0255] Y2 is 0, 1, or 2;

[0256] When Y3 is 1, X4 is CH2; when Y3 is 2, X4 is CH; when Y3 is 3, X3 is carbon.

[0257] m is an integer between 0 and 4;

[0258] n is an integer between 0 and 4;

[0259] q is an integer between 0 and 4.

[0260] In some embodiments, the conjugating group has, for example, any of the following structures:

[0261] , , , ,and .

[0262] In some embodiments, the siRNA conjugates of this disclosure have, for example, any of the following structures:

[0263] ,

[0264] ,

[0265] ,

[0266] ,or

[0267] .

[0268] In some embodiments, the conjugation group is G101.

[0269] In some embodiments, the siRNA conjugate comprises any one or a combination of at least two of the following oligonucleotide duplexes composed of sense and antisense strand pairings:

[0270] (1) The positive chain has a sequence as shown in SEQ ID NO: 695; and the negative chain has a sequence as shown in SEQ ID NO: 732;

[0271] (2) The sense chain has the sequence shown in SEQ ID NO: 706; and the antisense chain has the sequence shown in SEQ ID NO: 743;

[0272] (3) The positive chain has the sequence shown in SEQ ID NO: 707; and the negative chain has the sequence shown in SEQ ID NO: 744;

[0273] (4) The sense chain has the sequence shown in SEQ ID NO: 708; and the antisense chain has the sequence shown in SEQ ID NO: 745;

[0274] (5) The sense chain has the sequence shown in SEQ ID NO: 710; and the antisense chain has the sequence shown in SEQ ID NO: 747;

[0275] (6) The sense chain has the sequence shown in SEQ ID NO: 713; and the antisense chain has the sequence shown in SEQ ID NO: 750;

[0276] (7) The sense chain has the sequence shown in SEQ ID NO: 714; and the antisense chain has the sequence shown in SEQ ID NO: 751;

[0277] (8) The sense chain has the sequence shown in SEQ ID NO: 715; and the antisense chain has the sequence shown in SEQ ID NO: 752;

[0278] (9) The sense chain has the sequence shown in SEQ ID NO: 719; and the antisense chain has the sequence shown in SEQ ID NO: 756;

[0279] (10) The sense chain has the sequence shown in SEQ ID NO: 720; and the antisense chain has the sequence shown in SEQ ID NO: 757;

[0280] (11) The sense chain has the sequence shown in SEQ ID NO: 721; and the antisense chain has the sequence shown in SEQ ID NO: 758;

[0281] (12) The sense chain has the sequence shown in SEQ ID NO: 722; and the antisense chain has the sequence shown in SEQ ID NO: 759;

[0282] (13) The sense chain has the sequence shown in SEQ ID NO: 723; and the antisense chain has the sequence shown in SEQ ID NO: 760;

[0283] (14) The sense chain has the sequence shown in SEQ ID NO: 724; and the antisense chain has the sequence shown in SEQ ID NO: 761;

[0284] (15) The sense chain has the sequence shown in SEQ ID NO: 725; and the antisense chain has the sequence shown in SEQ ID NO: 762;

[0285] (16) The sense chain has the sequence shown in SEQ ID NO: 728; and the antisense chain has the sequence shown in SEQ ID NO: 765;

[0286] (17) The positive chain has a sequence as shown in SEQ ID NO: 729; and the negative chain has a sequence as shown in SEQ ID NO: 766.

[0287] This disclosure also provides a nucleic acid protein complex comprising the double-stranded region of the aforementioned siRNA double strand or siRNA conjugate or the antisense strand of the double-stranded region, and a nuclease.

[0288] In this disclosure, the term "nucleic acid-protein complex" refers to the RNA-induced silencing complex (RISC) formed by the binding of siRNA to Argonaute protein (AGO). The siRNA is then unwound into a sense strand and an antisense strand. The sense strand is degraded, and the antisense strand (guide strand) RISC binds to a target mRNA homologous to the siRNA via base pairing. The RISC functions as a nuclease; the siRNA guides the RISC to cleave the homologous single-stranded mRNA, causing the mRNA to lose its function, i.e., it cannot be translated to produce protein, thus silencing the gene.

[0289] This disclosure also provides a recombinant vector comprising a nucleic acid molecule encoding siRNA as described herein.

[0290] In some embodiments, the vector backbone of the recombinant vector is selected from recombinant viroid-derived circular RNA vectors, tRNA, rRNA scaffolds, and chimeric tRNA / pre-miRNA vectors.

[0291] This disclosure also provides a recombinant cell comprising the aforementioned siRNA or recombinant vector.

[0292] In some embodiments, the recombinant cells are selected from *Pseudomonas thiophile* and *Corynebacterium glutamicum* deficient in ribonuclease III.

[0293] As used herein, a “recombinant vector” is preferably a vector comprising a regulatory sequence operatively linked to a nucleotide sequence encoding the positive strand contained in the nucleic acid molecule of the present invention. A “recombinant cell” is a cell in which at least one recombinant vector capable of expressing a nucleic acid molecule or at least one strand of such nucleic acid molecule has been introduced.

[0294] This disclosure also provides a method for preparing the siRNA described herein, the method comprising culturing the aforementioned recombinant cells, or directly obtaining the siRNA by chemical synthesis and mixing.

[0295] This disclosure also provides a pharmaceutical composition comprising the said siRNA duplex or corresponding siRNA conjugate, and a pharmaceutically acceptable carrier.

[0296] In one embodiment, a pharmaceutical composition comprising siRNA as described herein and a pharmaceutically acceptable carrier is provided herein. The siRNA-containing pharmaceutical composition can be used to treat diseases or conditions associated with the expression or activity of the FXI gene, such as hypertension. Such pharmaceutical compositions are formulated based on delivery models. One example is a composition formulated for systemic administration via parenteral delivery, such as subcutaneous injection (SC). Another example is a composition formulated for direct delivery to the brain parenchyma, such as by infusion into the brain, for example, via a continuous pump infusion.

[0297] Pharmaceutical compositions comprising the siRNA disclosed herein may be, for example, solutions with or without a buffer solution or compositions containing a pharmaceutically acceptable carrier. Such compositions include, for example, aqueous or crystalline compositions, liposome formulations, micellar formulations, emulsions, and gene therapy carriers.

[0298] In the method disclosed herein, the siRNA can be administered in a solution. A free siRNA can be administered in a non-buffered solution, such as physiological saline or water. Alternatively, the free siRNA can also be administered in a suitable buffered solution. The buffer solution may include acetate, citrate, alcohol-soluble gluten, carbonate, or phosphate, or any combination thereof. In a preferred embodiment, the buffer solution is phosphate-buffered saline (PBS). The pH and volumetric molar osmotic concentration of the buffer containing the siRNA can be adjusted to suit its administration to the subject.

[0299] In some embodiments, the buffer solution further comprises a reagent for controlling the molar osmotic pressure concentration of the solution, such that the molar osmotic pressure concentration is maintained at a desired value, such as the physiological value in human plasma. Solutes that may be added to the buffer solution to control the molar osmotic pressure concentration include (but are not limited to) proteins, peptides, amino acids, non-metabolitic polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the reagent for controlling the molar osmotic pressure concentration of the solution is a salt. In some embodiments, the reagent for controlling the molar osmotic pressure concentration of the solution is sodium chloride or potassium chloride.

[0300] The pharmaceutical compositions disclosed herein can be administered at a dose sufficient to inhibit the expression of the FXI gene. Typically, the suitable dose of the siRNA disclosed herein is in the range of about 0.001 to about 200.0 mg per kilogram of body weight per day, generally in the range of about 1 to 50 mg per kilogram of body weight per day. For example, siRNA (e.g., dsRNA) can be administered at doses of about 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3. 5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7. 7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or approximately 50 mg / kg.

[0301] The pharmaceutical composition can be administered once daily, or multiple times at different time intervals from 1 to 365 days, or the siRNA can be administered two, three, or more sub-dose at appropriate intervals within a year, or even administered via continuous infusion or delivery using a controlled-release formulation. In this case, the amount of siRNA contained in each sub-dose must be correspondingly less to achieve the total daily dose. Dosage units can also be compounded for delivery over several days, for example using conventional sustained-release formulations that provide sustained siRNA release over a timeframe of several days. Sustained-release formulations are well known in the art and are particularly useful for delivering reagents at specific sites, thus allowing their use with the reagents disclosed herein. In this embodiment, the dosage unit comprises a corresponding plurality of daily doses.

[0302] In other embodiments, a single dose of the pharmaceutical composition can be administered continuously, with subsequent doses given at intervals of no more than 3, 4, or 5 days, or at intervals of no more than 1, 2, 3, or 4 weeks. In some embodiments of this disclosure, a single dose of the pharmaceutical composition of this disclosure is given weekly. In other embodiments of this disclosure, a single dose of the pharmaceutical composition of this disclosure is given every two months.

[0303] Those skilled in the art will understand that certain factors can influence the dosage and timing required to effectively treat a subject, including (but not limited to) the severity of the disease or condition, previous treatments, the subject's overall health and / or age, and other pre-existing conditions. Furthermore, treating a subject with a therapeutically effective dose of the composition may comprise a single treatment or a series of treatments. As described elsewhere herein, the effective dose and in vivo half-life of the individual siRNAs covered by this disclosure can be estimated using conventional methods or based on in vivo testing using suitable animal models.

[0304] Depending on whether local or systemic treatment is desired and depending on the area to be treated, the pharmaceutical compositions of this disclosure can be administered in a variety of ways. Administration can be local (e.g., via a skin patch); pulmonary; such as by inhalation or blowing in a powder or aerosol, including via a nebulizer; intratracheal; intranasal; epidermal; and percutaneous, oral, or parenteral administration. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal, for example, via an implanted device; or intracranial, such as administration within the brain parenchyma, intrasheath, or ventricle.

[0305] The siRNA used in the compositions and methods of this disclosure can be formulated for delivery in membrane-bound molecular assemblies, such as liposomes or micelles. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids disposed in at least one lipid bilayer (e.g., one or more lipid bilayers), having an outer membrane formed of a lipophilic material and an aqueous portion located within. This lipophilic material separates the aqueous interior from the aqueous exterior (although in some instances it may include) of the composition, which typically does not contain siRNA. Liposomes are useful for the transfer and delivery of active ingredients to sites of action. Because the liposome membrane is structurally similar to a biological membrane, when a liposome is applied to a tissue, the liposome bilayer fuses with the cell membrane bilayer. As the liposome fuses with the cell, the aqueous contents, including the siRNA, are delivered into the cell, where the siRNA can specifically bind to a target RNA and can mediate RNA interference (RNAi).

[0306] Liposomes containing siRNA can be prepared by a variety of methods. In one example, the lipid component of the liposome is dissolved in a detergent to form micelles. For example, the lipid component can be an amphiphilic cationic lipid or a lipid conjugate. The detergent can have a high critical micelle concentration and can be nonionic. Exemplary detergents include bile salts, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. The siRNA formulation is then added to micelles containing the lipid component. The cationic groups on the lipid interact with the siRNA and condense around the siRNA to form liposomes. After condensation, the detergent is removed, for example by dialysis, to obtain the corresponding liposome formulation of the siRNA.

[0307] siRNA, such as the siRNA duplex disclosed herein, can be completely encapsulated in lipid formulations (e.g., LNPs or other nucleic acid-lipid particles).

[0308] As used herein, the term "LNP" refers to a stable nucleic acid-lipid particle. An LNP contains a cationic lipid, a non-cationic lipid, and a lipid that prevents the particle from aggregating (e.g., a PEG-lipid conjugate). LNPs are extremely useful for synthetic applications because they exhibit prolonged cycle life after intravenous (iv) injection and accumulate at distal sites (e.g., at sites physically separate from the administration site).

[0309] In one embodiment, the mass ratio of lipids to siRNA duplex is about 1:1 to about 50:1, about 1:1 to about 25:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1.

[0310] In some preferred embodiments, the lipid nanoparticles include cationic lipids, neutral lipids, structural lipids, and polymer-conjugated lipids.

[0311] In some preferred embodiments, the cationic lipid is a compound of formula (I), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein G1 is C 1~6 Alkylene; G2 is C 2~8 Alkylene; G3 is C 1~3 Alkylene; L1 is C 6~15 Straight-chain alkyl; L2 is C 12~25 Branched alkyl groups. For example, YK-009 of formula (II) (see patent CN114044741B, the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds therein).

[0312] (I)

[0313] (II)

[0314] In some preferred embodiments, the cationic lipid is a compound of formula (II), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein: G1 is C 2~8 Alkylene; G2 is C 2~8 Alkylene; L1 is -C(O)O- or -OC(O)-; L2 is -C(O)O- or -OC(O)-; R1 is C 6~25 Straight-chain or branched alkyl; R2 is C 6~25 Straight-chain or branched alkyl; G3 is HO(CH2)2- or HO(CH2)3-; G4 is HO(CH2)2- or HO(CH2)3-; L is (CH2)2- or -(CH2)3- or -(CH2)4-. For example, YK-401 with formula (II-I), YK-402 with formula (II-II), YK-407 with formula (II-III), etc. (see patent CN115784921B, the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds therein).

[0315] (II)

[0316] (II-I)

[0317] (II-II)

[0318] (II-III)

[0319] In some preferred embodiments, the cationic lipid is a compound of formula (III), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein: G1 is C 1~6 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~20 Straight-chain or branched alkyl; R2 is C 12~25 Branched alkyl groups; G3 is: HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2-, (HO(CH2)2)2N(CH2)2-, CH3O(CH2)2N(CH3)(CH2)2-, (CH3)2N(CH2)3SC(O)O(CH2)2-, (CH3)2N(CH2)3SC(O)-, CH3NH(CH2)2N(CH3)(CH2)2-, or CH3CH2NH(CH2)2-. For example, YK-201 with formula (III-I) structure, YK-202 with formula (III-II) structure, etc. (see patent CN115677518B, the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds therein).

[0320] (III)

[0321] (III-I)

[0322] (III-II)

[0323] In some preferred embodiments, the cationic lipid is a compound of formula (IV), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein G1 is C 1~8 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~25 Straight-chain or branched alkyl; R2 is C 12~25 Straight-chain or branched alkyl group; G3 is: HO(CH2)2N(R3)CH2CH(OH)CH2-, where R3 is -CH3, -CH2CH3, or -CH2CH2OH. For example, YK-305 with formula (IV-I) and YK-310 with formula (IV-II) (see patent CN115745820B, the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds therein).

[0324] (IV)

[0325] (IV-I)

[0326] (IV-II)

[0327] In some preferred embodiments, the cationic lipid is a compound of formula (V), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein G 1 and G 2 Each is independently unsubstituted C6-C 10 Alkylene; G 3 For unsubstituted C1-C 12 Alkylene; R 1 and R 2 Each independently is C6-C 24 Alkyl or C6-C 24 alkenyl; R 3 OR 5 N, -C (=O) OR 4 -OC(=O)R 4 or -NR 5 C(=O)R 4 ;R 4 For C1-C 12 hydrocarbon group; and R 5 It is an H or C1-C6 hydrocarbon group; for example, ALC0315 of formula (VI) (see patent CN108368028B, the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds therein).

[0328] (V)

[0329] (VI)

[0330] In some preferred embodiments, the cationic lipid is a compound of formula (VI), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein R4 is selected from -(CH2). n Q and -(CH2) n CHQR; Q is selected from the following groups: -OR, -OH, -O(CH2). nN(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), -N(R)S(O)2R8 and heterocycles; n is 1, 2 or 3; for example, SM102 of formula (VI-I) (see patent application CN110520409A, the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds therein).

[0331] (VI)

[0332] (VI-I)

[0333] In some preferred embodiments, the cationic lipid is a compound of formula (VII), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer (see patent CN102625696B, DLIN-MC3-DMA (as shown in formula (VII)), the entire contents of which are incorporated herein by reference, including, in particular, the general formula and specific compounds thereof).

[0334] (VII)

[0335] In some preferred embodiments, the cationic lipid is selected from any one or a combination of at least two of the group consisting of YK-009, YK-407, YK-305, ALC0315, SM102 and DLIN-MC3-DMA.

[0336] In some preferred embodiments, the molar ratio of the cationic lipid to the neutral lipid is 1:1 to 10:1.

[0337] In some preferred embodiments, the molar ratio of the cationic lipid to the structural lipid is 1:1 to 5:1.

[0338] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25~65):(5~25):(25~70):(0.5~5).

[0339] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25~65):(5~25):(25~45):(0.5~5).

[0340] In some more preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is 50:10:38.5:1.5 or 49:10:39.5:1.5.

[0341] In some preferred embodiments, the neutral lipid is selected from any one or a combination of at least two of the group consisting of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterols and their derivatives.

[0342] In some preferred embodiments, the neutral lipid is selected from any one or a combination of at least two of the following: 1,2-dilinoleoyl-sn-glycerol-3-phosphate choline (DLPC), 1,2-dimyristoyl-sn-glycerol-3-phosphate choline (DMPC), 1,2-dioleoyl-sn-glycerol-3-phosphate choline (DOPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphate choline (DPPC), 1,2-distearateoyl-sn-glycerol-3-phosphate choline (DSPC), 1,2-diundecanoyl-sn-glycerol-3-phosphate choline (DUPC), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate choline (POPC), 1,2-di-O-octadecenyl-sn-glycerol-3-phosphate choline (18:0 Diether 1,2-Dilinoleoyl-sn-glycerol-3-phosphate choline (OChemsPC), 1-hexadecyl-sn-glycerol-3-phosphate choline (C16 Lyso PC), 1,2-dilinoleoyl-sn-glycerol-3-phosphate choline, 1,2-disarachidonicoyl-sn-glycerol-3-phosphate choline, 1,2-bis(docohexanoyl-sn-glycerol-3-phosphate choline), 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE), 1,2-diphydanyl-sn-glycerol-3-phosphate ethanolamine (ME) 16.0PE), 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinolenoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-diarachidonicoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-bis(docosahexaenoicoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dioleoyl-sn-glycerol-3-phosphate-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl 1-Steayl-2-oleoyl-stearoyl-ethanolamine (POPE), 1-stearoyl-2-oleoyl-stearoyl-ethanolamine (DSPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl-phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), and mixtures thereof.

[0343] In some preferred embodiments, the neutral lipid is DOPE and / or DSPC.

[0344] In some preferred embodiments, the structural lipid is selected from any or at least a combination of the following: cholesterol, nonsterols, sitosterol, ergosterol, campesterol, stigmasterol, brassosterol, tomatine, ursolic acid, α-tocopherol, and corticosteroids.

[0345] In some preferred embodiments, the structural lipid is cholesterol.

[0346] In some preferred embodiments, the polymeric conjugated lipid is selected from any or a combination of at least two of the following: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol.

[0347] In some preferred embodiments, the polymeric conjugated lipid is selected from any one or more of the following groups, or at least a combination of two: distearylphosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristoylglycerol-3-methoxy polyethylene glycol 2000 (DMG-PEG2000), and methoxy polyethylene glycol bis(tetradecylacetamide) (ALC-0159).

[0348] Examples of pharmaceutical compositions disclosed herein include, but are not limited to, aqueous formulations, emulsion formulations, and liposome-containing formulations. These compositions can be derived from a variety of components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. For example, formulations targeting the liver are preferred when treating liver conditions such as liver cancer.

[0349] The pharmaceutical formulations disclosed herein (which can be conveniently presented in unit dosage forms) can be prepared using conventional techniques well known in the pharmaceutical industry. Such techniques include steps such as combining the active ingredients with the drug carrier or excipient. Generally, these formulations are prepared by uniformly and finely combining the active ingredients with a liquid carrier or a finely dispersed solid carrier, or both, and, if necessary, shaping the product.

[0350] The compositions disclosed herein can be formulated into any of a number of possible dosage forms, including, but not limited to, tablets, capsules, gelatin capsules, liquid syrups, soft capsules, suppositories, and enemas. The compositions disclosed herein can also be formulated as suspensions in aqueous, non-aqueous, or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension, such substances including, for example, sodium carboxymethyl cellulose, sorbitol, and / or dextran. The suspension may also contain stabilizers.

[0351] Some compositions of this disclosure also incorporate a carrier compound into the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid or its analogue that is inert (i.e., not biologically active in itself) but is considered a nucleic acid in vivo, for example by reducing the bioavailability of biologically active nucleic acids by degrading them or promoting their removal from circulation. Co-administration of nucleic acids and carrier compounds (generally in excess of the latter) can result in a significant reduction in the amount of nucleic acid recovered from the liver, kidneys, or other external circulation reservoirs, presumably due to competition for a common receptor between the carrier compound and the nucleic acid. For example, when co-administered with polyinosinic acid, dextran sulfate, polycytidine, or 2,2'-disulfonic acid 4-acetamido-4'-isothiocyanate, the recovery of partially thiophosphorylated dsRNA in liver tissue can be reduced (Miyao et al., DsRNA Research and Development, 1995, 5, 115-121; Takakura et al., DsRNA & Nucleic Acid Drug Development, 1996, 6, 177-183).

[0352] Compared to carrier compounds, a "drug carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent, or other arbitrary pharmaceutically inert medium used to deliver one or more nucleic acids to animals. The excipient can be liquid or solid, and when combined with nucleic acids and other components of a particular pharmaceutical composition, the excipient is selected to provide desired volume, consistency, etc., with reference to the intended manner of administration. Typical drug carriers include, but are not limited to: binders (e.g., pregelatinized corn starch, polyvinylpyrrolidone, or hydroxypropyl methylcellulose); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate, or dicalcium phosphate); lubricants (e.g., magnesium stearate, talc, silica, colloidal silica, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulfate, etc.).

[0353] Pharmaceutically acceptable organic or inorganic excipients that are suitable for non-parenteral administration, do not react toxically with nucleic acids, and are suitable for formulation of the compositions disclosed herein may also be used. Suitable pharmaceutically acceptable carriers include, but are not limited to: water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone, etc.

[0354] Formulations for topical administration of nucleic acids may include sterile or non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohol, or nucleic acid solutions in liquid or solid oil matrices. These solutions may also include buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration and not toxic to nucleic acids may be used.

[0355] Suitable pharmaceutically acceptable excipients include, but are not limited to: water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone, etc.

[0356] This disclosure also provides methods for treating or preventing diseases and conditions that can be regulated by downregulating the expression of the FXI gene. Examples include thrombotic diseases such as deep vein thrombosis, venous or arterial thrombosis, ischemic stroke, pulmonary embolism, myocardial infarction, stroke, Alzheimer's disease, and thrombosis associated with chronic kidney disease or end-stage renal disease.

[0357] The siRNA disclosed herein can be administered to a subject using any administration method known in the art, including (but not limited to) subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combination thereof. In a preferred embodiment, these agents are administered subcutaneously.

[0358] In another embodiment, siRNA is administered in combination with an additional therapeutic agent. The siRNA and the additional therapeutic agent may be administered in combination in the same composition, for example, parenterally, or the additional therapeutic agent may be administered as part of a separate composition or by another method described herein.

[0359] Other examples of therapeutic agents include those known to treat thrombotic disorders or cardiovascular diseases, including, for example, anticoagulants, antiplatelet agents, and thrombolytic agents for acute myocardial infarction and pulmonary embolism, as well as other drugs. Anticoagulants include warfarin, heparin, low molecular weight heparin (such as enoxaparin), and direct oral anticoagulants (such as dabigatran, rivaroxaban, apixaban, and edoxaban); antiplatelet agents include aspirin, clopidogrel, ticagrelor, and prasugrel; thrombolytic agents for acute myocardial infarction and pulmonary embolism include alteplase, tenecteplase, and streptokinase; other drugs include fondaparinux sodium and bivalirudin.

[0360] In one embodiment, siRNA is given to the patient, and then another therapeutic agent is given to the patient (or vice versa). In another embodiment, siRNA and another therapeutic agent are given simultaneously.

[0361] The following examples are used to illustrate this disclosure, but are not intended to limit the scope of this disclosure. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0362] The nucleotide abbreviations for this article are as follows:

[0363] A = Adenosine-3'-phosphate

[0364] Am = 2'-methoxyadenosine-3'-phosphate

[0365] Ams = 2'-methoxyadenosine-3'-thiophosphate

[0366] Af = 2'-Fluoroadenosine-3'-phosphate

[0367] Afs = 2'-Fluoroadenosine-3'-Thiophosphate

[0368] dA = 2'-deoxyadenosine-3'-phosphate

[0369] dAs = 2'-deoxyadenosine-3'-thiophosphate

[0370] G = Guanosine-3'-phosphate

[0371] Gm = 2'-methoxyguanosine-3'-phosphate

[0372] Gms = 2'-methoxyguanosine-3'-thiophosphate

[0373] Gf=2'-Fluoroguanosine-3'-phosphate

[0374] Gfs = 2'-Fluoroguanosine-3'-Thiophosphate

[0375] dG = 2'-deoxyguanosine-3'-phosphate

[0376] dGs = 2'-deoxyguanosine-3'-thiophosphate

[0377] C=cytidine-3'-phosphate

[0378] Cm = 2'-methoxycytidine-3'-phosphate

[0379] Cms = 2'-methoxycytidine-3'-thiophosphate

[0380] Cf = 2'-Fluorocytidine-3'-phosphate

[0381] Cfs = 2'-Fluorocytidine-3'-Thiophosphate

[0382] dC = 2'-deoxycytidine-3'-phosphate

[0383] dCs = 2'-deoxycytidine-3'-thiophosphate

[0384] U = uridine-3'-phosphate

[0385] Um = 2'-methoxyuridine-3'-phosphate

[0386] Ums = 2'-methoxyuridine-3'-thiophosphate

[0387] Uf = 2'-fluorouridine-3'-phosphate

[0388] Ufs = 2'-fluorouridine-3'-thiophosphate

[0389] dT = 2'-deoxyadenosine-3'-phosphate

[0390] dTs = 2'-deoxyadenosine-3'-thiophosphate

[0391] AmsEVP = 5'-vinyl-(E)-phosphonate-2'-methoxyadenosine-3'-thiophosphate

[0392] UmsEVP = 5'-vinyl-(E)-phosphonate-2'-methoxyuridine-3'-thiophosphate

[0393] dAinV=(3'-3' linker) 2'-deoxyadenosine-3'-phosphate

[0394] dTinV = (3'-3' linker) 2'-deoxythymidine-3'-phosphate

[0395] Agna = Adenosine-diol nucleic acid

[0396] Cgna = Cytidine-diol nucleic acid

[0397] Ggna = Guanosine-diol nucleic acid

[0398] Tgna = Thymidine-diol nucleic acid

[0399] Ugna = uridine-diol nucleic acid

[0400] Examples of the code rules for siRNA motifs (or motifs), siRNA modifications, siRNA conjugates, etc., in this article are as follows:

[0401] The motif is an unmodified RNA sequence. Compared to sequences with 21 / 23 base lengths for the positive and negative strands, sequences with 20 / 22 base lengths for the positive and negative strands are distinguished by adding "s" after the position number, such as compound B00211s.

[0402] Sequences with alternating modifications of 2'-methoxy (2'-OMe) and 2'-fluorine (2'-F) are designated with "-AL" appended to the motif number. For example, the code for the alternatingly modified compound B00211 is B00211-AL.

[0403] For example, the siRNA modifiers appearing in Table 7 of Example 1 were modified using the modification templates DV25P, DV26P, DV27P, DV29P, DV32P, DV34P, DV39P, DV40P, DV25SP, DV26SP, DV27SP, DV29SP, DV32SP, DV34SP, DV39SP, and DV40SP disclosed herein. The corresponding designation rule is as follows: the first letter of the designation of the corresponding siRNA motif of the siRNA modifier is changed from "B" to "C", and the corresponding template name of the siRNA modifier is added after the designation. For example, the B00211 sequence modified using the DV25P template is designated C00211-DV25P.

[0404] For example, the siRNA modifiers in Table 8 of Example 1 involve the use of the modification template disclosed herein, and may further employ off-target prevention and / or reverse insertion modification methods. The corresponding designation rule is as follows: the first letter of the designation of the corresponding motif of the siRNA modifier is changed from "B" to "C", and the corresponding template name and / or off-target prevention / reverse insertion modification name (if present) are added sequentially after the designation. For example, for motif B00211, the designation of the modifier obtained after modification with DV25P template and reverse insertion modification InV is C00211-DV25PInVG101.

[0405] For example, the siRNA conjugates appearing in Table 8 of Example 1 involve the use of the modification templates disclosed herein, and may further employ off-target prevention or reverse modification methods. For siRNA modifiers containing reverse modification on the positive strand, a conjugate group is attached to the 5' end of the positive strand; for siRNA modifiers without reverse modification, a conjugate group is attached to the 3' end of the positive strand. The designation rule is to change the first letter of the corresponding motif's designation from "B" to "D", and sequentially add the corresponding template name and the off-target prevention / reverse modification name (if present) after the designation, and add the conjugate group name such as "G103", "G101", etc., at the end. For example, for motif B00211, the conjugate obtained after modification with the DV25P template and reverse modification with InV, and attachment of the conjugate group G101, is designated as D00211-DV25PInVG101. See the table below for examples of designations.

[0406] Examples of siRNA double-stranded (motif, modification, conjugate) designations in this disclosure

[0407]

[0408] Example

[0409] Other objects, features, and advantages of this disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific embodiments (although illustrating specific implementations of this disclosure) are given for illustrative purposes only, as various changes and modifications that can be made within the spirit and scope of this disclosure will become apparent to those skilled in the art upon reading this detailed description.

[0410] Unless otherwise specified, the experimental techniques and methods used in this embodiment are conventional techniques and methods. For example, experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the embodiments are commercially available.

[0411] Those skilled in the art will understand that, in the various embodiments of this disclosure, when the test substance in the experiment is an siRNA conjugate, it includes, but is not limited to, inhibition rate, IC50. 50 IC 40 The experimental data and results can reflect the inhibition rate and IC50 of the corresponding siRNA modifier of the siRNA conjugate. 50 IC 40This presents no obstacle to understanding for those skilled in the art.

[0412] Example 1: Sequence Design

[0413] 1. Basic Sequence

[0414] 106 siRNA motifs were designed based on the human FXI mRNA sequence (NM_000128.4) (Table 1). Among them, APC is the base sequence siFXIg1 of the compound siFXIg1M1SP, which has the highest activity shown in patent CN113227376B, and was used as a positive control in this study. ANC is a nonsense sequence and was used as a negative control.

[0415] Table 1 siRNA motifs

[0416]

[0417]

[0418]

[0419] 2. siRNA modifiers

[0420] 2.1 Fluorine-oxygen alternating modification

[0421] To improve inhibition rate and stability, the siRNA motifs in Table 1 are modified with alternating 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) nucleotides, and 3',5'-thiophosphate bonds are formed between the nucleotides at the 5' and / or 3' ends. The rules for alternating modification in this disclosure are as follows: for sequences with an odd-length sense strand, the odd-numbered positions of the corresponding alternating siRNA modifier are all 2'-F modified nucleotides, and the even-numbered positions are all 2'-OMe modified nucleotides; however, for sequences with an even-length sense strand, the odd-numbered positions of the corresponding alternating siRNA modifier are all 2'-OMe modified nucleotides, and the even-numbered positions are all 2'-F modified nucleotides; the odd-numbered positions of the antisense strand are all 2'-OMe modified... Nucleotides with even-numbered positions all modified with 2'-F; additionally, there are 3',5'-thiophosphate bonds between the first and second nucleotides at the 5' end of the sense strand, and between the second and third nucleotides at the 5' end; similarly, there are 3',5'-thiophosphate bonds between the first and second nucleotides at the 5' end of the antisense strand, and between the first and second nucleotides at the 3' end of the antisense strand, and between the second and third nucleotides at the 3' end. SiRNA modifiers designed according to this rule with alternating modifications are indicated by adding "-AL" after the original base sequence number. The alternating siRNA modifiers were obtained by alternating fluorine and oxygen modification of the motifs B00202~B00217, B00302~B00312, B00401~B00410, B00701~B00709, B02601~B02609, B05001~B05008, B05201~B05208, B06401~B06411, B07401~B07408, B07501~B07506, and B07901~B07908 in Table 1. The modifier numbered APC-AL was obtained by alternating fluorine and oxygen modification of the siRNA motif siFXIg1M1SP, which has the highest activity shown in patent CN113227376B, and was used as a positive control in this study. The siRNA modified with the code ANC-AL is the siRNA modified by alternating fluorine and oxygen modification of the siRNA motif ANC in Table 1, and it was used as a negative control in this study.

[0422] Table 2. siRNA modifiers with alternating fluorine and oxygen content

[0423]

[0424]

[0425]

[0426]

[0427]

[0428]

[0429]

[0430]

[0431]

[0432] 2.2 siRNA modifiers that modify templates

[0433] 2.2.1 Modify the template

[0434] The modified templates disclosed herein include DV25P, DV26P, DV27P, DV29P, DV32P, DV34P, DV39P, DV40P, DV25SP, DV26SP, DV27SP, DV29SP, DV32SP, DV34SP, DV39SP, and DV40SP. DV22 is a previously disclosed Advanced ESC template (fluorination sites: antisense strand positions 2, 6, 14, and 16; sense strand positions 7, 9, 10, and 11). The modified templates are shown in Table 3-6. The modification rules are as follows:

[0435] For siRNA motifs with lengths of 21 and 23 bases for the sense and antisense strands, the antisense and sense strands can be modified using any of the methods shown in Tables 3 and 4, respectively.

[0436] For siRNA motifs with lengths of 20 / 22 bases for the sense and antisense strands, the antisense and sense strands can be modified using any of the methods shown in Tables 5 and 6, respectively.

[0437] The antisense and sense strands were modified with siRNA templates of modification methods A and a, respectively, and named DV25P.

[0438] The antisense and sense strands were modified with siRNA templates of modification methods B and a, respectively, and named DV26P.

[0439] The antisense and sense strands were modified with siRNA templates of modification methods C and a, respectively, and named DV27P.

[0440] The antisense and sense strands were modified with siRNA templates of modification methods C and b, respectively, and named DV29P.

[0441] The antisense and sense strands were modified with siRNA templates of modification methods D and b, respectively, and named DV32P.

[0442] The antisense and sense strands were modified with siRNA templates of modification methods E and b, respectively, and named DV34P.

[0443] The antisense and sense strands were modified with siRNA templates of modification methods F and b, respectively, and named DV39P.

[0444] The antisense and sense strands were modified with siRNA templates of G and b, respectively, and named DV40P.

[0445] The antisense chain and the justice chain respectively adopt the existing technology of modification template DV22 with modification methods H and c;

[0446] The antisense and sense strands were modified with siRNA templates using modification methods A' and a', respectively, and named DV25SP.

[0447] The antisense and sense strands were modified with siRNA templates of B' and a', respectively, and named DV26SP.

[0448] The antisense and sense strands were modified with siRNA templates using modification methods C' and a', respectively, and named DV27SP.

[0449] The antisense and sense strands were modified with siRNA templates using modification methods C' and b', respectively, and named DV29SP.

[0450] The antisense and sense strands were modified with siRNA templates using modification methods D' and b', respectively, and named DV32SP.

[0451] The antisense and sense strands were modified with siRNA templates using modification methods E' and b', respectively, and named DV34SP.

[0452] The antisense and sense strands were modified with siRNA templates using modification methods F' and b', respectively, and named DV39SP.

[0453] The siRNA modification templates for the antisense and sense strands, using modification methods G' and b' respectively, were named DV40SP.

[0454] Table 3. Antisense chain modification methods (21 / 23nt)

[0455]

[0456]

[0457] Where 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; 2'-Deoxy represents 2'-deoxy; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

[0458] Table 4. Justice Chain Modifications (21 / 23nt)

[0459]

[0460] Where 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; 2'-Deoxy represents 2'-deoxy; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

[0461] Table 5. Antisense chain modification methods (20 / 22nt)

[0462]

[0463]

[0464]

[0465] Where 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; 2'-Deoxy represents 2'-deoxy; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

[0466] Table 6. Justice Chain Modification Methods (20 / 22nt)

[0467]

[0468] Where 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS indicates that the nucleotide at the 5' end is connected to the adjacent nucleotide on its right by a thiophosphate bond; and EVP represents 5'-vinyl-(E)-phosphonate.

[0469] 2.2.2 The siRNA modified by the template modified in this disclosure

[0470] In this experiment, siRNA motifs B00209, B00210, B00211, B00211s, B00212, B00214, B00215, B00216, B00217s, B00301, B00304, B00307, ​​B00311, B00312, B00403, B00404, B00410, and B05202 were modified using the modification templates in section 2.2.1, as shown in Table 7. Natural 5' phosphorylation or simple direct 5' phosphorylation may result in intracellular dephosphorylation. Direct 5' phosphorylation of oligonucleotide chains can result in 90% dephosphorylation after 2 hours of circulation in the blood and complete disappearance after 24 hours. The 5' phosphorylation design (5'-E-VP) utilizes E-vinylphosphonate to replace the bridging oxygen, resulting in improved phosphorylation efficiency and stability. The modified templates disclosed herein all contain 5'-E-VP phosphorylation at the 5' end of the antisense chain. The sequence numbered APC-SL in Table 7 is siFXIg1-M1SP, the compound with the highest activity shown in patent CN113227376B, which is modified using the modified template in the original patent and is used as a positive control in this embodiment.

[0471] Table 7. siRNA Modifiers

[0472]

[0473]

[0474]

[0475]

[0476]

[0477]

[0478]

[0479]

[0480]

[0481]

[0482]

[0483]

[0484]

[0485]

[0486]

[0487]

[0488]

[0489]

[0490] 2.3 siRNA modifiers for preventing off-target effects and reverse insertion modification

[0491] The following six off-target prevention designs and three reverse insertion modification designs were performed on the siRNA modified with the modified template in section 2.2.2 above.

[0492] To effectively prevent nuclease attack on the sequence ends, this study performed a reverse linking modification on the siRNA modifier C00211-DV25P, changing the connection of the oligonucleotide sequence ends from the natural 3'-5' to 3'-3' and / or 5'-5'. This study explored 3' end reversal modification on the sense strand (InV, as shown in Table 2 below), 3' end reversal modification on the sense strand with removal of the antisense strand overhang (InVs, as shown in Table 3 below), and 3' end reversal modification on the antisense strand (AInV, as shown in Table 4 below).

[0493] To mitigate off-target effects, the aforementioned seed region GNA substitution (7+ and 6+, as shown in Table 7-8) and DNA substitution (d7B and d7B5, as shown in Table 9-10) modifications were employed. Additionally, the nucleotide reversal modification at positions 6 or 7 of the seed region (6InV and 7InV, as shown in Table 5-6) was explored to design an anti-off-target approach for the C00211-DV25P sequence.

[0494] Table 8. siRNA modifiers with anti-off-target modification and inversion modification

[0495]

[0496]

[0497] 2.4 siRNA conjugates

[0498] For siRNA modifiers containing inverted modifications on the positive strand, a conjugate group is attached to the 5' end of the positive strand; for siRNA modifiers without inverted modifications, a conjugate group is attached to the 3' end of the positive strand. DPC-SL10 is the L10-siFXIg1M1SP with the highest activity shown in patent CN113227376B. Its modification method is the modification template in that patent, with L10 attached to the 3' end of its positive strand. In this study, it is used as a positive control. The capital letter P in its sequence indicates that the nucleotide adjacent to the left of the letter P is a 5'-phosphate nucleotide.

[0499] Table 9 Conjugate Sequences

[0500]

[0501]

[0502]

[0503]

[0504]

[0505] Example 2. Synthesis of siRNA compounds

[0506] 2.1. Synthesis of siRNA modified by alternating fluorine and oxygen

[0507] Table 2 shows the siRNA modifiers with alternating fluorine and oxygen. Taking the small interfering RNA with sequence number B00202-AL as an example, its basic sequence is:

[0508] Chain of Justice: 5'-CUUAUUAAGAAUUGCAGCAAA-3' (SEQ ID NO: 1)

[0509] Antonym: 5'- UUUGCUGCAAUUCUUAAUAAGGG-3' (SEQ ID NO: 107)

[0510] Odd-numbered sites on the sense strand and even-numbered sites on the antisense strand are modified with 2'-F, while other sites are modified with 2'-OMe. Furthermore, there are 3',5'-thiophosphate bonds between the first and second nucleotides at the 5' end of the sense strand, as well as between the second and third nucleotides at the 5' end; similarly, there are 3',5'-thiophosphate bonds between the first and second nucleotides at the 5' end of the antisense strand, as well as between the second and third nucleotides at the 3' end of the antisense strand.

[0511] Instruments and reagents: CYTiva 192 P model DNA / RNA automated synthesizer, with cross-linked polystyrene beads as the solid carrier, model Primer support 5G Unylinker 350 (Cytiva manufacturer).

[0512] Preparation method:

[0513] Solutions of the following nucleotide monomers were prepared with acetonitrile at a monomer concentration of 0.15 M: DMT-A-OMe phosphorus amide monomer (Formula 1), DMT-C-OMe phosphorus amide monomer (Formula 2), DMT-G-OMe phosphorus amide monomer (Formula 3), DMT-U-OMe phosphorus amide monomer (Formula 4), DMT-AF phosphorus amide monomer (Formula 5), ​​DMT-CF phosphorus amide monomer (Formula 6), DMT-GF phosphorus amide monomer (Formula 7), and DMT-UF phosphorus amide monomer (Formula 8).

[0514]

[0515]

[0516]

[0517] Prepared using the following steps:

[0518] Nucleotide monomers are linked sequentially from 3' to 5' along the nucleotide arrangement using a solid-phase phosphoramide method. Each linkage involves four steps: deprotection, coupling, oxidation or sulfidation, and hydroxyl protection. Specifically, when two nucleotides are linked using a phosphate ester, the linkage of the subsequent nucleotide monomer involves these four steps. When two nucleotides are linked using a thiophosphate ester, the linkage of the subsequent nucleotide monomer involves these four steps. Details are as follows:

[0519] (1) Deprotection

[0520] The DMT protecting group was removed using a 3% dichloroacetic acid toluene solution as a deprotecting agent, followed by washing with acetonitrile.

[0521] (2) Coupling

[0522] The acetonitrile solution of each nucleotide monomer was coupled using 0.25 M 5-ethylthiotetrazole as an activator, followed by rinsing with acetonitrile.

[0523] (3) Oxidation / sulfidation

[0524] Oxidation: Oxidation was performed using a 0.05 M iodine pyridine / water (90 / 10) solution as the oxidant, followed by rinsing with acetonitrile.

[0525] Vulcanization: Vulcanization was carried out using a pyridine solution of 3% hydroxanthin as a vulcanizing agent, followed by rinsing with acetonitrile.

[0526] (4) Hydroxyl protection

[0527] Hydroxyl protection was performed using a 10% acetic anhydride tetrahydrofuran solution (CAP A) tetrahydrofuran / pyridine / methylimidazole 74 / 10 / 16 (v / v / v) (CAP B) as the hydroxyl protecting agent, followed by rinsing with acetonitrile.

[0528] Repeat the above steps in a cyclical manner according to the set nucleotide arrangement order to obtain a sense or antisense product with a specific sequence arrangement.

[0529] (5) Use 3% dichloroacetic acid toluene solution as a deprotection agent to remove the DMT protecting group of the last nucleotide, and then wash with acetonitrile.

[0530] (6) Ammonolysis and purification

[0531] The reacted solid support was transferred to a reactor, and concentrated ammonia (25%-28%, mass percentage) was added. After ammonolysis at 60°C for 12 h, the system was cooled to room temperature, and the mixture was transferred to a filter press for filtration. The filter cake was washed with a mixture of purified water and ethanol. The filtrates were combined, passed through a chromatography column, concentrated, and lyophilized to obtain single-chain products modified with 2'-OMe and 2'-F.

[0532] (7) Remove TBDMS

[0533] DMSO and triethylamine hydrofluoric acid were added to the obtained product, and the reaction was carried out at 60°C for 2 hours. Then, ammonium acetate aqueous solution was added to the reaction solution, and the mixture was shaken and mixed. Anhydrous ethanol was added, and the mixture was shaken and mixed. Crystallization was carried out at -20°C for 8 to 12 hours. After centrifugation, the supernatant was discarded, and the precipitate was washed with anhydrous ethanol to obtain the unmodified single-chain product.

[0534] (8) Annealing

[0535] The purified sense and antisense strands were mixed in a 1:1 molar ratio, heated to 95°C and held for 3 min, and then slowly cooled to room temperature to form siRNA duplexes.

[0536] Synthesize the other sequences listed in Table 2 using the method described above.

[0537] 2.2 Synthesis of template-modified siRNA products disclosed herein

[0538] For the siRNA modified product in 2.2.2 of Example 1, referring to 2.1 of Example 2 for the synthesis of the siRNA modified product, when synthesizing the 5' end base (the last base) of the antisense strand, a monomer containing a phosphonic acid group at the 5' end is used, for example, vinyl-(E)-phosphonate-A-OMe phosphorous amide monomer (Formula 9) or vinyl-(E)-phosphonate-U-OMe phosphorous amide monomer (Formula 10), the structural examples of which are as follows:

[0539] Formula 9 Formula 10

[0540] For the DV39P template modification sequence, referring to section 2.1 of Example 2 for siRNA sequence synthesis, the DNA monomers DMT-dA phosphorus amide monomer (Formula 11), DMT-dT phosphorus amide monomer (Formula 12), DMT-dC phosphorus amide monomer (Formula 13), or DMT-dG phosphorus amide monomer (Formula 14) are used when synthesizing the nucleotides at positions 2, 6, and 14 of the antisense strand and position 16 of the sense strand. Their exemplary structures are as follows:

[0541] Formula 11 Formula 12 Formula 13

[0542] Formula 14

[0543] 2.3 Synthesis of inverted siRNA modifiers

[0544] For inverted siRNA modifiers, refer to section 2.1 of Example 2 for the synthesis of siRNA modifiers. When synthesizing the terminal nucleotides of the positive or antisense strands, use the DNA monomers dA(Bz)-CE-Reverse (dAinV), dT(Bz)-CE-Reverse (dTinV), dC(Bz)-CE-Reverse (dCinV), or dG(Bz)-CE-Reverse (dGinV), with the following structures:

[0545]

[0546] 2.4 Synthesis of siRNA conjugates

[0547] For the conjugates in Table 9 with the GalNAc conjugate group G101 (with the following structural formula) attached to the 3' end of the positive chain, the method for attaching the oligonucleotide to G101 is as described in Example 3 of patent application CN116854754A.

[0548]

[0549] The oligonucleotide forms a conjugate with the conjugation group G101 as shown below:

[0550] .

[0551] The presence of G101 in the sequence number indicates that the sequence is connected to the conjugation group G101. L10 is the conjugation group of *Gynostemma pentaphyllum* (siFXIg1-M1SP, which exhibits the highest activity as shown in CN113227376B). L10 indicates that the sequence is connected to the conjugation group L10. The structural formula of L10 is as follows:

[0552]

[0553] Example 3: Inhibitory effect of siRNA on FXI gene expression in vitro

[0554] 3.1. Inhibitory effect of motif and fluorine-oxygen alternating modified siRNA on FXI gene expression

[0555] The siRNA motif synthesized in Example 2 and the siRNA modified by alternating 2'-OMe and 2'-F were transfected into HepG2 cells via lipid nanoparticles (LNPs). The inhibitory effect of each siRNA on the target gene FXI was detected by qPCR and ELISA.

[0556] 3.1.1. qPCR detection of FXI mRNA expression inhibition rate

[0557] HepG2 cell line was cultured in 10% fetal bovine serum DMEM medium (supplemented with 100× penicillin and 100× streptomycin 10μL / mL) and placed in a cell culture incubator containing 5% CO2 at 37℃.

[0558] Before siRNA transfection of cells, Lipofectamine RNAiMAX (Invitrogen, 13778150) and Opti-MEM were mixed at a ratio of 2:98 and vortexed to prepare the transfection mixture. The siRNA compound was diluted to an appropriate concentration using Opti-MEM. For single-site transfection, the siRNA concentration was prepared at 960 pM. 55 μL of the Opti-MEM-diluted siRNA solution was added to 55 μL of the transfection mixture at a ratio of 1:1 (v / v).

[0559] For the blank control group, add 55 μL of the prepared transfection mixture to 55 μL of Opti-MEM. Vortex mix and let stand at room temperature for 15 min.

[0560] Add the prepared transfection reagent to each 24-well cell culture plate (100 μL per well) to achieve a final siRNA concentration of 80 pM per well. Add 500 μL of cell suspension (cell density 1.5 × 10⁻⁶ cells / well). 5 ( / mL). After mixing using the cross-hatching method, place in a 37°C, 5% CO2 cell culture incubator and incubate for 48 h.

[0561] Forty-eight hours after transfection, RNA was extracted according to the instructions of the RNA extraction kit (RNeasy Mini Kit, QIAGEN, 74106). Then, the RNA was reverse transcribed into cDNA using the FastKing RT Kit (with gDNase) (TIANGEN, KR116-02). Finally, qPCR was performed using the TB Green® Premix Ex Taq™ (Tli RNaseH Plus) kit (Takara, RR420W(L × 5)) to quantify the expression level of FXI mRNA. The amplification primers used in the qPCR experiment are shown in Table 10. The qPCR reaction program was: 95℃ for 30 s, followed by cycling at 95℃ for 5 s, then at 60℃ for 34 s, for a total of 40 cycles.

[0562] Table 10 qPCR amplification primers

[0563]

[0564] The formula for calculating the FXI mRNA expression rate (%) is as follows:

[0565] Expression rate = (FXI mRNA expression level / FXI mRNA expression level in blank control group) × 100%;

[0566] FXI gene expression inhibition rate = 100% - expression rate (%). The results are shown in Table 11.

[0567] 3.1.2. ELISA detection of FXI protein expression inhibition rate

[0568] To investigate the inhibitory effect of siRNA on the target gene FXI at the protein level, which was detected by qPCR with a high inhibition rate, the supernatant of cell culture medium transfected with siRNA for 48 h was analyzed by ELISA using the Human Factor XI ELISA kit (Thermo Fisher, EH118RB).

[0569] The ELISA data were processed and standardized relative to the transfection reagent control group (expression level relative to the transfection reagent control group = protein expression level of FXI in each sample / protein expression level of FXI in the transfection reagent control group sample). The results are shown in Table 11.

[0570] Table 11. Inhibition rate of siRNA motifs and fluorine-oxygen alternating siRNA modifiers on the target gene FXI in HepG2.

[0571]

[0572]

[0573]

[0574] In this embodiment, the inhibition rate was the average of three experiments, as shown in Table 11. qPCR results showed that among the 106 siRNA modifiers with alternating 2'-OMe and 2'-F modifications, 49 showed inhibition rates exceeding 60% for FXI gene expression, 34 had inhibition rates between 40% and 60%, and 23 had inhibition rates below 40%, with Yangshen APC-AL showing an inhibition rate of 59%. In the ELISA experiment, Yangshen APC-AL showed an inhibition rate of 46%, and among the 27 dominant siRNAs detected, 25 showed higher inhibition rates than Yangshen.

[0575] 3.2. Inhibitory effect of template-modified siRNA on FXI gene expression

[0576] The modified siRNA synthesized in Example 2 (sequence shown in Table 7) was transfected into HepG2 cells via lipid nanoparticles (LNPs), and the inhibition rate of the target gene FXI was detected by qPCR and ELISA.

[0577] The experimental procedure was basically the same as in 3.1, except that the siRNA transfection concentration was 10 pM. The experimental results are shown in Table 12.

[0578] Table 12. Inhibition rate of template-modified siRNA in HepG2

[0579]

[0580]

[0581]

[0582]

[0583] As can be seen from Table 12, the siRNA modifiers provided in this disclosure exhibit excellent inhibitory effects on the FXI gene. Furthermore, compared to the previously disclosed Advanced ESC template DV22, the siRNA modifiers modified with the modified template of this disclosure have a stronger inhibitory effect on gene expression.

[0584] 3.3. Inhibitory effects of inverted and off-target modified derivatives on FXI gene expression

[0585] The siRNA modified products (sequences shown in Table 8) synthesized in Example 2, obtained through inverted modification and off-target prevention modification, were transfected into HepG2 cells via lipid nanoparticles (LNPs). The transfection concentrations were 1.00E+02, 5.00E+01, 2.50E+01, 1.30E+01, 1.60E+00, 2.00E-01, 2.40E-02, 3.10E-03, 3.80E-04, 4.80E-05, and 6.00E-06 nM, respectively. The inhibitory effect on the target gene FXI at each concentration was detected using qPCR, and the IC50 was calculated. 50 .

[0586] According to IC 50 The results of maximum inhibition rate (transfection at the highest concentration point) showed that the IC50 values ​​of five siRNA modifiers, namely C00211-DV25P, C00211-DV25PInV, C00211-DV25PInVs, C00211-DV25Pd7B, and C00211-DV25P6InV, were significantly higher than those of the previous year. 50 The values ​​are all lower than the IC50 of Yangshen APC-SL. 50 Its medicinal efficacy is superior to that of Yangshen.

[0587] Example 4: Inhibitory effect of siRNA conjugate on FXI gene expression in humanized mice

[0588] This embodiment utilizes transgenic mice expressing the human FXI gene to detect the inhibitory effect of the siRNA conjugates listed in Table 9 on FXI protein expression in vivo using an ELISA experiment. The Yangshen drug is L10-siFXIg1-M1SP, the compound with the highest activity shown in patent CN113227376B.

[0589] 4.1 Inhibitory effect of siRNA conjugate on mouse FXI protein expression

[0590] Six- to eight-week-old male hFXI transgenic mice were introduced into the breeding facility and acclimatized for approximately one week. They were then divided into 40 groups (n=6 per group) based on baseline hFXI levels and body weight, including a solvent group (saline), a negative control group, a positive control group, and a test substance group (Table 14). The drug was administered at a dose of 1 MPk via a single subcutaneous dose. Serum hFXI levels were measured using an ELISA kit on days 7, 14, 21, 28, 35, 42, and 49 post-administration, and the inhibitory rate of the drug on FXI protein expression in mice was calculated.

[0591] Table 13. Inhibition rate of serum hFXI protein in high-dose humanized mice (%)

[0592]

[0593]

[0594]

[0595] Note: " / " indicates that the experiment has been terminated and no tests were conducted.

[0596] As shown in Table 13, the experimental results of applying high-dose siRNA conjugates to humanized mice showed that the inhibition rate of Yangshen DPC-SL10 was 61.12% on day 28. Fourteen siRNA conjugates had higher inhibition rates than Yangshen and were able to inhibit FXI expression in vivo within 28 days. Among them, five candidate compounds, including D00211-DV34PG101, D00211s-DV25SPG101, D00211-DV25PG101, D00211-DV34PInVG101, and D00216-DV34PG101, had inhibition rates exceeding 80%. On day 49, the inhibition rate of Yangshen DPC-SL10 decreased to 17.40%. Thirteen siRNA conjugates showed higher inhibition rates than Yangshen. Among them, four siRNA conjugates, D00211s-DV25SPG101 (70.09%), D00211-DV25PG101 (65.65%), D00211-DV34PG101 (58.22%), and D00216-DV34PG101 (53.33%), showed inhibition rates above 50%, demonstrating high pharmacodynamic activity.

[0597] To further screen for highly active compounds, eight sequences (see Table 14) that showed superior efficacy in high-dose mouse experiments were selected and subjected to low-dose experiments with Yangshen DPC-SL10 and the solvent group. The dosage in the low-dose group was 0.5 mpk, with 8 mice per group, for a total of 10 groups.

[0598] Table 14. Inhibition rate of serum hFXI protein in low-dose humanized mice (%)

[0599]

[0600] As shown in Table 14, in the experiment of applying low-dose siRNA conjugates to humanized mice, the lowest point of serum FXI inhibition rate in each group occurred on day 7. Among them, the inhibition rates of 7 siRNA conjugates (D00211-DV25PG101, D00211-DV25PInVG101, D00211-DV34PG101, D00211-DV34PInVsG101, D00211s-DV25SPG101, D00212-DV32PG101, D00216-DV34PG101) were higher than those of Yangshen DPC-SL10 (63.56%), showing higher pharmacological activity. On day 49, the serum FXI content in the Yangshen group returned to baseline (inhibition rate -1.01%). The inhibition rates of D00211s-DV25SPG101 (55.87%), D00211-DV34PG101 (44.06%), D00211-DV25PG101 (40.69%), D00216-DV34PG101 (23.58%) and D00212-DV32PG101 (22.11%) were significantly higher than those of Yangshen, showing higher pharmacodynamic activity.

[0601] 4.2 The effect of siRNA conjugates on prolonging APTT (Activated Partial Thromboplastin Time) in humanized mice

[0602] For the eight siRNA conjugates and yangshen in Table 15, APTT was detected at D49 in high-dose and low-dose experiments, and the results are shown in Table 15 below.

[0603] Table 15. APTT assay of humanized mice D49

[0604]

[0605] Table 15 shows that, compared to the solvent group, the APTT of all eight siRNA conjugates and *Gynostemma pentaphyllum* was prolonged in the high-dose group experiment, with D00211-DV34PG101, D00211s-DV25SPG101, and D00212-DV32PG101 showing a prolongation rate greater than 50%. In the low-dose group experiment, the prolongation rates of D00211-DV25PG101, D00211-DV34PG101, and D00211s-DV25SPG101 were greater than 10%.

[0606] Example 5: Pharmacological effects of siRNA conjugates in cynomolgus monkeys

[0607] This embodiment evaluates the pharmacological effects of siRNA in cynomolgus monkeys by detecting serum FXI protein levels, liver FXI mRNA expression levels, serum FXI activity, and APTT (Activated Partial Thromboplastin Time). Yangshen DPC4059-SL10 is compound L10-siFXIf1-M1SP from patent CN113227376B.

[0608] Before administration, cynomolgus monkeys were grouped according to serum FXI protein levels and body weight, while also considering APTT, PT (prothrombin time), and FXI activity. Each group consisted of 3 males, for a total of 6 groups, including 5 siRNA conjugate groups and 1 *Gynostemma pentaphyllum* group. Administration was via a single subcutaneous injection (neck and back), with a dose designed to be 1 mg / kg and a volume of 1 mL / kg. Therefore, the concentration was set at 1 mg / mL. The day of administration was recorded as D0, and the observation period was 84 days.

[0609] 5.1 Serum FXI Level Detection

[0610] The levels of FXI protein in serum were measured using ELISA at D-1 before drug administration and at D7, 14, 21, 28, 42, 56, 70, and 84 after drug administration, and the inhibition rate was calculated (see Table 16).

[0611] Table 16. Serum FXI protein inhibition rate (%)

[0612]

[0613] Table 16 shows that the five siRNA conjugates and Yangshen DPC4059-SL10 exhibited inhibitory effects on serum FXI expression in cynomolgus monkeys as early as day 7 after drug administration, with the inhibition rate reaching its peak on day 28. The inhibition rates of the five siRNA conjugates were all higher than those of Yangshen. At the experimental endpoint on day 84, the inhibition rates of all groups were higher than 60%.

[0614] 5.2 Detection of liver FXI mRNA expression

[0615] Before and after drug administration, liver biopsies were performed on cynomolgus monkeys at D28, 56, and 84. Approximately 5 mg of tissue was collected each time, and total RNA was extracted. The expression level of FXI mRNA was detected by RT-qPCR, and the inhibition rate was calculated.

[0616] Table 17. Hepatic FXI mRNA inhibition rate (%)

[0617]

[0618] The table above shows that the FXI mRNA levels in each group reached their lowest levels on day 56. Among them, D00211-DV34PG101, D00216-DV34PG101, D00211-DV34PInVsG101, and D00211s-DV25SPG101 showed higher inhibition rates of liver FXI mRNA than the positive control DPC4059-SL10. On day 84, the inhibition rates of liver FXI mRNA by the five siRNA conjugates were all higher than those of the positive control DPC4059-SL10.

[0619] 5.3 Serum FXI Activity Detection

[0620] Coagulation time was measured using a semi-automatic coagulation analyzer. FXI activity in plasma was measured at D-1 (before drug administration) and at D7, 14, 21, 28, 42, 63, 77, and 84 (after drug administration). Specifically, whole blood was collected using 3.8% sodium citrate anticoagulant tubes and thoroughly mixed (to avoid hemolysis or coagulation). Immediately after collection, the blood was centrifuged at 2500 g for 15 min at room temperature to separate the plasma. The plasma was then diluted 10-fold with Owren-Koller diluent. 50 µL of FXI-deficient plasma and 50 µL of the test plasma sample were mixed and incubated at 37°C for 1 min. 50 µL of APTT reagent and one magnetic bead were added, and the mixture was incubated at 37°C for 3 min. Finally, CaCl2 solution was added, and the mixture was immediately mixed at 37°C to measure coagulation time. FXI activity and reduction rate were calculated based on the standard curve of FXI activity versus coagulation time. Table 18 shows that the five siRNA conjugates and the ginseng treatment group induced a decrease in FXI activity in cynomolgus monkeys on day 7, which continued until day 84.

[0621] Table 18. FXI activity reduction rate (%)

[0622]

[0623] 5.3 APTT and PT testing

[0624] Using a fully automated coagulation analyzer, plasma APTT and PT were measured at D-1 before drug administration and at D7, 14, 21, 28, 42, 56, 70, and 84 after drug administration to assess the effect of siRNA conjugates on the function of intrinsic and extrinsic coagulation pathways. Specifically, whole blood was collected using 3.8% sodium citrate anticoagulant tubes, thoroughly mixed (to avoid hemolysis or coagulation), and immediately transferred to the clinical laboratory at room temperature. The plasma was then centrifuged at 3500 rpm / min for 15 min at room temperature to separate it, and APTT and PT were immediately measured. The APTT prolongation rate compared to before drug administration (D-1) was calculated for each group of animals. The results are shown in Tables 19-21 below.

[0625] Table 19. APTT(s)

[0626]

[0627] Table 20. PT(s)

[0628]

[0629] Table 21. APTT prolongation rate relative to pre-drug administration (D-1)

[0630]

[0631] Tables 19 and 210 show that the five siRNA conjugates and *Yangshen* induced a prolongation of APTT in cynomolgus monkeys, but had no significant effect on PT, indicating that the drugs prolong clotting time by regulating the intrinsic coagulation pathway, without affecting the extrinsic coagulation pathway. Table 21 shows that the five siRNA conjugates exhibited varying degrees of APTT prolongation as early as day 7. From day 7 to day 42, the APTT prolongation rate of the five siRNA conjugates was higher than that of *Yangshen* DPC4059-SL10. On day 84, the APTT prolongation rates of D00211-DV34PG101 and D00216-DV34PG101 were 49.70% and 48.31%, respectively, demonstrating strong pharmacological activity.

[0632] Example 6: Comparison of this patent sequence with prior art disclosed sequences

[0633] In this embodiment, the unmodified sequences B00209, B00210, B00211, B00211s, B00212, B00215, B00216 and B00404 disclosed herein are compared with similar unmodified sequences disclosed in the prior art in terms of sequence structure and in vitro pharmacological activity.

[0634] 6.1 Comparison of Sequence Structures

[0635] The sequences disclosed in the prior art are very similar to those disclosed herein. The table below shows information such as sequence, length, position, and terminal mutations:

[0636] Table 22 Comparison of the sequence structure of prior art disclosures and this disclosure

[0637]

[0638]

[0639] 6.2 Comparison of in vitro pharmacological activities

[0640] In vitro, the inhibitory effects of unmodified prior art sequences and the unmodified sequences of this disclosure on the expression of the target gene FXI were compared at the cellular level. The specific experimental methods were basically the same as in 3.1.1, except that the cell transfection experiment was performed in 96-well plates at 3000 cells / well, with final siRNA transfection concentrations of 0.01 nM and 0.10 nM. After 48 h, RNA was extracted, and the FXI gene expression inhibition rate was detected by qPCR. The results are shown in Table 23. Compared with similar unmodified sequences disclosed in the prior art, the unmodified sequences in this disclosure showed significantly enhanced activity.

[0641] Table 23 Comparison of the inhibition of FXI expression by prior art sequences and sequences disclosed herein.

[0642]

[0643] Although specific embodiments of this disclosure have been described in detail, the above embodiments and specific embodiments should not be considered as limitations on this disclosure. Those skilled in the art will understand that, without departing from the spirit and intent of this disclosure, various modifications and substitutions can be made to those details based on all the teachings disclosed, and such changes are all within the scope of protection of this disclosure. The full scope of this disclosure is given by the appended claims and any equivalents.

Claims

1. A siRNA double strand, characterized in that, The siRNA duplex comprises a sense strand and an antisense strand forming an inverse complementary double-stranded region, and the siRNA duplex comprises any one of the following oligonucleotide duplexes composed of sense and antisense strand pairings: (1) The sequence of the justice chain is Cms-Ams-Gm-Gm-Am-Um-Gf-Am-Uf-Uf-Uf-Um-Cm-Um-Um-Am-Uf-Am-Um-Cm-Am; and the sequence of the antisense chain is UmsEVP-Gfs-Am-Um-Am-Uf-Am-Am-Gm-Am-Am-Am-Am-Uf-Cm-Af-Um-Cm-Cm-Um-Gms-Ams-Am; (2) The sequence of the justice chain is Cms-Ams-Gm-Gm-Am-Um-Gf-Am-Uf-Um-Uf-Um-Cm-Um-Um-Am-Uf-Am-Um-Cm-Am; and the sequence of the antisense chain is UmsEVP-Gfs-Af-Um-Am-Uf-Am-Am-Gm-Am-Am-Am-Am-Uf-Cm-Af-Um-Cm-Cm-Um-Gms-Ams-Am; (3) The sequence of the justice chain is Ams-Gms-Gm-Am-Um-Gf-Am-Uf-Uf-Uf-Um-Cm-Um-Um-Am-Uf-Am-Um-Cm-Am; and the sequence of the antisense chain is UmsEVP-Gfs-Am-Um-Am-Uf-Am-Am-Gm-Am-Am-Am-Am-Uf-Cm-Af-Um-Cm-Cm-Ums-Gms-Am; (4) The sequence of the justice chain is Cm-Am-Gm-Gm-Am-Um-Gf-Am-Uf-Um-Uf-Um-Cm-Um-Um-Am-Uf-Am-Ums-Cms-dAinV; and the sequence of the antisense chain is UmsEVP-Gfs-Af-Um-Am-Uf-Am-Am-Gm-Am-Am-Am-Am-Uf-Cm-Af-Um-Cm-Cms-Ums-Gm; (5) The sequence of the justice chain is Cm-Am-Gm-Gm-Am-Um-Gf-Am-Uf-Um-Uf-Um-Cm-Um-Um-Am-Uf-Am-Ums-Cms-dAinV; and the sequence of the antisense chain is UmsEVP-Gfs-Af-Um-Am-Uf-Am-Am-Gm-Am-Am-Am-Am-Uf-Cm-Af-Um-Cm-Cm-Um-Gms-Ams-Am; (6) The sequence of the justice chain is Gms-Gms-Am-Um-Gm-Am-Uf-Um-Uf-Um-Cf-Um-Um-Am-Um-Am-Uf-Cm-Am-Am-Am; and the sequence of the antisense chain is UmsEVP-Ufs-Uf-Gm-Am-Uf-Am-Um-Am-Am-Gm-Am-Am-Af-Am-Uf-Cm-Am-Um-Cm-Cms-Ums-Gm; Where m represents 2'-O-methyl modification, f represents 2'-fluorine modification, s indicates that the nucleotide at this position is connected to the adjacent nucleotide to its right by a thiophosphate bond, EVP represents 5'-vinyl-(E)-phosphonate, and inV indicates that the connection at the 3' end of the sequence is changed from the natural 3'-5' to 3'-3'.

2. A conjugate for reducing the expression of FXI, characterized in that, The conjugate includes the siRNA duplex as described in claim 1, and the conjugate group attached thereto.

3. The conjugate according to claim 2, characterized in that, The conjugating group is attached to the 3'-terminus or 5'-terminus of the positive strand of the oligonucleotide; and / or, The conjugating group is a GalNAc derivative attached using a divalent or trivalent branched linker arm.

4. The conjugate according to claim 2, characterized in that, The conjugating group is: 。 5. The conjugate according to any one of claims 2-4, characterized in that, The conjugate comprises any one of the following oligonucleotide duplexes formed by pairing of sense and antisense strands: (1) The sequence of the justice chain is Cms-Ams-Gm-Gm-Am-Um-Gf-Am-Uf-Uf-Uf-Um-Cm-Um-Um-Am-Uf-Am-Um-Cm-Am-G101; and the sequence of the antisense chain is UmsEVP-Gfs-Am-Um-Am-Uf-Am-Am-Gm-Am-Am-Am-Am-Uf-Cm-Af-Um-Cm-Cm-Um-Gms-Ams-Am; (2) The sequence of the justice chain is Cms-Ams-Gm-Gm-Am-Um-Gf-Am-Uf-Um-Uf-Um-Cm-Um-Um-Am-Uf-Am-Um-Cm-Am-G101; and the sequence of the antisense chain is UmsEVP-Gfs-Af-Um-Am-Uf-Am-Am-Gm-Am-Am-Am-Am-Uf-Cm-Af-Um-Cm-Cm-Um-Gms-Ams-Am; (3) The sequence of the justice chain is G101-Cm-Am-Gm-Gm-Am-Um-Gf-Am-Uf-Um-Uf-Um-Cm-Um-Um-Am-Uf-Am-Ums-Cms-dAinV; and the sequence of the antisense chain is UmsEVP-Gfs-Af-Um-Am-Uf-Am-Am-Gm-Am-Am-Am-Am-Uf-Cm-Af-Um-Cm-Cms-Ums-Gm; (4) The sequence of the justice chain is G101-Cm-Am-Gm-Gm-Am-Um-Gf-Am-Uf-Um-Uf-Um-Cm-Um-Um-Am-Uf-Am-Ums-Cms-dAinV; and the sequence of the antisense chain is UmsEVP-Gfs-Af-Um-Am-Uf-Am-Am-Gm-Am-Am-Am-Am-Uf-Cm-Af-Um-Cm-Cm-Um-Gms-Ams-Am; (5) The sequence of the justice chain is Ams-Gms-Gm-Am-Um-Gf-Am-Uf-Uf-Uf-Um-Cm-Um-Um-Am-Uf-Am-Um-Cm-Am-G101; and the sequence of the antisense chain is UmsEVP-Gfs-Am-Um-Am-Uf-Am-Am-Gm-Am-Am-Am-Am-Uf-Cm-Af-Um-Cm-Cm-Ums-Gms-Am; (6) The sequence of the justice chain is Gms-Gms-Am-Um-Gm-Am-Uf-Um-Uf-Um-Cf-Um-Um-Am-Um-Am-Uf-Cm-Am-Am-Am-G101; and the sequence of the antisense chain is UmsEVP-Ufs-Uf-Gm-Am-Uf-Am-Um-Am-Am-Gm-Am-Am-Af-Am-Uf-Cm-Am-Um-Cm-Cms-Ums-Gm.

6. A nucleic acid protein composition, characterized in that, The nucleic acid protein composition comprises the double-stranded region of the siRNA double strand as described in claim 1, and a nuclease; Alternatively, the nucleic acid protein composition may comprise the antisense strand of the double-stranded region of the siRNA double strand as described in claim 1, and a nuclease.

7. A pharmaceutical composition, characterized in that, The composition comprises the siRNA duplex according to claim 1, the conjugate according to any one of claims 2-5, or the nucleic acid protein composition according to claim 6, and a pharmaceutically acceptable carrier.

8. The use of the siRNA double strand according to claim 1, the conjugate according to any one of claims 2-5, the nucleic acid protein composition according to claim 6, or the pharmaceutical composition according to claim 7 in the preparation of a medicament for treating diseases related to FXI gene expression; wherein the diseases related to FXI gene expression are thrombotic diseases.

9. The use of the siRNA double strand according to claim 1, the conjugate according to any one of claims 2-5, the nucleic acid protein composition according to claim 6, or the pharmaceutical composition according to claim 7 in the preparation of anticoagulant drugs.

Citation Information

Patent Citations

  • Improved lipid formulation

    CN102625696B

  • Novel lipid and lipid nanoparticle formulations for nucleic acid delivery

    CN108368028B

  • Compounds and compositions for intracellular delivery of therapeutic agents

    CN110520409A

  • Nucleic acid, pharmaceutical composition and conjugate, preparation method and use thereof

    CN113227376B

  • GalNAc compound containing ribose ring or derivative structure thereof and oligonucleotide conjugate thereof

    CN116854754A