Pig chromosome 3 TMC7 gene as meat-producing character molecular breeding marker and application of pig chromosome 3 TMC7 gene

Abstract

The invention belongs to the technical field of molecular biology, particularly relates to a pig chromosome 3 TMC7 gene as a meat-producing character molecular breeding marker and application, and aims to provide a new marker and technical support for meat-producing character molecular breeding of pigs. The molecular marker is located at the 26346502 base in a pig chromosome 3 TMC7 gene, and allele G / T polymorphism exists at the site. A correlation analysis result shows that in American and French large white pig populations, the eye muscle area of a GG genotype individual is remarkably higher than that of other genotype individuals (plt; 0.05), and it is indicated that the genotype is a favorable genotype of the eye muscle area character. The SNP marker provided by the invention provides a new molecular tool for genetic breeding of pig eye muscle area characters, and can be used for auxiliary screening of breeding pigs with excellent meat production performance, so that the breeding process of pig breeds with high lean meat percentage is accelerated.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biomolecular markers, in particular to the pig chromosome 3 TMC7 gene as a meat production trait molecular breeding marker and application. BACKGROUND

[0002] With the improvement of living standards, people's demand for pork quality is getting higher and higher. Studies have found that the eye muscle area of pigs is positively correlated with the lean meat rate In lean-type pig breeding, eye muscle area is a key indicator related to meat production efficiency and economic benefit. This trait is affected by genetics, nutrition and environment, and the core of breeding is to continuously improve the growth performance of pig populations through genetic improvement By breeding pigs with larger eye muscle area, the carcass lean meat rate can be effectively improved, thereby providing higher production and economic benefits for pig breeding enterprises and promoting the scientific and healthy development of the pig industry. Pig genetic improvement based on molecular breeding will become a rigid demand for the pig breeding industry.

[0003] Current pig genetic improvement still faces technical bottlenecks. Traditional eye muscle area measurement mainly relies on post-mortem dissection or in vivo ultrasonic detection, which has limitations such as strong destructiveness, high cost, and complex operation The application of marker-assisted selection (MAS) technology brings new breakthroughs to breeding. This technology analyzes genotype differences and is particularly suitable for traits with moderate heritability and difficult to measure accurately in vivo. Single nucleotide polymorphism (SNP) markers, as a highly efficient genetic analysis tool, play a key role in analyzing the mechanism of pig muscle development. It can accurately detect single base variations in the genome, including transitions, transversions, insertions, or deletions. These variations are widely distributed in coding and non-coding regions. SNPs in coding regions can directly change amino acid sequences, thereby affecting protein structure and function; SNPs in non-coding regions often indirectly affect trait performance by regulating gene expression levels. With its multi-level and fine resolution of genetic effects, SNP markers have become an important breeding method for improving pig meat production performance and have been practically promoted and applied in multiple commercial pig populations.

[0004] Genome-wide association study (GWAS) is a key technology in modern breeding. It can efficiently identify candidate genes and functional sites that affect important economic traits in pigs by detecting the association between millions of SNP sites in the genome and target traits The technology utilizes high-density molecular markers, large-scale population data analysis and advanced statistical models to accurately locate genetic variations that regulate muscle development, thereby significantly improving the accuracy and efficiency of breeding selection. Currently, GWAS has been successfully applied to genetic analysis of pork traits such as eye muscle area, providing a scientific basis for molecular marker-assisted selection.

[0005] The core group of Large White pig breed eye muscle area is improved, and the cross-sectional area of longissimus dorsi muscle is increased, so as to improve the lean meat yield and slaughter rate of commercial pigs, and enhance the production efficiency and market competitiveness of pig breeding industry. SUMMARY

[0006] The present application aims to provide a pig chromosome 3 TMC7 gene as a molecular breeding marker for meat production traits and its application. Based on GWAS analysis of the Danish Large White pig population, a SNP site with significant association with the trait and the largest effect value is identified, which can be used as an effective molecular marker for improving the genetic selection efficiency of meat production traits.

[0007] The present application is realized by the following technical solutions:

[0008] A SNP molecular marker related to the eye muscle area of a pig, the site of the SNP molecular marker corresponds to the gene sequence of the segment 26346101-26346700 of pig chromosome 3, the fragment length is 600bp, the nucleotide sequence is shown in the attached sequence table SEQ ID NO. 1, and the BLAST comparison is performed through NCBI, and it is found that there is a nucleotide polymorphism (SNP) site in the amplified fragment, specifically as shown in Figure 4 The mutation of the SNP site is specifically at the 26346502 base of chromosome 3, and the base is changed from G to T. According to the Ensembl database query, the mutation site is rs81329230; the SNP molecular marker is significantly related to the eye muscle area.

[0009] Whole genome DNA was extracted from the ear tissue of the American Large White, the Danish Large White and the French Large White, and a primer pair was designed according to the pig gene sequence (NC_010449.5) published in the NCBI database. The sequence of the primer pair is as follows:

[0010] Forward primer (SEQ ID NO. 2): 5'-GGTAATAGCATCAAGGTCAAGAGGA-3',

[0011] Reverse primer (SEQ ID NO. 3): 5'-AAGCGTCACAGCCAAGATGAT-3'.

[0012] The primer pair can be used for genotyping the polymorphic site of the 26346101-26346700 segment of pig chromosome 3, and the genotype of the region is identified by specific amplification of the target fragment.

[0013] After PCR amplification by the primer pair, purification of the PCR product, cloning sequencing and sequence alignment analysis, one genetic marker associated with the eye muscle area trait of pigs is screened. The nucleotide sequence of the genetic marker is shown in SEQ ID NO. 1: wherein the mutation site is at the 402th position of the sequence.

[0014] The application further provides a method for screening a genetic marker associated with the eye muscle area trait of pigs, which comprises the following steps:

[0015] Genomic DNA is extracted from the ear tissue samples of American, Danish and French large white pigs. Specific primers covering the segment from upstream-401 bp to downstream+198 bp are designed for the target site. PCR amplification is carried out using the extracted DNA as a template, and a 600 bp fragment (the sequence is shown in SEQ ID NO. 1) is obtained by direct sequencing, which contains a specific SNP site. The polymorphic site can be used as a genetic marker for the association analysis of the eye muscle area trait of American and French large white pigs.

[0016] The application provides a genotyping method for detecting the SNP site in the above sequence.

[0017] The application further provides an application of determining the association analysis between different genotypes of individuals and the eye muscle area trait by direct sequencing method, which comprises the following steps:

[0018] In order to determine the correlation between the SNP in the 26346101-26346700 region of pig chromosome 3 and the difference in pig phenotype, American large white, Danish large white and French large white are selected as test materials; polymorphism detection is carried out by direct sequencing method, and the correlation between the polymorphic site and the eye muscle area of pigs is analyzed by taking American large white and French large white as test materials. The association between genotypes and phenotypic values is analyzed by using the mixed linear model (Mixed) in SAS statistical software.

[0019] Compared with the prior art, the application has the following advantages and effects:

[0020] Through whole genome association analysis, a SNP marker is locked at 26346502 base of pig chromosome 3: the 402th base of the nucleotide sequence is replaced by alleles, resulting in polymorphism at the site. Based on the genotype data of the Danish large white pig population, the SNP site shows significant genome-wide association with the live eye muscle thickness trait, and the P value is 1.98×10 -6The R at the 402th position in the nucleotide sequence of the SNP molecular marker is allelic replacement, and the replacement causes polymorphism at the position: the eye muscle area of the GG genotype of the SNP site is larger than that of other genotypes, and the GG genotype of the SNP site is the advantageous genotype of the eye muscle area of the pig. The present application first discloses the genetic regulation effect of the SNP site on the eye muscle area trait of the pig, provides a new target with high precision and high stability for pig molecular marker assisted selection, and has important breeding application value. By exploring and verifying the association of the site and the target trait, scientific basis and key technical support are provided for pig genetic breeding practice. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 The genetic marker of the present application is a SNP significantly related to the live eye muscle thickness, which is obtained by whole genome association analysis;

[0022] Figure 2 The genetic marker of the present application is a SNP significantly related to the live eye muscle thickness, which is obtained by whole genome association analysis;

[0023] Figure 3 The present application is the cloning detection result of the 26346101-26346700 segment of the pig chromosome 3; the concentration of agarose gel is 1.5%; wherein, lanes 1-3: PCR amplification products, lane M: DL2000 Maker;

[0024] Figure 4 The nucleotide sequence of the 26346101-26346700 segment of the chromosome 3 provided by the present application; wherein, there is 1 mutation site in the shown sequence, which is a specific site causing the polymorphism of the segment;

[0025] Figure 5 The sequencing result of the genetic marker sequence of the present application; the sequencing results of three genotypes of American line, Danish line and French line, respectively, wherein there is a double-peak map, which is the mutation of base "G" to "T". DETAILED DESCRIPTION

[0026] Example 1: Identification of the genetic marker of the present application

[0027] The genotype data of the Danish line of large white pigs of a national core breeding farm in Shaoguan City, Guangdong Province was subjected to whole genome association analysis by using the univariate linear mixed model in Gemma software, the first three principal components were corrected in the model to control the population structure, and gender and batch were included as fixed effects, and the P value was 1.98x10 -6 .

[0028] Example 2: Obtaining of DNA fragment in the region of 26346101-26346700 of pig chromosome 3 and establishment of SNP detection method

[0029] The primer pair is designed according to the genomic sequence of the segment of 26346101-26346700 of pig chromosome 3, and the specific sequence is as follows:

[0030] Forward primer (SEQ ID NO. 2): 5'-GGTAATAGCATCAAGGTCAAGAGGA-3',

[0031] Reverse primer (SEQ ID NO. 3): 5'-AAGCGTCACAGCCAAGATGAT-3'.

[0032] The above primer pair is used for PCR amplification in the genomic DNA of pigs in different test populations.

[0033] The PCR reaction system is shown in Table 1.

[0034] Table 1 PCR reaction system

[0035] The PCR reaction conditions are shown in Table 2.

[0036] Table 2 PCR reaction conditions

[0037] After the obtained PCR product is purified and cloned, Wuhan Hechukong Gene Technology Co., Ltd. is entrusted to perform sequence determination. Through BLAST comparison and analysis, it is determined that there is a G / T mutation at the 402th base of the sequence. Further population genotyping results show that the site exhibits stable polymorphism in the populations of American Large White, Danish Large White and French Large White.

[0038] Example 3: Association analysis and application of genetic marker of the application to eye muscle area traits of different varieties of pigs

[0039] In order to determine the correlation between the SNP in the region of 26346101-26346700 of pig chromosome 3 and the difference in pig phenotype, American Large White (266) and French Large White (385) are selected as test materials in this embodiment. The polymorphism is detected by direct sequencing method, and the correlation between the polymorphic site and the eye muscle area trait of the pig is analyzed. The association between the genotype and the phenotype value is analyzed by using the mixed linear model (Mixed) in the SAS statistical software. The analysis model is as follows: ijkl Y = u + G i + F j + S k+B l +ε ijklm In the formula, Y ijkl G represents the observed trait value; u represents the overall trait mean; G represents the observed trait value. i This is a genotype effect; F j S k B l For fixed effects, ε represents pedigree, sex, and batch effects. ijklm The error is random, assumed to follow N~(0, σ). 2 )distributed.

[0040] Polymorphism detection was performed on the rs81329230 locus in the 26346101-26346700 region of pig chromosome 3, and three genotypes were detected in all of the above populations. The genotype frequencies and their distribution are shown in Table 3.

[0041] Table 3 Genotype and allele frequencies of polymorphic site rs81329230

[0042]

[0043] Table 3 shows that the frequency of the G allele at the polymorphic site rs81329230 is lower than that of the T allele in American Large White pigs, while it is higher in French Large White pigs. The Hardy-Weinberg equilibrium test results indicate that in American Large White (χ²)... 2 =0.779, P=0.38>0.05) and French Big White (χ²) 2 In the range of 3.120 (P=0.08>0.05), the genotype distribution of the polymorphic site rs81329230 conforms to the state of genetic equilibrium.

[0044] Table 4. Association analysis between the rs81329230 locus and in vivo ocular muscle area trait in American Large White pigs.

[0045]

[0046] Table 5. Association analysis between the rs81329230 locus and in vivo ocular muscle area trait in French Large White pigs.

[0047]

[0048] Note: The above values ​​are the least squares mean ± standard error; within each pig breed, the same letter in the same column indicates no significant difference (P>0.05), different letters indicate significant difference (P<0.05), uppercase letters indicate extremely significant difference (P<0.01), lowercase letters indicate significant difference (P<0.05), and no label indicates no significant difference (P>0.05). The number in parentheses indicates the number of pigs.

[0049] Analysis of Tables 4 and 5 revealed that the polymorphic locus rs81329230 was significantly correlated with the live eye muscle area trait in both American and French Large White pigs (P<0.05). Individuals with the GG genotype showed significantly larger live eye muscle areas than those with the TT genotype (P<0.05). From the perspective of synergistic optimization of genetic progress and genetic stability, the GG genotype has a clear advantage in increasing live eye muscle area. Based on these results, we hypothesize that the polymorphic locus rs81329230 can be used for marker-assisted selection to breed superior individuals with larger live eye muscle areas.

[0050] Main References

[0051] [1] Guo Jianfeng, Lin Haichao, Wang Jiying, Wang Yanping, Analysis of carcass properties, meat quality traits and their correlations of Yantai black pigs with different slaughter weights, Pig Farming (2020) 49-53.

[0052] [2] KG Friesen, JL Nelssen, RD Goodband, MD Tokach, JAUnruh, DH Kropf, BJ Kerr, The effect of dietary lysine on growth, carcasscomposition, and lipid metabolism in high-lean growth gilts fed from 72 to136 kilograms, Journal of Animal Science 73 (1995) 3392-3401.

[0053] [3] Y. He, J. Ma, F. Zhang, L. Hou, H. Chen, Y. Guo, Z. Zhang, Multi-breed genome-wide association study reveals heterogeneous loci associated with loin eye area in pigs, J Appl Genet 57 (2016) 511-518.

[0054] [4] He, Deng, Lixin. Ultrasound measurement technique for ocular muscle area and backfat thickness in pigs. Chinese Journal of Veterinary Medicine (2000) 55.

[0055] [5] Tang Xiang, He Jun, Jiang Juan, Research progress of genome-wide association analysis in livestock and poultry, Animal Husbandry & Veterinary Medicine 52 (2020) 147-152.

[0056] SEQ ID NO.1 GGTAATAGCATCAAGGTCAAGAGGATGGCGCTTGAAGCCAAGGGTTTGAACCCCATCGAGCCCCTTCCTTCTTTCCTTCCTTCCTGCCTTCTTTGCTATTTAGGGCCCCACCTGCAGCATATGGAGGTTTCCAGGCTAGGGGTCTAATCGGAGCCACAGCTGCCAGCCTACACCACAGCCAGAGCCACGCTAGATCCGAGTCACATCTGCAACTTACACAGCTCACGGCAACGCCGGATCCTCAAGCCACTGAGCAAGGCCAGGGATCGAGCCCGTGTCCTCATGGATACTAGTCAGATTCATTTCCACTGAGCCACGACGGGAACTTTCCATCCACTTTCATGCTGGGTCGCAGAATCTGGCACAGCCGTCACTTCTAAGGTCTTGAAAACCAAAGTCTGRGCTGGAGCTCAGAGGAGCATCGGCTGATGGCTTCCGGAGGCAGCAGGGTTGGGGCTGGACATGGCCTCGGGAGGACCTGGCTTTCTTTGTTCCAAGTCAGGCTCCTTTCTCTGGTTTCAGTGCTGGGAGACCCAGGTAGGGCAGGAGATGTACAAGCTGATGATCTTCGACCTCATCATCATCTTGGCTGTGACGCTT。

Claims

1. A porcine ocular muscle area-related TMC7 gene SNP molecular marker, characterized in that, The SNP molecular marker is located at base 26346502 in the TMC7 gene on pig chromosome 3. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where R in the sequence is G or T.

2. The SNP molecular marker according to claim 1, characterized in that, The pigs mentioned include American Large White and French Large White pigs.

3. The SNP molecular marker according to claim 1, characterized in that, The primer pair sequences used to detect the SNP molecular marker are shown in SEQ ID NO. 2 and SEQ ID NO.

3.

4. The application of the SNP molecular marker according to claim 1 in improving the area trait of porcine ocular muscles, characterized in that, The R at position 402 in the nucleotide sequence of the SNP molecular marker represents an allelic substitution, which leads to polymorphism at that position.

5. The application of the SNP molecular marker according to claim 4 in improving the area trait of porcine ocular muscles, characterized in that, In this application, the GG genotype at the SNP locus has a larger eye muscle area than other genotypes.

6. A genotype for improving the area trait of pig eye muscles, characterized in that, The genotype is the GG genotype based on the SNP site described in claim 1.

Images